Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB1725 C. elegans ZK1025.7(ok2197) I. Show Description
ZK1025.7. Homozygous. Outer Left Sequence: AACTCGATTACACCGATGCC. Outer Right Sequence: GGAGATCATTTCCGCGATTA. Inner Left Sequence: TTCTTCGGAGACTTCACGGT. Inner Right Sequence: GCCGATTTGTACAGCCCTAA. Inner Primer PCR Length: 2643 bp. Deletion Size: 1741 bp. Deletion left flank: CATGCGTTAAACCGAATACCTATCTACTAA. Deletion right flank: CACGGTCACAGGAGTGGAAATAGTTTCTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1731 C. elegans T21B10.1&enol-1(ok2210) II. Show Description
T21B10.1, T21B10.2. Homozygous. Outer Left Sequence: GTCGAAGCTCAAAAGGTTGC. Outer Right Sequence: GAAAGAGTGACGAAGGTCGC. Inner Left Sequence: GTCACAAGACTCCGTGCAGA. Inner Right Sequence: CATGCCGAGAAGAAAAGAGG. Inner Primer PCR Length: 2467 bp. Deletion Size: 1161 bp. Deletion left flank: GAGAATCCACACAAGTTACTGCTTCAGCTG. Deletion right flank: TAATGGGGTCTGCCGTGCCTTTTTTCCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1732 C. elegans E01G4.3(ok2211) II. Show Description
E01G4.3. Homozygous. Outer Left Sequence: CACAAATACGTTGGCATTCG. Outer Right Sequence: GATTGCCGATTTGCCTTAAA. Inner Left Sequence: CTGATGCTGTTGCTGGTGTT. Inner Right Sequence: GAGAAACGGCAAGCAAACTC. Inner Primer PCR Length: 2562 bp. Deletion Size: 1076 bp. Deletion left flank: CCCGAAATCATTGGCGAGGTGAGGTGGCGG. Deletion right flank: CTTTTTATCAGGTGAAAAAAAAATAATTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1735 C. elegans F35E12.8(ok2220) V. Show Description
F35E12.8. Homozygous. Outer Left Sequence: TGAAAAAGCTGTGCAAGTGG. Outer Right Sequence: GGGCAGTTTCCAAATCTCAA. Inner Left Sequence: GCAGCACAATGAATCTGGAA. Inner Right Sequence: AGTTTGATTGGCCAAAGTGC. Inner Primer PCR Length: 3078 bp. Deletion Size: 1014 bp. Deletion left flank: AAATTCAAATCAGTGAGATAAACCATACTA. Deletion right flank: AATTCAAAACATATTTTAGAAAGTTATCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1736 C. elegans F55F8.9(ok2221) I. Show Description
F55F8.9. Homozygous. Outer Left Sequence: CAGAAATCGAGCGTCTCACA. Outer Right Sequence: GAGTGTCGTTGCGAGATTCA. Inner Left Sequence: AAATGTGGTTCTGTCGAGCC. Inner Right Sequence: CATTCGATAGCCGTTGGTTT. Inner Primer PCR Length: 3096 bp. Deletion Size: 950 bp. Deletion left flank: TCCGTTCAAAGTGCTACCGTATGATGAGAA. Deletion right flank: GTGACCATGTCCATGTCCATGAGCAAATGA. Insertion Sequence: AATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1741 C. elegans C39F7.2(ok2226) V. Show Description
C39F7.2. Homozygous. Outer Left Sequence: CTGAGCCTAAACCGAACCAA. Outer Right Sequence: ATAGATTGTGTGGTGGGGGA. Inner Left Sequence: AAGCCTAAGCCAAAGCCTTC. Inner Right Sequence: GATCCAGGTTAGGTGTCGGA. Inner Primer PCR Length: 3282 bp. Deletion Size: 2315 bp. Deletion left flank: TAGCGTCAGTAGCGAGCTCACGCTCGCCAC. Deletion right flank: CTGTTCCCGCTACAAAAAGTTTCTTTTACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1743 C. elegans C33H5(ok2228) IV. Show Description
