| RB841 |
C. elegans |
F14B8.1(ok668) X. Show Description
F14B8.1. Homozygous. Outer Left Sequence: TTCCATTGCTTCCCTCAATC. Outer Right Sequence: ATGGCAAGGGTGGTAGTGAC. Inner Left Sequence: ATTCCCAACATTTTCCACCA. Inner Right Sequence: TTGGCTGGGATGATTCTTTC. Inner primer WT PCR product: 2944. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB842 |
C. elegans |
abt-2(ok669) I. Show Description
F12B6.1. Homozygous. Outer Left Sequence: TGTCCTGGCCTAATTTTTGC. Outer Right Sequence: AAATGCCACGTATAATGCCC. Inner Left Sequence: GGCTCCACAGCAAATGAGAT. Inner Right Sequence: ACTGGAAATGGAACGAGACG. Inner Primer WT PCR Product: 2966. Deletion size: 1152 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB843 |
C. elegans |
wrt-5(ok670) IV. Show Description
W03D2.5, W03D2.3. Homozygous. Outer Left Sequence: GCGGTTTTTAATGGGGAAAT. Outer Right Sequence: TGAGAAGGAAGGATGATGGG. Inner Left Sequence: AACTGAGGCCTGGAGTTTGA. Inner Right Sequence: CAGCCTTTTTGGAGAGCTTG. Inner primer WT PCR product: 2763. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB844 |
C. elegans |
C06C6.5(ok671) V. Show Description
C06C6.5. Homozygous. Outer Left Sequence: TGAGGACACTCTCGCGTATG. Outer Right Sequence: CGCACACCTAACCATGACAC. Inner Left Sequence: AAATGTGAAATCTTTGCCGC. Inner Right Sequence: GTGCACCCGAGATCAAAAAG. Inner primer WT PCR product: 2464. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB845 |
C. elegans |
gur-4(ok672) II. Show Description
K09E4.5. Homozygous. Outer Left Sequence: TCGCGCAGTTATTTGAGTTG. Outer Right Sequence: TTCAATAATTCGGCTTTCGG. Inner Left Sequence: CGCCGAAACTTCTGAAAGTC. Inner Right Sequence: GTGTCTGAAATGGAGGGGAA. Inner primer WT PCR product: 3218. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB846 |
C. elegans |
F01D5.9(ok673) II. Show Description
F01D5.9. Homozygous. Outer Left Sequence: ATCATCAGTTTTCTTGGCGG. Outer Right Sequence: TTTTGCAGTGAGCGAAAATG. Inner Left Sequence: CTCTCCATTTCTCACCGCTC. Inner Right Sequence: TTCATGCGGAAATTGTTGAA. Inner primer WT PCR product: 2808. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB847 |
C. elegans |
C14H10.3(ok674) X. Show Description
C14H10.3. Homozygous. Outer Left Sequence: GCGAAAACTGAACACGGAAT. Outer Right Sequence: CCTTAACATGCGGCCATTAT. Inner Left Sequence: GAAAAGACGCACGAGGAAAG. Inner Right Sequence: ATTTCTGACGACTGGTTGGG. Inner primer WT PCR product: 3138. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB848 |
C. elegans |
rgef-1(ok675) V. Show Description
F25B3.3. Homozygous. Outer Left Sequence: TGTCGGCTTCTCTGTTGTTG. Outer Right Sequence: CGAGCGGTATCATTTTGGAT. Inner Left Sequence: CATACTGCCACGTGGTGAAG. Inner Right Sequence: GGAATTGCGAGCTATGGTGT. Inner primer WT PCR product: 2838. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB849 |
C. elegans |
kap-1(ok676) II. Show Description
F08F8.3. Homozygous. Outer Left Sequence: CATTTTGCTCGCTGTGAGAC. Outer Right Sequence: AACTTCTCGAACCACTGCGT. Inner Left Sequence: CCATGAATCCATGCCTCTTT. Inner Right Sequence: ATCATCAATTTGGCATGCTG. Inner primer WT PCR product: 3332. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB850 |
C. elegans |
egl-47(ok677) V. Show Description
C50H2.2. Homozygous. Outer Left Sequence: GATATGCTCATGTGGCATCG. Outer Right Sequence: AGATCGATGAGTGTGGAGGG. Inner Left Sequence: ATGCCATCTTTTTCAAACGG. Inner Right Sequence: GGAAGACCTGATTGGGTTGA. Inner Primer WT PCR Product: 2549. Deletion size: 966 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB851 |
