| MT14768 |
C. elegans |
mir-231(n4571) III. Show Description
Deletion breakpoints are: CATAAATTTCAGGAAAGC / ATGTGGTAAAATATGAAT...ATGTGAATGAAAATAAACC / GCCAAAAATATCAAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14875 |
C. elegans |
nDf59 V. Show Description
mir-61 (F55A11.9), mir-250 (F55A11.12) and part of F55A11.3 are deleted in nDf59. Deletion breakpoints are:TGGATTTCCACAACAACCAGCTGGTGCC / GGAGGTGCTCAGCCTGG...GTTCTAGTCATTGCC / ATACGGAGGAAGGACTAAGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14876 |
C. elegans |
mir-261(n4594) II. Show Description
Deletion breakpoints are:TTTTCGAATTGGCTTATG / AACCGATGGCATTTTCTTCTC...TGCAAATTGGGGCCAACA / ATACAATAGGTGTAAAATGGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14878 |
C. elegans |
mir-270(n4595) IV. Show Description
Deletion breakpoints are:AGTTTGGAAAACTGTGCTAGAATGAGAAAAGTTGCTGAAATGAT / GAAAAAGCG...TCGGACTTTA / CCCTTCGCCCCTTATCACACCATTCTATCAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14919 |
C. elegans |
mir-260(n4601) II. Show Description
Deletion breakpoints are:TTACTAAAAAAAAAGTGCCTAG / GATTGTCTGAAAATT...CGGCTGAAAAATAT / AAATTTATAACTGGGCAACAGAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects
|
|
| MT14935 |
C. elegans |
mir-59(n4604) IV. Show Description
Deletion breakpoints are: GAAATAAGGCTCTACAGT / ATGCTCAGACATAAATTA...ACGGTAGCTCCACGGGCAT / TTTAATGACAACTTACATAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14936 |
C. elegans |
mir-242(n4605) IV. Show Description
Deletion breakpoints are: GTACCTAGACAATATTCCT / CACCAACCTCAATTCAACAC...GGCTTAAGCTTAGGCGAATA / CAATCAATTTTTCAAAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14937 |
C. elegans |
mir-251(n4606) X. Show Description
Deletion breakpoints are: TGGCTAATCGGTAAAATGGT / CGGCTGACGGCTAATTCGG...AGTTTCAACAATTTTTTC / GGGCGAGAAGCGACTAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14993 |
C. elegans |
mir-46(n4475) III; mir-47(gk167) X. Show Description
Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15018 |
C. elegans |
mir-360(n4635) X. Show Description
Deletion breakpoints are:ACGTGCTGTAAAAATTTGCGG / ATACCAAGCCTACAGTTGATTT...GGGACTTTGGGCGGCTTA / AAGTGTCACTGGTCTGGACG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15019 |
C. elegans |
nDf60 V. Show Description
mir-357 and mir358 are deleted in this strain. Deletion breakpoints are:TTCTGTTTGACGATGATG / GGGACGATTCAACGGTCA...CATTTAATGTATTTCACAT / CTTTTTGGGTTACTGTAGTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15020 |
C. elegans |
mir-246(n4636) IV. Show Description
Deletion breakpoints are:GATACATCGGTGCAATGAAGA / CATCATCAGATAATATTCTCAA...ATGTTTCGGGTAGGAGCTGT / TCAAACTTTGGACATTGGCATC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15021 |
C. elegans |
mir-78(n4637) IV. Show Description
Deletion breakpoints are:CTTTCATACATCTATTTT / ATACGGAAATGTAAAAT...CTTGTTTCAAGCTATCC / ATTTTGCAACAATACTGT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15022 |
C. elegans |
mir-83(n4638) IV. Show Description
Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15023 |
C. elegans |
mir-268(n4639) V. Show Description
Deletion breakpoints are:TTCCAAAAATGAGACTACGT / AGAAAACATATCG...CCACCCTCTTGTTTTTTTTTT / TGCTCTTTTCCACTCCGTA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15024 |
C. elegans |
mir-58.1(n4640) IV. Show Description
Deletion breakpoints are:CCGGCCAAATCTAGAACTGC / AAGAGTACGGTCTTG...GACTGAGCTAGAGTG / ACCTCTGATAATACGGAACGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15025 |
C. elegans |
mir-269(n4641) IV. Show Description
Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15312 |
C. elegans |
nDf62 X. Show Description
mir-239a and mir-239b are deleted in nDf62. Deletion breakpoints are:GAGTTTTTAACAGTTTCG / CCACTGGCGCTACTC...AATTGTCGACCAAAAAAAT / CTTGCTATAGTTAAATATTCAATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15454 |
C. elegans |