C33H5. Homozygous. Outer Left Sequence: AAGGAGAAAGTGGCAGCAAA. Outer Right Sequence: CAGACGGACCACCAGTACCT. Inner Left Sequence: CAATGCAGGCACAAGAAGAA. Inner Right Sequence: TCGCCTGGTCATATCAATCA. Inner Primer PCR Length: 2211 bp. Deletion Size: 1217 bp. Deletion left flank: ACTTGGAGTAAATTTTAAACTGCTATATTA. Deletion right flank: TTATCTGTCCTTGATATCCTTGATATGAGT. Insertion Sequence: TATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1745 C. elegans clec-66(ok2230) II. Show Description
F35C5.9. Homozygous. Outer Left Sequence: GCCTCCAATCGTCATTTGTT. Outer Right Sequence: AAACATTGCCGTTCTGCTTT. Inner Left Sequence: ATAAAAGAGCCTGGCGTGAA. Inner Right Sequence: GAGCCCCTTTTGAAGGCTAT. Inner Primer PCR Length: 2401 bp. Deletion Size: 1187 bp. Deletion left flank: CCTCACCATCCCAAGCAGTCACCGATCGAT. Deletion right flank: TTGCCGATTCGTTTGCCGCGCACCCCTGGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1746 C. elegans C15F1.5(ok2231) II. Show Description
C15F1.5. Homozygous. Outer Left Sequence: CACTCCGACAACAGGCAGTA. Outer Right Sequence: AGCACCGCAACTACCTCAAG. Inner Left Sequence: CGGAGTGTCGTTAGCCAGAT. Inner Right Sequence: GCCATCGTTCCATTTGTTCT. Inner Primer PCR Length: 3106 bp. Deletion Size: 1194 bp. Deletion left flank: TGTGTAATTAAATGAGCCGAAAAACTATAC. Deletion right flank: AACCAAGACTTGCAACATTTTTCAAGCAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1748 C. elegans eat-4&ZK512.7(ok2233) III. Show Description
ZK512.6, ZK512.7. Homozygous. Outer Left Sequence: ACAAATGGTTGGAGAGCCAC. Outer Right Sequence: ATGCAGCTTCTCCTCCAAAA. Inner Left Sequence: AGCCCAACACAACAAAAAGG. Inner Right Sequence: GGATCTTGTTGGATCGGAGA. Inner Primer PCR Length: 3386 bp. Deletion Size: 1329 bp. Deletion left flank: TACAGCACTCTTTTTTCAGGGAGTTTGTTA. Deletion right flank: GTGCTAAAATGCCTGAATATCGTAGTAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1749 C. elegans numr-1(ok2239) III. Show Description
F08F8.5. Homozygous. Outer Left Sequence: CACAAAGAGCATGCCTTGAA. Outer Right Sequence: GGTCTGAAATCTGGAGAGCG. Inner Left Sequence: GACAAAATGCGGAACGTCTT. Inner Right Sequence: GTTTGCAGATCCCAATTCGT. Inner Primer PCR Length: 2296 bp. Deletion Size: 975 bp. Deletion left flank: CGTAAATGAAAACAAATTTTGATGGAGATT. Deletion right flank: CTGAGACATTGAAATCAAATTTCCTTTGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1751 C. elegans H08M01.2(ok2241) IV. Show Description
H08M01.2 Homozygous. Outer Left Sequence: tggagcaagattctcagcaa. Outer Right Sequence: ccaactccggctaaatgttc. Inner Left Sequence: tgatggacaggttcaaccaa. Inner Right Sequence: accgtttctcaacttctgcc. Inner Primer PCR Length: 3276. Deletion size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1752 C. elegans E01G4.3(ok2242) II. Show Description
E01G4.3. Homozygous. Outer Left Sequence: CACAAATACGTTGGCATTCG. Outer Right Sequence: GATTGCCGATTTGCCTTAAA. Inner Left Sequence: CTGATGCTGTTGCTGGTGTT. Inner Right Sequence: GAGAAACGGCAAGCAAACTC. Inner Primer PCR Length: 2562 bp. Deletion Size: 1672 bp. Deletion left flank: AATTCCGAAAAAATCCCGAATACCCTGCGG. Deletion right flank: CAAAGATCTCCGTATCACTGACAAAAAGAT. Insertion Sequence: TCTCCGTATCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1753 C. elegans fbxb-56(ok2243) I. Show Description