C. elegans |
inx-20(ok681) I. Show Description
T23H4.1. Homozygous. Outer Left Sequence: GCAATCATGACAAAACGGTG. Outer Right Sequence: GGTCCCAACGGACACATTAC. Inner Left Sequence: GCCAACCTTGATTCCTCAAA. Inner Right Sequence: CCTGCTCAAACCACCTCATT. Inner primer WT PCR product: 2909. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB852 |
C. elegans |
ras-2(ok682) III. Show Description
F17C8.4. Homozygous. Outer Left Sequence: CTTCTCACATCAAACGGCAA. Outer Right Sequence: ACACCACTCATGCAAAGCTG. Inner Left Sequence: CCATGGATGCCTGAAAAGTT. Inner Right Sequence: CAGAAACGTTCGCAATTCAA. Inner primer WT PCR product: 2592. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB853 |
C. elegans |
T14G12.4(ok683) X. Show Description
T14G12.4. Homozygous. Outer Left Sequence: AATAATCGACGTTTGACGGC. Outer Right Sequence: TAATCATCCTTGGAAACGCC. Inner Left Sequence: TTGGTGTTACAAGCACGGAA. Inner Right Sequence: ATCGCAGTGGTTAGTCCCAC. Inner primer WT PCR product: 2102. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB854 |
C. elegans |
lrg-1(ok684) III. Show Description
F55H2.4. Homozygous. Outer Left Sequence: TGATCCAATGAAAGGCAACA. Outer Right Sequence: TCTTGCAAAATGATCCCCTC. Inner Left Sequence: GCGGATATTTTTGGGAGTGA. Inner Right Sequence: CTGCTCTCGGATTTCGTAGG. Inner primer WT PCR product: 2912. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB855 |
C. elegans |
Y32F6B.3(ok685) V. Show Description
Y32F6B.3. Homozygous. Outer Left Sequence: CCCATTCTCGTCCACTTTGT. Outer Right Sequence: GTGATCCCATTCCAAAATGC. Inner Left Sequence: GAAGACAACGCCTCTGGAAG. Inner Right Sequence: AGGAAAATGGGTGAGCAATG. Inner primer WT PCR product: 2112. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB856 |
C. elegans |
B0393.5(ok686) III. Show Description
B0393.5. Homozygous. Outer Left Sequence:GTTCACCTGGATGGATTGGT. Outer Right Sequence:GCGAGTTCAAATTTTCGAGG . Inner Left Sequence: AAATTCAAAGGCAGCACCAC. Inner Right Sequence: TTCCGCAAAATCCAAAAATC. Inner primer WT PCR product: 3110. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB857 |
C. elegans |
pah-1(ok687) II. Show Description
K08F8.4. Homozygous. Outer Left Sequence:TCCAACGACGGTGAACACTA. Outer Right Sequence: CTCGTCACAAGGCAGTCGTA. Inner Left Sequence: CGTCTGTAAATCGAGCAGCA. Inner Right Sequence: GAAGTACGCCATGGAATCGT. Inner primer WT PCR product: 2344. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB858 |
C. elegans |
R09B3.3(ok688) I. Show Description
R09B3.3. Homozygous. Outer Left Sequence: CGTTGTTGATTTGTCCGATG. Outer Right Sequence: TGGTCTCCGCTCGTTCTACT. Inner Left Sequence: TGACGGTTTAATTTTTCCGC. Inner Right Sequence: CAGGATCTCAAGTGCCTCGT. Breaks are at R09B3 coordinates 4090/5259. Inner primer WT PCR product: 2206. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB859 |
C. elegans |
Y57A10C.6(ok693) II. Show Description
Y57A10C.6. Homozygous. Outer Left Sequence: AAGTTTGGTTGCCCAGTGAA. Outer Right Sequence: CCTGGCTACGTAGTTCCCAA. Inner Left Sequence: ACTTTTCCGATTTTCCGGTT. Inner Right Sequence: TCGTTGGAGTCGGTATGACA. Inner primer WT PCR product: 2202. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB860 |
C. elegans |
nck-1(ok694) X. Show Description
ZK470.5. Homozygous. Outer Left Sequence: TCTTGCCAGCCTTCATTCTT. Outer Right Sequence: TGTTGGATTTGTGCCTTCAA. Inner Left Sequence: TTCACCAACTTTGGCAACTG. Inner Right Sequence: GAACAATCAAGGGCTTAGCG. Inner primer WT PCR product: 2915. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB861 |