mir-243(n4759) IV. Show Description
Deletion breakpoints are:CAGAGATCGTGTGACAAT / GACGTTGACGCGAAGAAG.... GAGTAGTGTAATTTCCAATTTTTAT / AGATTAATTCAGGGGTGGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15488 |
C. elegans |
lin-35(n4760) I. Show Description
Class B SynMuv. Reduced fertility. Maintain at 20C or cooler. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15501 |
C. elegans |
mir-83(n4638) IV. Show Description
Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15517 |
C. elegans |
mir-233(n4761) X. Show Description
Deletion breakpoints are:TTGAAGTTGCTCCGGACAAAAA / GCAGCCATCAGTCT...TCTCTCCAAGGTTGTA / ACAGGAGACGACGACCACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15563 |
C. elegans |
nDf53 III; mir-58.1(n4640) IV; nDf54 X. Show Description
Sick strain. mir-80 and mir-227 are deleted in nDf53. mir-81, mir-82, T02D1.2 are deleted in nDf54. Deletion breakpoints for n4640 are:CCGGCCAAATCTAGAACTGC / AAGAGTACGGTCTTG...GACTGAGCTAGAGTG / ACCTCTGATAATACGGAACGG. Deletion breakpoints for nDf53 are: ACTCATTTCGTTCGCCAGAAATTC / TCAGTTTGTGTA...ATAGCAGAGGT / ATTAGGAGAGTATAGACATCGAAAGCA. Deletion breakpoints for nDf54 are AAAATTTTTAAATTCTGAAATTAG / TTAAAAAACTGG...ATGAGTGGCAAA / AACTGATTGTGAGTAATTGTCATCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15767 |
C. elegans |
mir-258.2(n4797) X. Show Description
Deletion breakpoints are:ATCAAAGTGAACAAATACG / TGCTCTTCTCCATAACCAAC...CGGCGAATTCCTTATGATTTG / GTCTCTCTTTTGTAGTATGAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15873 |
C. elegans |
mir-240(n4541) X. Show Description
Deletion breakpoints are:TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15981 |
C. elegans |
mir-87(n4104) V; mir-233(n4761) X. Show Description
Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15982 |
C. elegans |
mir-67(n4899) III. Show Description
Deletion breakpoints are:GGGTGCCTAATGCAAA / AGTACACATTTATGAAT...GCGAGTTTAAAGCAACG / AGTAGCAGAAGGACCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16033 |
C. elegans |
mir-244(n4367) I. Show Description
Deletion breakpoints are: CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16060 |
C. elegans |
nDf64 V. Show Description
mir-253 and part of F44E7.5 are deleted in nDf64. Deletion breakpoints are:GATATCCTCACACTTTGGCAAAGAGTGCTT / GTTGAAGACGGTGAAAACATCCGAATTTTCAGGGAAGTT...TGAGATAAGAACACAAA GAATTCGATTTTC / GTGAATTCTGAACGAAACTTTACGTTTTGGACAGTAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16308 |
C. elegans |
mir-252(n4570) II. Show Description
Deletion breakpoints are:TGTTGCACAATAAATTCTCAAACTTTTGTG / TTTCCGTAATAA...AGTGAATTGAAA / GAGCCGGTGTGGAGTGGGGCGGTTCTCGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16309 |
C. elegans |
mir-247&mir-797(n4505) X. Show Description
Deletion breakpoints are: CCAGTGTTACCACCGCTTGCTACAAACGGC / AAAAAATTTGAA...CAAAAATTTAT / CACATGAAATTATACCAAACAGTCAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16310 |
C. elegans |
mir-269(n4641) IV. Show Description
Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16311 |
C. elegans |
mir-77(n4286) II. Show Description
Deletion breakpoints are:CTACAAAAACTATTCCATTC / AAAAAACGGCTGTCAGTGC...AGAGACGATTTGTGTCGA / TTTACGAAATTTTCCTCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16316 |
C. elegans |
mir-355(n4618) II. Show Description
Deletion breakpoints are:TGTGTCTATGAAATTAATTC / TTATATCAACTCTAATTAT...TTTTGGGAAAATGAAC / GATTAAACATTTTTTTTA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16317 |
C. elegans |
mir-252(n4570) II; mir-251(n4606) X. Show Description
Deletion breakpoints for n4606 are:TGGCTAATCGGTAAAATGGT / CGGCTGACGGCTAATTCGG...AGTTTCAACAATTTTTTC / GGGCGAGAAGCGACTAAA. Deletion breakpoints for n4570 are:TGTTGCACAATAAATTCTCAAACTTTTGTG / TTTCCGTAATAA...AGTGAATTGAAA / GAGCCGGTGTGGAGTGGGGCGGTTCTCGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16335 |