YY63D3A.10. Homozygous. Outer Left Sequence: AGGTGGAAGGGATGGCTATT. Outer Right Sequence: GCTTCCTTGACTCTCCGTTG. Inner Left Sequence: GAAATTTGCACTCCAGGGAA. Inner Right Sequence: TAGTCTGGAAGGAGCGCTGT. Inner Primer PCR Length: 3267 bp. NOTE: External left primer occurs twice in Y63D3A, once at coordinate 1234 and once at coordinate 3721, giving external WT products of 3493 and 1006 bp respectively. Shorter product is apparently preferred in PCR. Reactions on mutant template using ok2243_external primers thus primarily gives a product from EL(3721) and ER. Nested amplification on this product using ok2243_internal primers appears to give a product from EL(3721) (remaining primer from the external round passed to internal round by product transfer) and IR. Deletion Size: 219 bp. Deletion left flank: CCACTTCAGTCTTGATGCTGCGCTCGTGCC. Deletion right flank: TGTCACTAGCTCTATATTCAAGTCTCCTCG. Insertion Sequence: TTTTGTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1754 C. elegans Y32B12A.3(ok2244) V. Show Description
Y32B12A.3. Homozygous. Outer Left Sequence: GGTGTGCCATTAGGCATTTT. Outer Right Sequence: GAATCGGATCAGTGGAGGAA. Inner Left Sequence: GGTTTTTGACGCCAATGTTT. Inner Right Sequence: CTCTCCCAGCAGAGAAATCG. Inner Primer PCR Length: 2108 bp. Deletion Size: 1023 bp. Deletion left flank: AATCAAAGGGTGATAATAGTTCGAACAAAT. Deletion right flank: CTGATCGCTGGCTCTCGTGGGAAAAGACGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1755 C. elegans gur-3(ok2245) X. Show Description
ZC504.5 Homozygous. Outer Left Sequence: gttggctcaatatggggaaa. Outer Right Sequence: gcgtcgaatacgttggagtt. Inner Left Sequence: ggcggtgagagtaagctttg. Inner Right Sequence: aaatggacgtcaccaaggag. Inner Primer PCR Length: 3321. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1756 C. elegans gur-3(ok2246) X. Show Description
ZC504.5. Homozygous. Outer Left Sequence: GTTGGCTCAATATGGGGAAA. Outer Right Sequence: GCGTCGAATACGTTGGAGTT. Inner Left Sequence: GGCGGTGAGAGTAAGCTTTG. Inner Right Sequence: AAATGGACGTCACCAAGGAG. Inner Primer PCR Length: 3319 bp. Deletion Size: 2376 bp. Deletion left flank: ACTGTCATAAATAAATTGAGTTTACGTATT. Deletion right flank: TTTCTGCAATCTTCATTAGAACTGAACAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1757 C. elegans F28A10(ok2260) II. Show Description
F28A10. Homozygous. Outer Left Sequence: CGAACGAGAAAGGAAACTCG. Outer Right Sequence: TCCGACGCTTACAGGTCTCT. Inner Left Sequence: ACTCTGGAGAGCGGAAGATG. Inner Right Sequence: AGTCGAGAAGCAGAACACCC. Inner Primer PCR Length: 2073 bp. Deletion Size: 604 bp. Deletion left flank: GATTTTATGAATTAGTTTTTAATAAAGATT. Deletion right flank: TAAACCAGACATAGTTGGGGAAAAAATTAA. Insertion Sequence: TG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1758 C. elegans ZK1025.3(ok2261) I. Show Description
