Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
BC5437 C. elegans sEx488. Show Description
sEx488 [T06F6 (III) + pCes1943[rol-6(su1006)]]. 6 ng/ul T06F6 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5453 C. elegans sEx504. Show Description
sEx504 [T01D10 (III) + pCes1943[rol-6(su1006)]]. segrgnt 1. 5 ng/ul T01D10 + 95 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5477 C. elegans sEx528. Show Description
sEx528 [F25H8 (IV) + pCes1943[rol-6(su1006)]]. 20 ng/ul F52H8 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5480 C. elegans sEx531. Show Description
sEx531 [K01H12 (IV) + pCes1943[rol-6(su1006)]]. "low" ng/ul K01H12 + 83 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5482 C. elegans sEx533. Show Description
sEx533 [ZK1251 (IV) + pCes1943[rol-6(su1006)]]. "low" ng/ul ZK1251 + 83 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5489 C. elegans sEx540. Show Description
sEx540 [C28H8 (III) + pCes1943[rol-6(su1006)]]. segrgnt A. "Low" amount of cosmid C28H8 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5494 C. elegans sEx545. Show Description
sEx545 [F27C8 (IV) + pCes1943[rol-6(su1006)]]. "low" ng/ul F27C8 + 83 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5496 C. elegans sEx547. Show Description
sEx547 [C33A12 (IV) + pCes1943[rol-6(su1006)]]. "low" ng/ul C33A12 + 83 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5508 C. elegans sEx558. Show Description
sEx558 [B0280 (III) + pCes1943[rol-6(su1006)]]. "low" ng/ul B0280 + 100 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5509 C. elegans sEx559. Show Description
sEx559 [C37D8 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul C37D8 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5513 C. elegans sEx563. Show Description
sEx563 [F31E3 (III) + pCes1943[rol-6(su1006)]]. 10 ng/ul F31E3 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5523 C. elegans sEx570. Show Description
sEx570 [C14A1 (X) + pCes1943[rol-6(su1006)]]. 20 ng/ul C14A1 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5525 C. elegans sEx572. Show Description
sEx572 [ZK1074 (X) + pCes1943[rol-6(su1006)]]. 20 ng/ul ZK1074 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5532 C. elegans sEx579. Show Description
sEx579 [R02E12 (X) + pCes1943[rol-6(su1006)]]. 10 ng/ul R02E12 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5542 C. elegans sEx794. Show Description
sEx794 [C14E2 (X) + pCes1943[rol-6(su1006)]]. 10 ng/ul C14E2 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5544 C. elegans sEx591. Show Description
sEx591 [K03E5 (I) + pCes1943[rol-6(su1006)]]. seg 2. 20 ng/ul K03E5 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5545 C. elegans sEx592. Show Description
sEx592 [D1054 (V) + pCes1943[rol-6(su1006)]]. Segrgnt. II. low ng/ul D1054 + 100 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5577 C. elegans sEx623. Show Description
sEx623 [C50C12 (II) + pCes1943[rol-6(su1006)]]. 20 ng/ul C50C12 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5600 C. elegans sEx630. Show Description
sEx630 [F52C9 (III) + pCes1943[rol-6(su1006)]]. 9.8 ng/ul F52C9 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5601 C. elegans sEx631. Show Description
sEx631 [D1044 (III) + pCes1943[rol-6(su1006)]]. line 2. 12.3 ng/ul D1044 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5603 C. elegans sEx633. Show Description
sEx633 [F40H6 (III) + pCes1943[rol-6(su1006)]]. line 3. 8.2 ng/ul F40H6 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5606 C. elegans sEx636. Show Description
sEx636 [F48E8 (III) + pCes1943[rol-6(su1006)]]. line 1. 9.8 ng/ul F48E8 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5612 C. elegans sEx642. Show Description
sEx642 [F19F10 (V) + pCes1943[rol-6(su1006)]]. 20 ng/ul F19F10 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5618 C. elegans sEx648. Show Description
sEx648 [F47D12 (III) + pCes1943[rol-6(su1006)]]. 8.2 ng/ul F47D12 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5653 C. elegans sEx669. Show Description
sEx669 [C10C5 (IV) + pCes1943[rol-6(su1006)]]. "low" ng/ul C10C5 + 83 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5657 C. elegans sEx673. Show Description
sEx673 [F49C12 (IV) + pCes1943[rol-6(su1006)]]. 20 ng/ul F49C12 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5658 C. elegans sEx674. Show Description
sEx674 [C56G2 (III) + pCes1943[rol-6(su1006)]]. 10 ng/ul C56G2 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5664 C. elegans sEx680. Show Description
sEx680 [F40F11 (IV) + pCes1943[rol-6(su1006)]]. 20 ng/ul F40F11 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5667 C. elegans sEx683. Show Description
sEx683 [C08F8 (IV) + pCes1943[rol-6(su1006)]]. 20 ng/ul C08F8 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5668 C. elegans sEx684. Show Description
