Search Strains

F13D2.2 Homozygous. Outer Left Sequence: aagcgggattcgaaggtatt. Outer Right Sequence: tcaaaacgttgcttgcattc. Inner Left Sequence: tgtcacagatagggaccgaa. Inner Right Sequence: ctagttgacggtagcaacgc. Inner Primer PCR Length: 1136. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54A5.1 Homozygous. Outer Left Sequence: atccgatcagttgctcaagg. Outer Right Sequence: gattagcagtcgatgacgca. Inner Left Sequence: tttcggcgagctggaagt. Inner Right Sequence: gaaacgacttgagggctgac. Inner Primer PCR Length: 1127. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y111B2A.3 Homozygous. Outer Left Sequence: accagccaccactcttatgg. Outer Right Sequence: gcatcttggtccagtgtcct. Inner Left Sequence: ctcaatgcctcaagaacttcg. Inner Right Sequence: tcctcaaacgccttcttcat. Inner Primer PCR Length: 1128. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC328.3 Homozygous. Outer Left Sequence: caattggcagctgaacttga. Outer Right Sequence: agttccatttctccacgcac. Inner Left Sequence: tgaaatccatgcagaatcca. Inner Right Sequence: gcttctactttgaaaaataacaacga. Inner Primer PCR Length: 1164. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13B12.4 Homozygous. Outer Left Sequence: gcgtcgactggtcaattttt. Outer Right Sequence: tcttcgcaatgcaaaagcta. Inner Left Sequence: agcaagcacaaaactcatgc. Inner Right Sequence: cgacaaaaaccacggattcta. Inner Primer PCR Length: 1126. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15B10.2 Homozygous. Outer Left Sequence: tcaccgatccagttgcatta. Outer Right Sequence: aacccaacagtatccctcca. Inner Left Sequence: taatgcttgttgctcatccg. Inner Right Sequence: acacgcaacgcagttttatt. Inner Primer PCR Length: 1136. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08G5.4 Homozygous. Outer Left Sequence: gagaaatagacaggtgcggc. Outer Right Sequence: gttgtggcactacaaggggt. Inner Left Sequence: aaaaatcaccattttgggca. Inner Right Sequence: ccgtgcaaatttctcactca. Inner Primer PCR Length: 1165. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39B6A.2 Homozygous. Outer Left Sequence: accggaaattgtcccaaaat. Outer Right Sequence: tttatcttccagccgtggac. Inner Left Sequence: aacagatgacattgtggcga. Inner Right Sequence: attgcggcttcaaacttctg. Inner Primer PCR Length: 1129. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y34B4A.4 Homozygous. Outer Left Sequence: ggtcttgccacgatttcagt. Outer Right Sequence: taaaaaccgctcaacctcca. Inner Left Sequence: agctgctgttcttgaagctg. Inner Right Sequence: gctcacattgcatcgtgtaaa. Inner Primer PCR Length: 1120. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K10B4.4 Homozygous. Outer Left Sequence: cggcttctgttgaggaagag. Outer Right Sequence: attcagtttggcggtttcag. Inner Left Sequence: tgtcaaacacgcttcgaact. Inner Right Sequence: cgcaaaatgttttagggctc. Inner Primer PCR Length: 1149. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F14B8.2 Homozygous. Outer Left Sequence: gaagcatggggaagaaatga. Outer Right Sequence: ttgctggcagaagttgtacg. Inner Left Sequence: tttgctcattttatgctcatttt. Inner Right Sequence: gccacatttcatgtatcgca. Inner Primer PCR Length: 1113. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02C12.4 Homozygous. Outer Left Sequence: gcgaaaggagcattcttcag. Outer Right Sequence: gaggaggaaaacgtggtgaa. Inner Left Sequence: aatttcttgatttcagccagc. Inner Right Sequence: caatggatcgaatggaacaa. Inner Primer PCR Length: 1189. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39H10A.3 Homozygous. Outer Left Sequence: agcgagaaattcacgatgct. Outer Right Sequence: ttcaaatttttcgcagtgga. Inner Left Sequence: gtgtgctccgaacgaaaagt. Inner Right Sequence: cccgtttttcgggatttt. Inner Primer PCR Length: 1157. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38F1A.3 Homozygous. Outer Left Sequence: atttgccgaagttgcatagg. Outer Right Sequence: ttcacaaaatgcgaccatct. Inner Left Sequence: aaatcacatttttcggagctt. Inner Right Sequence: tgaagaattctggcaaatatcg. Inner Primer PCR Length: 1129. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