ZK1025.3 Homozygous. Outer Left Sequence: taaatttttccggcagatcg. Outer Right Sequence: cgggtgctttcttgaatcat. Inner Left Sequence: ggaattgaaattttcggcaa. Inner Right Sequence: cttccgtactcccgatttga. Inner Primer PCR Length: 2408. Deletion size: about 2100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1759 C. elegans acbp-3(ok2262) X. Show Description
F47B10.7. Homozygous. Outer Left Sequence: ACCAGCGCCAATGATAAAAA. Outer Right Sequence: TTTTGCATGTTGTCTACCGC. Inner Left Sequence: AGCCCGTTTGTCCTTGTAAA. Inner Right Sequence: AATTTCCTTCTCGGGTGCTC. Inner Primer PCR Length: 2288 bp. Deletion Size: 1201 bp. Deletion left flank: AAAGTTTTGAAGAAATGTAGAGTGTCGTTT. Deletion right flank: ATACTAAATAAATATGAATTAATTTTGTAA. Insertion Sequence: ACTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1762 C. elegans dsl-6(ok2265) IV. Show Description
H02I12.4. Homozygous. Outer Left Sequence: AAATAGCCCCAAAGATCGCT. Outer Right Sequence: TTCAAAAATGCCCACATCAA. Inner Left Sequence: GTTCTTGCATGAGCAGTCCA. Inner Right Sequence: GAGGGAGTTAGAGCAGCCAG. Inner Primer PCR Length: 2315 bp. Deletion Size: 1811 bp. Deletion left flank: TCACATTTTTCACCGAACCAGTTTCTGAAA. Deletion right flank: CATAAATGATCAAATTAACATTTTTTACAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1763 C. elegans K11E4.3(ok2266) X. Show Description
K11E4.3 Homozygous. Outer Left Sequence: ttgacttgcaccttcattcg. Outer Right Sequence: agaaacttcatcacgcccac. Inner Left Sequence: gatgccagttgggaaagaaa. Inner Right Sequence: aaaataatgcagtttgcgcc. Inner Primer PCR Length: 2991. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1764 C. elegans trxr-2(ok2267) III. Show Description
ZK637.10. Homozygous. Outer Left Sequence: GCGAATATCCGATAGCGATT. Outer Right Sequence: CAAGACCCTTCCAAACCAAA. Inner Left Sequence: CCAATCAGGCGTCTCTTCTC. Inner Right Sequence: GCTCAAAGCCTGTTCAATCC. Inner Primer PCR Length: 3171 bp. Deletion Size: 1649 bp. Deletion left flank: TTGTAATTGGAGCAGGATCTGGAGGACTTT. Deletion right flank: TAAGGATAGCGGTTTTTGTTATGTGAAAGC. Insertion Sequence: TTTGTAGCGGTTTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1765 C. elegans abt-5(ok2268) I. Show Description
Y53C10A.9. Homozygous. Outer Left Sequence: GTTGTTCTGGGTGCCTTTGT. Outer Right Sequence: TCCCAAAGAAACACGACTCC. Inner Left Sequence: CTTGCACAGTCGTGATGCTT. Inner Right Sequence: AGCGAGACCCTGAAAGTGAA. Inner Primer PCR Length: 2886 bp. Deletion Size: 2067 bp. Deletion left flank: TTGAGTTGACGGACAAACGGAATACATTGG. Deletion right flank: TAGAGCGGCGTTCGCGCCTCGCTCAGCTGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1766 C. elegans C12D8.1(ok2270) V. Show Description
C12D8.1 Homozygous. Outer Left Sequence: aaagaagttgtggtgccgac. Outer Right Sequence: aatggaaggatttaacccgc. Inner Left Sequence: ccgttagccgaaaaattgaa. Inner Right Sequence: cgaatacttgtttgaacccca. Inner Primer PCR Length: 3085. Deletion size: about 2700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1767 C. elegans clec-39(ok2271) V. Show Description