C. elegans |
mir-251(n4606) X. Show Description
Deletion breakpoints are:TGGCTAATCGGTAAAATGGT / CGGCTGACGGCTAATTCGG...AGTTTCAACAATTTTTTC / GGGCGAGAAGCGACTAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16336 |
C. elegans |
mir-86(n4607) III. Show Description
Deletion breakpoints are:TCTACCGAACTTCGCATAAT / TTCCAATTTTCAATTTCCA...ACAATTTGAAAATAAAAA / TTTGCAGAAAAAGTTGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16337 |
C. elegans |
mir-245(n4798) I. Show Description
Deletion breakpoints are:AACCTTAATAAACAAATTTTA / TTAGATTTGTTTCTGAA...GATAGTGACTTTCTTGAC / AAAACTTCCTAGCGCCATCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16471 |
C. elegans |
mir-60(n4947) II. Show Description
Deletion breakpoints are:GAAACTTGTTCTGATACAGTA / ATTTTCAAAGAACCATCCATG...GGGCTTATGGAATGGTAG / ATAGTTGAGACACAGAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16494 |
C. elegans |
mir-229&mir-64&mir-65&mir-66(nDf63) III. Show Description
Deletion breakpoints are: TATTTGCCAAAAATGGAAATTTT / CGGCAAATCGGGAAGCC...AGCTCGTCGGAAGCAATTG / GCTCCGCGTAATTGGAGCCCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16506 |
C. elegans |
mir-254(n4470) X. Show Description
Deletion breakpoints are: AAAATTTATTGAATTTTT / ATGAAGAATTACTATAAT...TCCAGGAGTGCAGTACGA / TCTCGAACCATGTTTTCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16696 |
C. elegans |
mir-244(n4367) I. Show Description
Deletion breakpoints are:CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16848 |
C. elegans |
mir-249(n4983) X. Show Description
Deletion breakpoints are:TGCCAACTGGATTGAACAAAACAACT / TGCACACAAGAGAGAGGTCCACCTAGCAA...AGATAAGTCGTACATCACTTTAT / CTGTTTAATGGATTAGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT17810 |
C. elegans |
mir-1(n4102) I. Show Description
Deletion breakpoints are: CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT17997 |
C. elegans |
mir-235(n4504) I. Show Description
Deletion breakpoints are: ATCGGCCATCAGAACAGTGCAAGAAAT / TTGAGAAATATG...ATCCACAGGTGGT / GTCATCTGAAGAAAGGACACACATACATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT18043 |
C. elegans |
mir-240&mir-786(n4541) X. Show Description
Deletion breakpoints are: TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MX52 |
C. elegans |
bbs-8(nx77) V. Show Description
Displays Dyf, Che and Odr phenotypes. nx77 is a double deletion in bbs-8. Nucleotides 612-759 and 826-1631 of bbs-8 (numbers refer to unspliced gene sequence) are removed.
|
|
| NB131 |
C. elegans |
wrn-1(gk99)/mIn1[dpy-10(e128) mIs14(GFP)] II; exo-1(tm1842) III. Show Description
Heterozygotes (wrn-1/mIn1;exo-1) are WT and GFP+. mIn1 homozygotes (mIn1;exo-1) are Dpy and GFP+. wrn-1;exo-1 homozygotes are non-GFP. Reference: Ryu, J.S. and Koo, H.S. (2017). FEBS Lett.
|
|
| NB514 |
C. elegans |
exo-1(tm1842) III; parg-2(ok980) IV. Show Description
Double mutant is less sensitive to ionizing radiation than the parg-2(ok980) single mutant, but as sensitive as the exo-1(tm1842) single mutant. Parental parg-2(ok980) strain outcrossed 6 times; parental exo-1(tm1842) strain outcrossed 4 times. Reference: Bae W, et al. Hypersensitivity to DNA double-strand breaks associated with PARG deficiency is suppressed by exo-1 and polq-1 mutations in Caenorhabditis elegans. The FEBS Journal, In press.
|
|
| NB515 |
C. elegans |
polq-1(tm2572) III; parg-2(ok980) IV. Show Description
Hypersensitivity to ionizing radiation due to the parg-2(ok980) mutation is rescued by the polq-1(tm2572) mutation. The double mutant is as sensitive as the wild-type to ionizing radiation. Parental parg-2(ok980) strain outcrossed 6 times; parental polq-1(tm2572) strain outcrossed 5 times. Reference: Bae W, et al. Hypersensitivity to DNA double-strand breaks associated with PARG deficiency is suppressed by exo-1 and polq-1 mutations in Caenorhabditis elegans. The FEBS Journal, In press.
|
|