Search Strains

More Fields
Strain Species Genotype Add
CX2065 C. elegans odr-1(n1936) X. Show Description
Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. [NOTE: the n1936 mutation is a G-to-A substitution at the end of the second exon (donor site). N2: 5'AGTTGAGGTAATTCA3'. n1936: 5'AGTTGAGATAATTCA3'. Recommended sequencing primers: FWD 5'gcaggagctcacatcggtta3'; REV 5'ttggaatcacatcctgcatga3'.]