T25E12.7. Homozygous. Outer Left Sequence: TGGCTGCCTTGCTAGAAAAT. Outer Right Sequence: GTTATTGCACGGGAGACGTT. Inner Left Sequence: GACATTCACACAATCACCGC. Inner Right Sequence: GGGAAAGTGCTCAACTACCG. Inner Primer PCR Length: 2219 bp. Deletion Size: 1334 bp. Deletion left flank: GGTGCCACTCTTTTTTCCATAAAAAGTGAA. Deletion right flank: AATTTTAGAAATTAAAAAAAAAATCACATA. Insertion Sequence: AAATTTTAGAAATTAAAAAAAATTTTAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1768 C. elegans T07D1.3(ok2272) X. Show Description
T07D1.3. Homozygous. Outer Left Sequence: AATGACACGTGCGACCATTA. Outer Right Sequence: AAAAATGCGGTTTCGTGTTC. Inner Left Sequence: CTTCGGAATATTTGCCTCCA. Inner Right Sequence: AAAAAGTGCCAACAACTGGC. Inner Primer PCR Length: 2130 bp. Deletion Size: 1260 bp. Deletion left flank: TTGGATTAAATGAAGAAATGCTTTTGTTAA. Deletion right flank: TGCATATTTTGGTGGTTTATCTAGTGTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1769 C. elegans mig-2(ok2273) X. Show Description
C35C5.4. Homozygous. Outer Left Sequence: CCGAGGTTTTCGTTTTTCAA. Outer Right Sequence: AATGACTGGGAAACGTCCAA. Inner Left Sequence: TTTTGTTCCACGCTTTGTCA. Inner Right Sequence: ATGATCGGGAAGAAGAGCCT. Inner Primer PCR Length: 2116 bp. Deletion Size: 1192 bp. Deletion left flank: ATTTTCGCCAACTTTTCATTCCCTAACTTT. Deletion right flank: TTTTGTTGAAACTCATAAAACTATATCTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1772 C. elegans K08B12.2(ok2276) V. Show Description
K08B12.2. Homozygous. Outer Left Sequence: TCCTTTTTGTCGTTGCATTG. Outer Right Sequence: GGAGTGAACCCGATCTTGAA. Inner Left Sequence: CGTTTGTCGTTGTTGCATCT. Inner Right Sequence: GCAAGAAGAAAATGGGTGGA. Inner Primer PCR Length: 2599 bp. Deletion Size: 914 bp. Deletion left flank: GAGCGGAATGGAATGAAGAGTGTGTGTGTG. Deletion right flank: ATGTCAATGAGAGCTAACGCCATCATCAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1773 C. elegans slc-5A12(ok2281) IV. Show Description
ZK822.5. Homozygous. Outer Left Sequence: GCGATTTTTGGATTGAGCAT. Outer Right Sequence: TTTCAAATTTCCGGATCACC. Inner Left Sequence: GCTTTTCATTGCGATTTCGT. Inner Right Sequence: CACGCAATTTGTCATGCTTT. Inner Primer PCR Length: 2857 bp. Deletion Size: 1318 bp. Deletion left flank: TCGAGGGGACAGAACAGCAAAAGAGGAATA. Deletion right flank: GGCAATTTATGAAGATTTCTTGAAAAATAG. Insertion Sequence: AAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1777 C. elegans F45E4.3(ok2285) IV. Show Description
F45E4.3. Homozygous. Outer Left Sequence: AAAAGTTGCGCTTCCAAAAA. Outer Right Sequence: TCAAAACGAATCAACGACCA. Inner Left Sequence: CGCTTTTGTAGAAAAACACGG. Inner Right Sequence: TGCATCGGCATTTGTTGTAT. Inner Primer PCR Length: 3120 bp. Deletion Size: 2410 bp. Deletion left flank: TTTGAGATATCAAACGATCGGAAACTAGTA. Deletion right flank: CCGACAGTATGGAGCCGCACCACCTCCAAC. Insertion Sequence: ATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1778 C. elegans F09A5.1(ok2286) X. Show Description