C. elegans |
F41D9.3(ok695) X. Show Description
F41D9.3. Homozygous. Outer Left Sequence: TGACACTGTTGCAGTCCTCC. Outer Right Sequence: ACAGAAGTCGTCGCTGTTGA. Inner Left Sequence: GCAGAAAGTGATCCGCATTT. Inner Right Sequence: TAACTACTCGTGCGCATTGG. Inner primer WT PCR product: 3367. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB862 |
C. elegans |
zig-2(ok696) X. Show Description
F42F12.2. Homozygous. Outer Left Sequence: TTTGTTTCGGGTAAAGCCAC. Outer Right Sequence: TTGCGCCCTCTAGAAACACT. Inner Left Sequence: TTTGTCTTGCCCCACCTAAC. Inner Right Sequence: AGCAAAGCAAAGGGCAACTA. Inner primer WT PCR product: 2229. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB863 |
C. elegans |
F22E12.2(ok697) V. Show Description
F22E12.2. Homozygous. Outer Left Sequence: TGTCGCCACGTAATCACATT. Outer Right Sequence: ATCCTCGTGCCACTCACTTT. Inner Left Sequence: ACACTTCTCCTCAACCCCCT. Inner Right Sequence: TGGCAACTTGCAAAATGTGT. Inner primer WT PCR product: 2460. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB864 |
C. elegans |
xpa-1(ok698) I. Show Description
K07G5.2. Homozygous. Outer Left Sequence: TGAGCGAGGAGAAAGAGAGC. Outer Right Sequence:AAAAACGACACGATAACGGC. Inner Left Sequence: AGATAGCCGGAATAGCTGGC. Inner Right Sequence: CTGGAGCCAATCCAACTGAT. Inner primer WT PCR product: 2133. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB865 |
C. elegans |
C05D2.3(ok703) III. Show Description
C05D2.3. Homozygous. Outer Left Sequence: AGATATTGCGACCCACTTG. Outer Right Sequence: TGTCGTCTATGCCGTTCAA. Inner Left Sequence: CGGATGTGAAGCCTGGTTA. Inner Right Sequence: GCGCAATTTCACGATCAAT. Inner primer WT PCR product: 2405. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB866 |
C. elegans |
klp-10(ok704) IV. Show Description
C33H5.4. Homozygous. Outer Left Sequence: CACACACCGAGACTGACGA. Outer Right Sequence: TTGATTCTCAGCCAGGCTCT. Inner Left Sequence: TAAATTAGCGATGCCCGAA. Inner Right Sequence: TTCTTCTTGTGCCTGCATTG. Inner primer WT PCR product: 2678. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB867 |
C. elegans |
haf-1(ok705) IV. Show Description
C30H6.6. Homozygous. Outer Left Sequence: CACCCCTGTCACAGACCTTT. Outer Right Sequence: CGCCAGAGAACAACAGATG. Inner Left Sequence: TGGGCACAAGTTTCATGGT. Inner Right Sequence: AATTTTCTCGCCCTCCAGAT. Inner primer WT PCR product: 2412. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB868 |
C. elegans |
xnd-1(ok708). Show Description
C05D2.5. Homozygous. Outer Left Sequence: GAACCCATTGTTGCCAATCT. Outer Right Sequence: GAGGATCGTCATTTCCCTGA. Inner Left Sequence: TTTTCCACCAATATCCCCAA. Inner Right Sequence: TTGAAGCCCTTTTGTCAACC. Inner primer WT PCR product: 2810. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB869 |
C. elegans |
xnd-1(ok709). Show Description
C05D2.5. Homozygous. Outer Left Sequence: GAACCCATTGTTGCCAATCT. Outer Right Sequence: GAGGATCGTCATTTCCCTGA. Inner Left Sequence: TTTTCCACCAATATCCCCAA. Inner Right Sequence: TTGAAGCCCTTTTGTCAACC. Inner primer WT PCR product: 2810. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB870 |
C. elegans |
F39H12.4(ok711) X. Show Description
F39H12.4. Homozygous. Outer Left Sequence: GTTTCGTCGACTTTGCATCA. Outer Right Sequence: GCACTACACCTTCCGAGAGC. Inner Left Sequence: CCGATAGGGTTGCTTGATGT. Inner Right Sequence: GGTGCAACCGAAAGTTTGTT. Inner primer WT PCR product: 2828. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB871 |
