Search Strains

R03G8.4. Homozygous. Outer Left Sequence: tgaggattttctggacctgg. Outer Right Sequence: cagagcggtaacgagctagg. Inner Left Sequence: gcattgaatcctcatttaggc. Inner Right Sequence: ctcacggtgcaattggaaat. Inner Primer PCR Length: 1169. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C42D4.9 Homozygous. Outer Left Sequence: tgtaacacggcaggttcaaa. Outer Right Sequence: acattccgttttccatttgc. Inner Left Sequence: ttggcgccacttcttcttta. Inner Right Sequence: ccagactgtccaaaatccaga. Inner Primer PCR Length: 1146. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11E3.4 Homozygous. Outer Left Sequence: gatgtttgaaaggcttggga. Outer Right Sequence: cggtgaaactcacaggacaa. Inner Left Sequence: tcattaacatgagctactcgtcg. Inner Right Sequence: gctttccttgtgcctacacc. Inner Primer PCR Length: 1178. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F47G4.6 Homozygous. Outer Left Sequence: ttttgcggaatcctcagttt. Outer Right Sequence: ggggtacttaccaggggtgt. Inner Left Sequence: aaacttgaaattttcggttcca. Inner Right Sequence: tcaatatttgccgagcacag. Inner Primer PCR Length: 1199. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C56E6.6 Homozygous. Outer Left Sequence: tctaattgatttcccgccag. Outer Right Sequence: cgatgttctgcgttccaata. Inner Left Sequence: aggtgttgcaatttcggaag. Inner Right Sequence: tgtcgttctaatgctggcaa. Inner Primer PCR Length: 1117. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F14H12.6 Homozygous. Outer Left Sequence: ggaaatgccaaggcagatta. Outer Right Sequence: tccaacacgaaaatgtgagc. Inner Left Sequence: tttccgtgttttaagataagaacaaa. Inner Right Sequence: ctaaccttctgcatcctcgc. Inner Primer PCR Length: 1196. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E03G2.3 Homozygous. Outer Left Sequence: tagttttcgagatacgggcg. Outer Right Sequence: aaataaaaacgtgcaagcgg. Inner Left Sequence: ttgtcaaaaacggactcacg. Inner Right Sequence: tgttcccaatctccatcaca. Inner Primer PCR Length: 1126. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06E7.3 Homozygous. Outer Left Sequence: gtgggggctactgattttga. Outer Right Sequence: gttctcgtccgaaacgtcat. Inner Left Sequence: agctggtccttgtgatttgg. Inner Right Sequence: acgatgattcctcgaaaggt. Inner Primer PCR Length: 1141. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11A8.5 Homozygous. Outer Left Sequence: gccaccattcagcaattttt. Outer Right Sequence: accgatccgttgtgtttttc. Inner Left Sequence: tgaacgctgagcatccatag. Inner Right Sequence: cgcccgttttcttttaatg. Inner Primer PCR Length: 1218. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08E4.2 Homozygous. Outer Left Sequence: aactccaatgaaaccgcaac. Outer Right Sequence: ttttctctgtgccctccagt. Inner Left Sequence: ctgcaaaatgcatagcgaaa. Inner Right Sequence: tgtttgttctgatacatggcaa. Inner Primer PCR Length: 1164. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K09C8.2 Homozygous. Outer Left Sequence: acacgaggcccactgtaatc. Outer Right Sequence: cgttcaaacacaaccacctg. Inner Left Sequence: cgtaaggaacgagggatcaa. Inner Right Sequence: cggtctccctatcttcacca. Inner Primer PCR Length: 1171. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02C1.1 Homozygous. Outer Left Sequence: tgttcttctttccctcccct. Outer Right Sequence: tcgagaatcattcaacgcaa. Inner Left Sequence: cctttcgttcttaccttccg. Inner Right Sequence: ggtaaacaaaaagtggacaatgg. Inner Primer PCR Length: 1166. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R10D12.14 Homozygous. Outer Left Sequence: aagagcgagatgacgaggaa. Outer Right Sequence: accatttgtccgagcaactc. Inner Left Sequence: gacatcaaaataccgacggc. Inner Right Sequence: gaacacgagaagcctgttcc. Inner Primer PCR Length: 1196. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T11F9.5 Homozygous. Outer Left Sequence: ccactttgcataatctcgca. Outer Right Sequence: catatagcccgcatccaaat. Inner Left Sequence: tccaatcagagctacgagca. Inner Right Sequence: tgattctacaatgacagctggttt. Inner Primer PCR Length: 1244. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C24G6.3 Homozygous. Outer Left Sequence: aaaattggattttggagggg. Outer Right Sequence: gccattattgccgattttct. Inner Left Sequence: tctttgacggtttttctgaatg. Inner Right Sequence: tttgaaaagttaaaaacatacagatgc. Inner Primer PCR Length: 1193. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59A7.9 Homozygous. Outer Left Sequence: cctacacctgcctacttgcc. Outer Right Sequence: ccctacagtactccggcaga. Inner Left Sequence: ctaccaaagacgccttaccg. Inner Right Sequence: ttctccaatcaactacctccaa. Inner Primer PCR Length: 1194. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T13B5.8 Homozygous. Outer Left Sequence: tgcaaatcagctctaatgcg. Outer Right Sequence: ggtggccgagtctaaagtca. Inner Left Sequence: aagtgtttcaagtgcgctcc. Inner Right Sequence: ccagttttccgtcgattttc. Inner Primer PCR Length: 1164. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13D2.2 Homozygous. Outer Left Sequence: aagcgggattcgaaggtatt. Outer Right Sequence: tcaaaacgttgcttgcattc. Inner Left Sequence: tgtcacagatagggaccgaa. Inner Right Sequence: ctagttgacggtagcaacgc. Inner Primer PCR Length: 1136. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01B12.3 Homozygous. Outer Left Sequence: aaccatttccctcatttcca. Outer Right Sequence: tcatcatcctctcccaaagg. Inner Left Sequence: tcactcgatgttgcttcttctt. Inner Right Sequence: gagaagcacttcggcaactt. Inner Primer PCR Length: 1105. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T03F1.1 Homozygous. Outer Left Sequence: tttaaaccgccttggaaatg. Outer Right Sequence: agtgtgatggaaggcgagag. Inner Left Sequence: gaaagaccaccctctggagtc. Inner Right Sequence: gctccgactcatttaccagc. Inner Primer PCR Length: 1112. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54B8.5 Homozygous. Outer Left Sequence: tgcgaaacattccacagaaa. Outer Right Sequence: agatggcagacacgaagaca. Inner Left Sequence: agtttccagaagtcatgccc. Inner Right Sequence: cacagagtacgcttgcaaaa. Inner Primer PCR Length: 1126. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.3 Homozygous. Outer Left Sequence: tggtcaagaacgtgctgaag. Outer Right Sequence: cagatcggcaattcggtaat. Inner Left Sequence: atcaaaccgtaacgggacag. Inner Right Sequence: tcagcagttatccaactccaaa. Inner Primer PCR Length: 1196. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08D8.2Homozygous. Outer Left Sequence: ttacagaggcaatgcacgag. Outer Right Sequence: aaccggggatatcatcacaa. Inner Left Sequence: ccgaattgtttcttgggatg. Inner Right Sequence: tacaatccgttgcgtcaaaa. Inner Primer PCR Length: 1182. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C42D4.9 Homozygous. Outer Left Sequence: tgtaacacggcaggttcaaa. Outer Right Sequence: acattccgttttccatttgc. Inner Left Sequence: ttggcgccacttcttcttta. Inner Right Sequence:ccagactgtccaaaatccaga . Inner Primer PCR Length: 1146. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T24C12.3 Homozygous. Outer Left Sequence: cttatgccataccccctcaa. Outer Right Sequence: cgcaaagtgcttgatttgaa. Inner Left Sequence: tatcgcatcagaaattgcca. Inner Right Sequence: gctattggcgatgacaacaa. Inner Primer PCR Length: 1135. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34D1.1 Homozygous. Outer Left Sequence: ctgtctgctgagcattgagc. Outer Right Sequence: gagacatgcacactagccga. Inner Left Sequence: gtctggcttgtcaccactga. Inner Right Sequence: gagagaagcaaaagggggag. Inner Primer PCR Length: 1136. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11A3.1 Homozygous. Outer Left Sequence: tgatccaaattgggactgct. Outer Right Sequence: ggattttgtggaaagcaagc. Inner Left Sequence: gaaagctctcttgtttcttcca. Inner Right Sequence: tttgtcaaactgtgccgatt. Inner Primer PCR Length: 1276. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F08C6.6 Homozygous. Outer Left Sequence: cacaaattggaaagcagcaa. Outer Right Sequence: aagcaaatgcaatttgggac. Inner Left Sequence: attctccgatcctactcgca. Inner Right Sequence: ttcttttcgggtttgtgacc. Inner Primer PCR Length: 1136. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44D12.3 Homozygous. Outer Left Sequence: acaaataattctgcgggacg. Outer Right Sequence: acctcttccacgtcttctcg. Inner Left Sequence: tcttcaaaaactcgctgtgg. Inner Right Sequence: cacgaaaggtcactggttca. Inner Primer PCR Length: 1142. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46H5.6 Homozygous. Outer Left Sequence: tccgcgaaatctgataatcc. Outer Right Sequence: cctctcccccatcttttctc. Inner Left Sequence: ttatcctgaaggtcgttcgc. Inner Right Sequence: tgccgctgaagagtacaaaa. Inner Primer PCR Length: 1138. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F39D8.4 Homozygous. Outer Left Sequence: ttttgggaagtggagcaatc. Outer Right Sequence: ttgtgtctgcctactgctgg. Inner Left Sequence: tgaatgcagttggagcgtag. Inner Right Sequence: ccttctccacccttcctctt. Inner Primer PCR Length: 1128. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T25B6.2 Homozygous. Outer Left Sequence: tgcatggatcttctcactgc. Outer Right Sequence: tctgggtacattgggctacc. Inner Left Sequence: gccatacggaactggatacg. Inner Right Sequence: aacctggttggttctgcatt. Inner Primer PCR Length: 1196. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F36F2.5 Homozygous. Outer Left Sequence: cgccaagaagtgaagattcc. Outer Right Sequence: acgcttgtaatgccgaaagt. Inner Left Sequence: gcaaatgcttcaaaagagcc. Inner Right Sequence: gagtccgagcaattctgaaaa. Inner Primer PCR Length: 1121. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K03B8.1 Homozygous. Outer Left Sequence: catatgtccagcgttccaaa. Outer Right Sequence: ggtcactttgtttttcccga. Inner Left Sequence: ggaacccgtcagaaaagaca. Inner Right Sequence: ttggatgggtccacttgatt. Inner Primer PCR Length: 1184. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28D1.2 Homozygous. Outer Left Sequence: cctcttctccctcctcatca. Outer Right Sequence: tcatttcactcgcacaggtc. Inner Left Sequence: ttcaacctcgtagttctcctcc. Inner Right Sequence: cgactggttgtcaccctttt. Inner Primer PCR Length: 1189. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R08C7.12 Homozygous. Outer Left Sequence: aaacttccggcaaattgatg. Outer Right Sequence: aggcttaggcttaggcttgg. Inner Left Sequence: acggcagagttggcaattt. Inner Right Sequence: cagtcattctttgcgcttca. Inner Primer PCR Length: 1119. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y95B8A.10 Homozygous. Outer Left Sequence: actcctcaacaatccgatgc. Outer Right Sequence: tacaaaaacacggccacaaa. Inner Left Sequence: gctgacacaatccccactct. Inner Right Sequence: cttaaagatctcggccacca. Inner Primer PCR Length: 1161. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK970.1 Homozygous. Outer Left Sequence: acgaatcgaatggaatctgc. Outer Right Sequence: attgttttgggcaggagttg. Inner Left Sequence: ttatgtgctggaaccgaaatc. Inner Right Sequence: gcaacttcctatccttctggc. Inner Primer PCR Length: 1112. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M28.2 Homozygous. Outer Left Sequence: actgccctggttttggtaaa. Outer Right Sequence: atcttcaattcccggttgtg. Inner Left Sequence: tccttcacctcgattgcttt. Inner Right Sequence: ccaaagttttgtaattttcttccaa. Inner Primer PCR Length: 1146. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08D8.2 Homozygous. Outer Left Sequence: ttacagaggcaatgcacgag. Outer Right Sequence: aaccggggatatcatcacaa. Inner Left Sequence: ccgaattgtttcttgggatg. Inner Right Sequence: tacaatccgttgcgtcaaaa. Inner Primer PCR Length: 1182. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35E12.5 Homozygous. Outer Left Sequence: tccatcgcaaatgattgtgt. Outer Right Sequence: taatgccgataaaagtgggc. Inner Left Sequence: tgcatcagcattatcatggaa. Inner Right Sequence: ataaaaggagcgacggacac. Inner Primer PCR Length: 1149. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57F5.1 Homozygous. Outer Left Sequence: ccggagctagtagcgaaatg. Outer Right Sequence: caattttggaattcctccga. Inner Left Sequence: ctcttcttgtcggccttgtc. Inner Right Sequence: cctcaattccgcactcgtta. Inner Primer PCR Length: 1100. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02G5.3 Homozygous. Outer Left Sequence: ccgaatgcctgaatatcaca. Outer Right Sequence: tcgtcctcttccacttttgg. Inner Left Sequence: tctaactatgctcggccacc. Inner Right Sequence: tccgagaccggctaccttat. Inner Primer PCR Length: 1158. Deletion size: about 500bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W02C12.1 Homozygous. Outer Left Sequence: gaaaacctctgcgcatcttc. Outer Right Sequence: gtcttggactgccaggtgat. Inner Left Sequence: gtgttcacggactgtgcatc. Inner Right Sequence: atgcaaagaaaagaatgccg. Inner Primer PCR Length: 1156. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y11D7A.4 Homozygous. Outer Left Sequence: tatgaggcgtctgattgctg. Outer Right Sequence: ggccatggatggagagtaaa. Inner Left Sequence: cgatgaactgaccttaggctg. Inner Right Sequence: ggagatggagcaagtggaaa. Inner Primer PCR Length: 1145. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y9C9A.16 Homozygous. Outer Left Sequence: gtcgacagttttcaagtgcg. Outer Right Sequence: ctcgaaaacttccaagtggc. Inner Left Sequence: tgatgcagctgtttttgcat. Inner Right Sequence: tgtcggtggaggtctaatga. Inner Primer PCR Length: 1187. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3C.1 Homozygous. Outer Left Sequence: ggaattgagcatgtcaagca. Outer Right Sequence: gggaattcaccgaaaatcaa. Inner Left Sequence: tgccgacatacaacaagttca. Inner Right Sequence: caaatcggcaaatcggtaat. Inner Primer PCR Length: 1117. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F37C4.5 Homozygous. Outer Left Sequence: tctgtggatcttggcaactg. Outer Right Sequence: ttttcagaacctcccattcg. Inner Left Sequence: atggtgagaagcaccgagtt. Inner Right Sequence: tctcgcaattaaggcgatct. Inner Primer PCR Length: 1166. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3C.1 Homozygous. Outer Left Sequence: ggaattgagcatgtcaagca. Outer Right Sequence: gggaattcaccgaaaatcaa. Inner Left Sequence: tgccgacatacaacaagttca. Inner Right Sequence: caaatcggcaaatcggtaat. Inner Primer PCR Length: 1117. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27F2.4 Homozygous. Outer Left Sequence: gactcccgtggagaatcaaa. Outer Right Sequence: tgagatcgagtttttgtgcg. Inner Left Sequence: ggtctcgacgcgactaattt. Inner Right Sequence: tgttccactcaacccatcaa. Inner Primer PCR Length: 1172. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807