F09A5.1. Homozygous. Outer Left Sequence: AGGTGTTCTACCCGATGTGC. Outer Right Sequence: TGCCGTTTGTGTACGACTTC. Inner Left Sequence: AATTTGTGGATATCTCGGCG. Inner Right Sequence: AACAAGTCTTCGTGCATCCC. Inner Primer PCR Length: 3224 bp. Deletion Size: 1465 bp. Deletion left flank: GCTGGTCGGCATCGTCATTTGGCTCATTTG. Deletion right flank: CTTAGTTCGACTTAAATTAGTTTGAAACAA. Insertion Sequence: TTCTTAGTTCGACTTCTTAGTTCTCTTAGTTCTCTTAGTTCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1779 C. elegans fbxb-67(ok2287) I. Show Description
F49B2.2. Homozygous. Outer Left Sequence: ACAATGCAACACCCTGTCAA. Outer Right Sequence: TCACAGGTGAATGAGAAGCG. Inner Left Sequence: TATCCCAAACAGGTTGCACA. Inner Right Sequence: GGGAAATGAGCTAGAAGGGG. Inner Primer PCR Length: 2132 bp. Deletion Size: 1154 bp. Deletion left flank: CTACTCTTTGCCCCTTATTGCTCTTCTGTA. Deletion right flank: AGGTGAAAGTTTACATAGGACACCCCTTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1782 C. elegans twk-37(ok2298) I. Show Description
C48E7.9 Homozygous. Outer Left Sequence: ccgtaacgagaaattgcaca. Outer Right Sequence: ttgagctcgccaagtttctt. Inner Left Sequence: cgctgggaggtcaaataaaa. Inner Right Sequence: cgaggtttgcagaatcattg. Inner Primer PCR Length: 2181. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1783 C. elegans C16C8.21(ok2301) II. Show Description
C16C8.16. Homozygous. Outer Left Sequence: AAGACGACCACACTCTCGCT. Outer Right Sequence: ACACTGGGAAAAATGTTCGG. Inner Left Sequence: TGCCGATACTAAAGTTCCCG. Inner Right Sequence: GGACTACGGTAGGTGGCAGA. Inner Primer PCR Length: 3110 bp. Deletion Size: 1331 bp. Deletion left flank: ATTGTTCGAAAATTTGATGTCGGAATTGAA. Deletion right flank: GACTGTCAAAGCCGAGCTGAATGTGACGAA. Interpretation of sequence data is very speculative, and should be confirmed independently. Predominant band in PCR of mutants, about 600 bp, is probably not the full-length mutant product. Full-length mutant product is more likely a fainter band of about 1770 bp, which correlates well with deduced breakpoints and relative sizes of various bands produced by single-round amplification with external and internal primer pairs. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1785 C. elegans Y105E8A.11(ok2303) I. Show Description
Y105E8A.11 Homozygous. Outer Left Sequence: atccgaagcagcaattcaag. Outer Right Sequence: ggatcaaacccaaggatgaa. Inner Left Sequence: tcgattgtgcaatgacgttt. Inner Right Sequence: tttcaagcgaatcaatggag. Inner Primer PCR Length: 3030. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1786 C. elegans Y105E8A.11(ok2304) I. Show Description
Y105E8A.11 Homozygous. Outer Left Sequence: atccgaagcagcaattcaag. Outer Right Sequence: ggatcaaacccaaggatgaa. Inner Left Sequence: tcgattgtgcaatgacgttt. Inner Right Sequence: tttcaagcgaatcaatggag. Inner Primer PCR Length: 3030. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1787 C. elegans F56F11.5(ok2305) III. Show Description