C. elegans |
gly-13(ok712) X. Show Description
B0416.6. Homozygous. Outer Left Sequence: TGTTTCAAAACGCTCACTCG. Outer Right Sequence: TTCCATAACTGCAGTCGCAA. Inner Left Sequence: TTCGGTAAGAATGAAACCCG. Inner Right Sequence: TTCAAAACGGGAATCTGGAG. Inner primer WT PCR product: 3235. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB872 |
C. elegans |
R09E10(ok713) IV. Show Description
R09E10. Homozygous. Outer Left Sequence: ATTTGCCGTCAAAACTGACC. Outer Right Sequence: TACATTGTTGCCCACTGCAT. Inner Left Sequence: TGCAGCTGATCGTTTCATTC. Inner Right Sequence: TGCAGGTGTGAAGTGGACTC. Inner primer WT PCR product: 3420. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB873 |
C. elegans |
lig-4(ok716) III. Show Description
C07H6.1. Homozygous. Outer Left Sequence: TCATTGTCCGTCTCTTTCCC. Outer Right Sequence: TCCTGAATCTCGAATCCACC. Inner Left Sequence: TGGCGTCAGATGTGATCTTC. Inner Right Sequence: ACATCAGAAGGCAACCAAGC. Inner primer WT PCR product: 3201. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB874 |
C. elegans |
M110.7(ok721) II. Show Description
M110.7. Homozygous. Outer Left Sequence: ACTTCATTCATCGCGAATCC. Outer Right Sequence: TTCTTGCACATCCAAGCAAC. Inner Left Sequence: GGAAAGTGTTTGAATGCGGT. Inner Right Sequence: AAGACTCACAGCTGCCTGGT. Inner primer WT PCR product: 2923. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB875 |
C. elegans |
baz-2&ZK783.6(ok722) III. Show Description
ZK783.4 Homozygous. Outer Left Sequence: TCAGCTATCAAGCTCCGGTT. Outer Right Sequence: TGAACGTGCTCTTCATCGTC. Inner Left Sequence: CGTCATACGCCCAGAAGAAT. Inner Right Sequence: ACCAGTTGGTGAGAAATCCG. Inner Primer PCR Length: 3113. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB876 |
C. elegans |
zig-6(ok723). Show Description
T03G11.8. Homozygous. Outer Left Sequence: GGAGTGAACACCAACCTCGT. Outer Right Sequence: TTTTTCGCACTTCTTGCCTT. Inner Left Sequence: AAAATTGCGTTCAACCAAGC. Inner Right Sequence: TAGCCTTCGGCGTTCTTTTA. Inner primer WT PCR product: 2398. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB877 |
C. elegans |
nth-1(ok724) III. Show Description
R10E4.5. Homozygous. Outer Left Sequence: AGAATGCGGTAAAACGATGC. Outer Right Sequence: TGATGAATTGCATCCGAAAA. Inner Left Sequence: ACAGTGAATATGACGCGCAA. Inner Right Sequence: GCACACCTTCCTTTCTCTGC. Inner primer WT PCR product: 2170. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB878 |
C. elegans |
T21H8.1(ok725) X. Show Description
T21H8.1. Homozygous. Outer Left Sequence: CCATTCGTATGGTGTGCAAG. Outer Right Sequence: ACGCATTATTCGGATTCTGG. Inner Left Sequence: CATGGTCCATTTCGTTCTGA. Inner Right Sequence: AACAGGAGTGCCCACGTTAC. Inner primer WT PCR product: 2713. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB879 |
C. elegans |
wnk-1(ok266) IV. Show Description
C46C2.1 Homozygous. Outer Left Sequence: CAAAACGACTCTGCTCCACA. Outer Right Sequence: GCAATTGTGCATGGTTTGTC. Inner Left Sequence: CAACGACATCATCTCCATCG. Inner Right Sequence: TGTCAAGTCGACACGAGACC. Inner Primer PCR Length: 3092. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB880 |
C. elegans |
Y74C9A.4(ok727). Show Description
Y74C9A.4. Homozygous. Outer Left Sequence: CATCGATTGGATCAGCTTCA. Outer Right Sequence: GCGCCCAAAAATTACAAAAA. Inner Left Sequence: GCCTGATGGTTTACGGAGAA. Inner Right Sequence: TTGATTTTCAGACGTGCAGC. Inner Primer WT PCR Product: 3251. Deletion size: 696 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB881 |