sEx684 [K11E8 (IV) + pCes1943[rol-6(su1006)]]. Segrgnt. B. 20 ng/ul K11E8 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5678 C. elegans sEx691. Show Description
sEx691 [T12F5 (I) + pCes1943[rol-6(su1006)]]. 20 ng/ul T12F5 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5684 C. elegans sEx697. Show Description
sEx697 [B0467 (I) + pCes1943[rol-6(su1006)]]. 10 ng/ul B0467 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5694 C. elegans sEx705. Show Description
sEx705 [C33D8 (III) + pCes1943[rol-6(su1006)]]. 5 ng/ul C33D8 + 95 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5700 C. elegans sEx714. Show Description
sEx714 [F57E5 (X) + pCes1943[rol-6(su1006)]]. 21 ng/ul F57E5 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5705 C. elegans sEx719. Show Description
sEx719 [F20H11 (III) + pCes1943[rol-6(su1006)]]. segrgnt 2. 15 ng/ul F20H11 + 85 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5710 C. elegans sEx724. Show Description
sEx724 [C34C12 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul C34C12 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5712 C. elegans sEx726. Show Description
sEx726 [F49E7 (X) + pCes1943[rol-6(su1006)]]. 20 ng/ul F49E7 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5713 C. elegans sEx727. Show Description
sEx727 [F54D1 (IV) + pCes1943[rol-6(su1006)]]. ? ng/ul F54D1 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5717 C. elegans sEx731. Show Description
sEx731 [T19E10 (II) + pCes1943[rol-6(su1006)]]. 20 ng/ul T19E10 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5722 C. elegans sEx735. Show Description
sEx735 [W05F2 (I) + pCes1943[rol-6(su1006)]]. Segrgnt. 1. 20 ng/ul W05F2 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5725 C. elegans sEx738. Show Description
sEx738 [M01B12 (I) + pCes1943[rol-6(su1006)]]. Segrgnt. 3. 20 ng/ul M01B12 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5726 C. elegans sEx739. Show Description
sEx739 [C07A9 (III) + pCes1943[rol-6(su1006)]]. 12.5 ng/ul C07A9 + 87.5 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5732 C. elegans sEx744. Show Description
sEx744 [C48B6 (I) + pCes1943[rol-6(su1006)]]. 7 ng/ul C48B6 + 93 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5733 C. elegans sEx745. Show Description
sEx745 [M01E11 (I) + pCes1943[rol-6(su1006)]]. Segrgnt I. 10 ng/ul M01E11 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5734 C. elegans sEx746. Show Description
sEx746 [B0261 (I) + pCes1943[rol-6(su1006)]]. 28 ng/ul B0261 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5775 C. elegans sEx793. Show Description
sEx793 [B2044 III + pCes1943[rol-6(su1006)]]. line 8. 20 ng/ul B0244 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5776 C. elegans sEx796. Show Description
sEx796 [R04B5 (V) + pCes1943[rol-6(su1006)]]. line 4. Low amount of cosmid R04B5 + 100 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5780 C. elegans sEx798. Show Description
sEx798 [K10D2 (III) + pCes1943[rol-6(su1006)]]. line 4. 20 ng/ul K10D2 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BE109 C. elegans ?(sc109) V. Show Description
As homozygote suppresses blister formation in bli-1(sc73), bli-2(sc768) and bli-6(sc16). WT phenotype. Males sometimes have small blisters above their bursas. Males mate well. See wbg9.1p51.
BIGb0170 Sphingobacterium sp. Sphingobacterium sp. Show Description
Bacteria. CeMbio Collection. Natural isolate from a C. elegans population in rotting apple. LB, 20-26C. Sampled in: Orsay, France. More information about collection on the project's wiki: http://www.cembio.uni-kiel.de/. 16S rRNA primer: 27F/1492R. 16S rRNA sequence: TGCAGTCGGACGGGANCCGTCGGAGAGCTTGCTCGAAGACGGTGAGAGTGGCGCACGG GTGCGTAACGCGTGAGCAACCTACCTCTATCAGGGGGATAGCCTCTCGAAAGAGAGATTAAC ACCGCATAACATATCTGACCGGCATCGGTTNGNTATTAAATATTTATAGGATAGAGATGGGCTC GCGTGACATTAGCTAGTTGGTAGGGTAACGGCTTACCAAGGCGACGATGTCTAGGGGCTCT GAGAGGAGAATCCCCCACACTGGTACTGAGACACGGACCAGACTCCTACGGGAGGCAGCA GTAAGGAATATTGGTCAATGGGCGGAAGCCTGAACCAGCCATGCCGCGTGCAGGATGACTG CCCTATGGGTTGTAAACTGCTTTTGTCCAGGAATAAACCTTTCTACGTGTAGGAAGCTGAATG TACTGGAAGAATAAGGATCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGATCCG AGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTATTAAGTCAGGGGTGAAA TACGGTGGCTCAACCATCGCAGTGCCTTTGATACTGATGGGCTTGAATCCATTTGAAGTGGG CGGAATAAGACAAGTAGCGGTGAAATGCATAGATATGTCTTAGAACTCCGATTGCGAAGGCAG CTCACTAAGCTGGTATTGACGCTGATGCACGAAAGCGTGGGGATCGAACAGGATTAGATACC CTGGTAGTCCACGCCCTAAACGATGATAACTCGATGTTGGCGATAGACAGCCAGCGTCCAA GCGAAAGCGTTAAGTTATCCACCTGGGGAGTACGCCCGCAAGGGTGAAACTCAAAGGAATT GACGGGGGCCCGCACAAGCGGAGGAGCATGTGGTTTAATTCGATGATACGCGAGGAACCTT ACCCGGGCTTGAAAGTTAGTGAAGAATGCAGAGACGCATTCGTCCTTCGGGACACGAAACT AGGTGCTGCATGGCTGTCGTCAGCTCGTGCCGTGAGGTGTTGGGTTAAGTCCCGCAACGA GCGCAACCCCTATGTTTAGTTGCCAGCATGTAATGGNGGGGACTCTAAACAGACTGCCTGT GCAAA