F56F11.5. Homozygous. Outer Left Sequence: ACAAGCTGAAAATGCCCAAC. Outer Right Sequence: ATTGCCAAAAGTTCGATTGC. Inner Left Sequence: CAGAAATGTCCATGAAATTAACAAA. Inner Right Sequence: CAGGCTCCAGTTCGAAGTTT. Inner Primer PCR Length: 3054 bp. Deletion Size: 2283 bp. Deletion left flank: TAACTCGGCTATAGCCTATAGCCGAGTTTC. Deletion right flank: TAATAGTGCCACACTGTGCGTAATTATTAT. Insertion Sequence: TGAGATTTTTCAACTTTTCAAAAAATCTTATAAAATCTAGAATTTTTTTGAATTTTTTA AGCATGATATTTTGGTCTTTATGGCCCCATAGGCATGTTTTAAAGCAATTCCCACACAT AGTGTAGTCCATCTTTAAGTTTCTATGTATAAAAGTAATTTTTACCATTGCTTTTGCTT TGTAGGCAATCGCCATGATTTCCAGACTTCGTTGAGACTTTTCAATTATATAATCACGG TAAGACTTCGAACTATCTTTTCTTGATTGCGAAAACGAGGATGTGTAGTCAGCTTGCAA TGCTTCTATTGCTTGACGTGGTCCCTGTTCCCCATTCAATTGAAGGTGAGTTATTACCT TACACGCAAGTTGTTCAAGTTCTCTGCAAATTTACAATTGAAAACTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1788 C. elegans cyp-35A1(ok2306) V. Show Description
C03G6.14. Homozygous. Outer Left Sequence: AAAGCTTTTGTTGGAGGTGC. Outer Right Sequence: TGATTCCTTTTGGAGTTGGG. Inner Left Sequence: GATGCATAGTAAGGAAATCTGGG. Inner Right Sequence: TCCACTACCGAGCTTATGCC. Inner Primer PCR Length: 3112 bp. Deletion Size: 1494 bp. Deletion left flank: TTGATATCCTCAATTCTAAATCAAGCAATC. Deletion right flank: TCACCAGAATACAATTTAAAAACCTTTAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1790 C. elegans D2096.3(ok2317) IV. Show Description
D2096.3 Homozygous. Outer Left Sequence: aactaccgcttatcggctcc. Outer Right Sequence: cacactctgcgaggaaacaa. Inner Left Sequence: gatttttgctcgtagtcccg. Inner Right Sequence: cggtgcaatcataagagcag. Inner Primer PCR Length: 3134. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1791 C. elegans amt-1(ok2318) X. Show Description
C05E11.4. Homozygous. Outer Left Sequence: CTGTCCCATCCGATTCTGTT. Outer Right Sequence: GTGTGTGCTTCACATGTCCC. Inner Left Sequence: ATTTCGAAAAATGACGACGC. Inner Right Sequence: CTAATTCGACGGCAAAGAGC. Inner Primer PCR Length: 2473 bp. Deletion Size: 1043 bp. Deletion left flank: TTTTATATATCCCCAATAATTTTCAGTCAT. Deletion right flank: ATGATAAGGTATTTCTTTAAAAGTCAGGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1792 C. elegans inx-7(ok2319) IV. Show Description
K02B2.4. Homozygous. Outer Left Sequence: AGCTAGTCATGGGGAGCAAA. Outer Right Sequence: ACGTCTGAAGGTTCGTGCTT. Inner Left Sequence: GGCTGTCTTCGGAATTTTTG. Inner Right Sequence: CAAGTGCGTCGTTCATCATC. Inner Primer PCR Length: 3021 bp. Deletion Size: 1610 bp. Deletion left flank: AGTTCTGAAAATTGAAATTATTTTAAATTT. Deletion right flank: TTTTTTGACAAATCTCGGTCGATTTCCACC. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1793 C. elegans Y24D9A.2(ok2320) IV. Show Description
Y24D9A.2 Homozygous. Outer Left Sequence: aattcgcgaaaacgaaacaa. Outer Right Sequence: attgacggagaaaagagcga. Inner Left Sequence: ctccaatgcctgtagatgcc. Inner Right Sequence: aaaattgggaaaatggtggg. Inner Primer PCR Length: 3188. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1796 C. elegans set-21(ok2327) IV. Show Description
Y24D9A.2. Homozygous. Outer Left Sequence: AATTCGCGAAAACGAAACAA. Outer Right Sequence: ATTGACGGAGAAAAGAGCGA. Inner Left Sequence: CTCCAATGCCTGTAGATGCC. Inner Right Sequence: AAAATTGGGAAAATGGTGGG. Inner Primer PCR Length: 3169 bp. Deletion Size: 1604 bp. Deletion left flank: TTTGCTGGCAGAACAGGGCACATCGACGGA. Deletion right flank: CACTCGGTACGATAAATGGAACAAGGATAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1797 C. elegans citk-1(ok2328) II. Show Description