C. elegans |
srp-9(ok728) V. Show Description
F09C6.5. Homozygous. Outer Left Sequence: TTCACCATCGGTTACGACAA. Outer Right Sequence: ATTATGGACTTGCGAGGTGC. Inner Left Sequence: GACTCGAGGACAGGGATCAA. Inner Right Sequence: CACCTACCTCTACCGCCAAA. Inner primer WT PCR product: 2731. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB882 |
C. elegans |
C44B12.7(ok731) IV. Show Description
C44B12.7. Homozygous. Outer Left Sequence: GGTCAGCGGTGTAACTTGGT. Outer Right Sequence: CATAACCGGGATATCGGATG. Inner Left Sequence: TCAAGTTGCCGGAAGTTTTT. Inner Right Sequence: TGAATAAAGCCTCCCAGTCG. Inner primer WT PCR product: 2120. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB883 |
C. elegans |
kqt-2(ok732) X. Show Description
M60.5. Homozygous. Outer Left Sequence: TCTTTGTCGGAGAAGCCACT. Outer Right Sequence: GCAAATTCAAAAGTTGGGGA. Inner Left Sequence: GAGAATGCCGGAAAATTCAA. Inner Right Sequence: TGGCAATAAAGTGACGCTTG. Inner primer WT PCR product: 3213. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB884 |
C. elegans |
fkh-10(ok733) I. Show Description
C25A1.2. Homozygous. Outer Left Sequence: ATTGAACCCCCTGAATTTCC. Outer Right Sequence: CAGGGCATCAAAAACTGACA. Inner Left Sequence: ATCTGTGTGCAGATGCTTGC. Inner Right Sequence: GGGAAAATGTTTTCAGCCAA. Inner primer WT PCR product: 2131. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB885 |
C. elegans |
Y76B12C.2(ok734) IV. Show Description
Y76B12C.2. Homozygous. Outer Left Sequence: ATTGGCAAAAGGTGAACGTC. Outer Right Sequence: CAGTTTCAAAGCATTTCGCA. Inner Left Sequence: CGGAAGATGAATGGGAAGAA. Inner Right Sequence: GACAAGCGACTCGTCTAGGG. Inner primer WT PCR product: 2715. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB886 |
C. elegans |
adr-2(ok735) III. Show Description
T20H4.4. Homozygous. Outer Left Sequence: CTCCATATTCGCTTCCGTGT. Outer Right Sequence: AGAACACGCTCTTCGTCGAT. Inner Left Sequence: CACGATGCTGCATGAGATTT. Inner Right Sequence: AGCTCGCTTCCAATCTTCAA. Inner primer WT PCR product: 2144. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB887 |
C. elegans |
C36H8.1(ok736) IV. Show Description
C36H8.1. Homozygous. Outer Left Sequence: GTGAAACCGATTTTGATGGG. Outer Right Sequence: GCGCGAGATGCTCTTTTATT. Inner Left Sequence: ATTTTGCACAACATAGGCCC. Inner Right Sequence: CCCTACTCGGATTCGTCAAA. Inner primer WT PCR product: 2103. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB888 |
C. elegans |
casy-1(ok739) II. Show Description
B0034.3. Homozygous. Outer Left Sequence: CCTTCGCGGTTTTTATTGAA. Outer Right Sequence: CCATCATTTGTGCAATACGC. Inner Left Sequence: AAAGAAGAAAATCGTGGCGA. Inner Right Sequence: ATTGCTCACATCGAGCCTCT. Inner primer WT PCR product: 2331. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB889 |
C. elegans |
ceh-40(ok740) X. Show Description
F17A2.5. Homozygous. Outer Left Sequence: AACAGTTGATGTTCCTCCCG. Outer Right Sequence: ACAATGGGCGAATAATCCA. Inner Left Sequence: GGGCCATCTGAAAATGAGAA. Inner Right Sequence: CCCACCTCTCGCTAATGTGT. Inner primer WT PCR product: 2509. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB891 |
C. elegans |
ent-1(ok743) IV. Show Description
ZK809.4. Homozygous. Outer Left Sequence: ACGACCGTGGTAATCGAAAG. Outer Right Sequence: ACCATTCAGGTTCAGGTTGC. Inner Left Sequence: GGAGAACAACGAGATGGTGC. Inner Right Sequence: GCAAAAGTAGGCGGAGTTTG. Inner primer WT PCR product: 2879. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