EEED8.9 Homozygous. Outer Left Sequence: cgcaatagactggcatgaaa. Outer Right Sequence: ttccagatatccagatgccc. Inner Left Sequence: aattccattgattccatccg. Inner Right Sequence: cacactgcacgttggtatga. Inner Primer PCR Length: 1126. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R09B3.1 Homozygous. Outer Left Sequence: tgaaaaatttcaattccccg. Outer Right Sequence: cgaaaagcagaagaagcacc. Inner Left Sequence: cagcttccagacgagacctt. Inner Right Sequence: ctcgcctcgatcttcacaa. Inner Primer PCR Length: 1158. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17G1.3 Homozygous. Outer Left Sequence: cgtgacgctttagcatttca. Outer Right Sequence: tcattgatgccgatgaagaa. Inner Left Sequence: ttgatcagcgaatattggga. Inner Right Sequence: atgcacattctcatcttgcg. Inner Primer PCR Length: 1197. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R09B3.1 Homozygous. Outer Left Sequence: tgaaaaatttcaattccccg. Outer Right Sequence: cgaaaagcagaagaagcacc. Inner Left Sequence: cagcttccagacgagacctt. Inner Right Sequence: ctcgcctcgatcttcacaa. Inner Primer PCR Length: 1158. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07G3.6 Homozygous. Outer Left Sequence: aattggatcaattgaaggcg. Outer Right Sequence: acccaattgcccatgaacta. Inner Left Sequence: cgcaacgaggtacgtatgaa. Inner Right Sequence: gcagcgatatcaacgacaag. Inner Primer PCR Length: 1185. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F38E9.5 Homozygous. Outer Left Sequence: gctttggactagcatccgtt. Outer Right Sequence: gtgacagacgcggaagtttt. Inner Left Sequence: tcctcctttgtaccgtaacga. Inner Right Sequence: aggtgtatcgtggcttgtca. Inner Primer PCR Length: 1132. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y45F10B.10 Homozygous. Outer Left Sequence: gcagcaggcataaagtaggc. Outer Right Sequence: aatagccaacgtgctaaccg. Inner Left Sequence: tctcgcagggtataaaacgg. Inner Right Sequence: gagccatcaatcctcccat. Inner Primer PCR Length: 1127. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T11F9.3 Homozygous. Outer Left Sequence: cctgatgcatcccattcttt. Outer Right Sequence: tcattgtccatgcgtaaagc. Inner Left Sequence: tgctgatcgcataattgacc. Inner Right Sequence: tgcaaatgcgacgaataaaa. Inner Primer PCR Length: 1156. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R09E12.2 Homozygous. Outer Left Sequence: ttgctggaatcgaattttcc. Outer Right Sequence: gtgtcgttctgctcatcgaa. Inner Left Sequence: caaactgccggagttgaaat. Inner Right Sequence: ggcacaacttgcttgctattc. Inner Primer PCR Length: 1189. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02G5.7 Homozygous. Outer Left Sequence: cagtctatcgcaatgtcgga. Outer Right Sequence: ggagttgacgattcggagac. Inner Left Sequence: ccgaggatctttcgctaactt. Inner Right Sequence: tttccgaaaacgctcactg. Inner Primer PCR Length: 1134. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R02F2.4 Homozygous. Outer Left Sequence: gcgagagtctcaaagatggc. Outer Right Sequence: agtttcatccgtttcgcatc. Inner Left Sequence: tctactcctccggcacttg. Inner Right Sequence: aacttgaacggcccgatac. Inner Primer PCR Length: 1176. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK6.7 Homozygous. Outer Left Sequence: ccaaatggcaagagacctgt. Outer Right Sequence: ctcaaggtgtgaaggtgcaa. Inner Left Sequence: cttcatgcaacacggcct. Inner Right Sequence: agcttgatagccggacgata. Inner Primer PCR Length: 1147. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y56A3A.13 Homozygous. Outer Left Sequence: cgacttgagctacgtggaca. Outer Right Sequence: catcgcatctcttgtagcca. Inner Left Sequence: tcttcgtgaaatgcaaccag. Inner Right Sequence: tgcgaaattttgggattttg. Inner Primer PCR Length: 1134. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y56A3A.29 Homozygous. Outer Left Sequence: aatcgtctctggctctctgg. Outer Right Sequence: cggtttgcctgcaaataact. Inner Left Sequence: gagcaaacccctgaattttt. Inner Right Sequence: cgaataatttcccatttttgtga. Inner Primer PCR Length: 1166. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11A6.2 Homozygous. Outer Left Sequence: actaacaaatggggcagcac. Outer Right Sequence: gcgagctttgaacttttgct. Inner Left Sequence: caaaaatgttgctcccatca. Inner Right Sequence: ttttctttcagttcagcccc. Inner Primer PCR Length: 1196. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK353.7 Homozygous. Outer Left Sequence: gcgtgtttgcatacattcgt. Outer Right Sequence: tacaactcggagggctcact. Inner Left Sequence: aaccctcacaatcccgtaga. Inner Right Sequence: ccgtcggatttgtgtctattc. Inner Primer PCR Length: 1143. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11A6.2 Homozygous. Outer Left Sequence: actaacaaatggggcagcac. Outer Right Sequence: gcgagctttgaacttttgct. Inner Left Sequence: caaaaatgttgctcccatca. Inner Right Sequence: ttttctttcagttcagcccc. Inner Primer PCR Length: 1196. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08E3.4 Homozygous. Outer Left Sequence: caacttgagacatggtgcgt. Outer Right Sequence: atgtctgttgctctttgcca. Inner Left Sequence: gccaagaccacattgagaca. Inner Right Sequence: tctctacgaagttctcgacaaaaa. Inner Primer PCR Length: 1155. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01G10.1 Homozygous. Outer Left Sequence: gtggacatcccacgtcttct. Outer Right Sequence: ttgctcctgggatagtacgg. Inner Left Sequence: aagtacgatgtcgcagagcc. Inner Right Sequence: caattgagactccgacgtga. Inner Primer PCR Length: 1147. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54F6.14 Homozygous. Outer Left Sequence: atgtgtctcagatttccgcc. Outer Right Sequence: gaaccctttcgttgccaata. Inner Left Sequence: ggttgaacctttttaggaactgc. Inner Right Sequence: acagtcccggacacgtaatc. Inner Primer PCR Length: 1178. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32D1.4 Homozygous. Outer Left Sequence: atatgccaagcaaatctggc. Outer Right Sequence: gaaatttgtcggattcaccg. Inner Left Sequence: aaatcgaattggctgcagat. Inner Right Sequence: ccagtttcagtcgttcccat. Inner Primer PCR Length: 1107. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H06O01.2 Homozygous. Outer Left Sequence: gggaagattggggaaaagaa. Outer Right Sequence: tgcacaaaaagcttgaacca. Inner Left Sequence: catcgaaaactttcggaatga. Inner Right Sequence: ggctcaccagaagcagtttt. Inner Primer PCR Length: 1197. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40D4.1 Homozygous. Outer Left Sequence: gcaattcattccgctctttc. Outer Right Sequence: tagtcgagcacatgagtggc. Inner Left Sequence: cggacagcagaagctcactt. Inner Right Sequence: acgatacggtgtatgcacga. Inner Primer PCR Length: 1133. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6G.2 Homozygous. Outer Left Sequence: cccatacgtactcggagcat. Outer Right Sequence: aatagctctgcaccggaaga. Inner Left Sequence: cttccagcacgaagaagcat. Inner Right Sequence: tgcaacgagaagatcgagtg. Inner Primer PCR Length: 1136. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27E9.4 Homozygous. Outer Left Sequence: gaatgttcgcatctgacgtg. Outer Right Sequence: cgcagcgacatacacttgtt. Inner Left Sequence: attgcgaaaatccccctcta. Inner Right Sequence: aatctttaaaggcgcacacg. Inner Primer PCR Length: 1148. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01G10.8 Homozygous. Outer Left Sequence:ccaaccgacttccttgttgt . Outer Right Sequence: attcgttcatcagccacctc. Inner Left Sequence: ggctgcggggaattatatgt. Inner Right Sequence: tccgagagccaatgttttct. Inner Primer PCR Length: 1192. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y105C5B.12 Homozygous. Outer Left Sequence: cattgtgtccaaagtgtccg. Outer Right Sequence: ctgatttctggctctacggg. Inner Left Sequence: gcggttggttcataaattgg. Inner Right Sequence: ggtgagatcacctcgaaagc. Inner Primer PCR Length: 1118. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R03A10.6 Homozygous. Outer Left Sequence: gtcggacgcacagctaagtt. Outer Right Sequence: ggccccaaactacaaacaaa. Inner Left Sequence: gtccgacaatttttgggttc. Inner Right Sequence: aagcatgctccttcttctcg. Inner Primer PCR Length: 1179. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73B3B.2 Homozygous. Outer Left Sequence: tgaaaacgtgctcgtacacc. Outer Right Sequence: atgactacggtagatggcgg. Inner Left Sequence: tcgtgcaaagtttgagcatt. Inner Right Sequence: ggaccgaaacatttttgcat. Inner Primer PCR Length: 1130. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y110A7A.10. Homozygous. Outer Left Sequence: GGACTCCGAGCTACTCAACG. Outer Right Sequence: ATGGGGGACAAGTGGATGTA. Inner Left Sequence: AATGAGCTTGTCGAGGAGGA. Inner Right Sequence: GGAGATGGAGAATCCCATGA. Inner primer WT PCR product: 2661. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11A5.1A. Homozygous. Outer Left Sequence: cgatatgccgaagaacaaca. Outer Right Sequence: caacagaaactcgtgctcca. Inner Left Sequence: tggaagtgctctccgagttt. Inner Right Sequence: tttcccttcacatcgagacc. Inner primer WT PCR product: 2880. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y57G11C.24c. Homozygous. Outer Left Sequence: TGGAAAGGGAGAGTCGTTTG. Outer Right Sequence: ACCAACCTGCTTCTGCTGTT. Inner Left Sequence: TCTCCACCACCACAACGTAA. Inner Right Sequence: GCGGAGCAACTCTTCCATAG. Inner primer WT PCR product: 2814. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11D5.3. Homozygous. Outer Left Sequence: GTTCAAAAAGAGCGCAAAGG. Outer Right Sequence: CAACCAATTCGGGAAAGAAA. Inner Left Sequence: TTTTCCTCGGCTACTGTGCT. Inner Right Sequence: GGACAATTTGAGCGGAGATG. Inner primer WT PCR product: 3007. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y77E11A.5. Homozygous. Outer Left Sequence: AGGCTCACCAAGAGCTTCAA. Outer Right Sequence:AGTAACCCGAGAATTTCGCA . Inner Left Sequence: TCAATTCGAAGCCCTTTCAC. Inner Right Sequence: CATTGATGAAACCTTCCCGT. Inner primer WT PCR product: 2853. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F12B6.1. Homozygous. Outer Left Sequence: TGTCCTGGCCTAATTTTTGC. Outer Right Sequence: AAATGCCACGTATAATGCCC. Inner Left Sequence: GGCTCCACAGCAAATGAGAT. Inner Right Sequence: ACTGGAAATGGAACGAGACG. Inner Primer WT PCR Product: 2966. Deletion size: 1152 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y32F6B.3. Homozygous. Outer Left Sequence: CCCATTCTCGTCCACTTTGT. Outer Right Sequence: GTGATCCCATTCCAAAATGC. Inner Left Sequence: GAAGACAACGCCTCTGGAAG. Inner Right Sequence: AGGAAAATGGGTGAGCAATG. Inner primer WT PCR product: 2112. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807