W02B8.2. Homozygous. Outer Left Sequence: CAAATTTGCCGAACATTTCA. Outer Right Sequence: TGCTTCATGTCTACAAGGCG. Inner Left Sequence: GAAATTTGCCGATTTGCC. Inner Right Sequence: TAAACCGGCCTCGTGTCTAC. Inner Primer PCR Length: 3065 bp. Deletion Size: 1711 bp. Deletion left flank: CTCAAGGTGGAAGAGGAGCTCCAGGAGAAG. Deletion right flank: GGCACAAGGCCTCAAGGTAGACGTAGGTAA. Insertion Sequence: CCTATACTTACCTCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1798 C. elegans zig-7(ok2329) I. Show Description
F54D7.4. Homozygous. Outer Left Sequence: AGCGAGAGACGCAGAGAAAC. Outer Right Sequence: ATTTTCCCAATGTCAACCCA. Inner Left Sequence: AGAAAGGGGGAAACTCGGT. Inner Right Sequence: TGCTTGGCGAGTCTAGTGAA. Inner Primer PCR Length: 3106 bp. Deletion Size: 1931 bp. Deletion left flank: GAATCGATGAGTTTTATTTTCTCGTTTGCC. Deletion right flank: AGAAATTAATTTTTCAAAAAAAGAAAGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1803 C. elegans clec-65(ok2337) II. Show Description
F35C5.8. Homozygous. Outer Left Sequence: TTAATGGTGTTCGGGACCTC. Outer Right Sequence: GGCAAATTTTGACATCGCTT. Inner Left Sequence: AGCAGCATCGCCAACTCTAT. Inner Right Sequence: GCAAATTGCCGGAATTAAAA. Inner Primer PCR Length: 2174 bp. Deletion Size: 1580 bp. Deletion left flank: AACTCTATCCGTCAGTGACAGACGATGCGG. Deletion right flank: GTACTCACTTCTGTGTATTTTTTTTGCTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1806 C. elegans fbxb-8(ok2340) I. Show Description
F49B2.1. Homozygous. Outer Left Sequence: TCGATTCGAATGGTTGTTCA. Outer Right Sequence: ACGTCATATGTGGCGCATTA. Inner Left Sequence: ACATAGGACACCCCTTGTCG. Inner Right Sequence: CCCGCATTTTTGTAGATCGT. Inner Primer PCR Length: 2880 bp. Deletion Size: 1799 bp. Deletion left flank: AGCTTCGATCACGATTCAGAGCAGTTTTGT. Deletion right flank: TCAATCCCGGCAATTTGCCGATTTACTGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1807 C. elegans F55G11.2(ok2341) IV. Show Description
F55G11.2. Homozygous. Outer Left Sequence: ATGGCATTTGTTAAGCCCTG. Outer Right Sequence: TAGCTTGTCGTTGTCGTTGC. Inner Left Sequence: TTTGTGTTGTTTGGCTCGTC. Inner Right Sequence: CTTGCGGTCCAAAAGACATT. Inner Primer PCR Length: 2122 bp. Deletion Size: 1155 bp. Deletion left flank: ACTAGCTTCCAAGTTGACTATATTAATATT. Deletion right flank: ACTGTAATTCACAAATTTTAGATAAGTTAA. Insertion Sequence: TTGACTATATTAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1808 C. elegans glr-2(ok2342) III. Show Description
B0280.12. Homozygous. Outer Left Sequence: AGCATCATGAGCAAATGCAG. Outer Right Sequence: ATATTGGTTTCCCTTTCCCG. Inner Left Sequence: TTTCCTCAAGGGCTCTCAAA. Inner Right Sequence: CTCACCTTCTCGGGCAATTA. Inner Primer PCR Length: 2675 bp. Deletion Size: 1229 bp. Deletion left flank: GATATTTCGGAGATTTCTCGTGCAGATATG. Deletion right flank: CAAGCAGTTATTTATGTGCCTACTTGAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807