Search Strains

More Fields
Strain Species Genotype Add
CB1073 C. elegans che-5(e1073) IV. Show Description
Unc. Chemotaxis abnormal. Short. Variable Dpyish. M-MATING++ 1-10%WT.
PS7220 C. elegans flp-34(sy810) V. Show Description
flp-34(sy810) is a CRISPR/Cas9-engineered 1,365-bp deletion flanked by the sequences TCAAATTTTTTGAGGAAATCCTCCTGAAAC and AATATTTTCGAGTTTCGAAACATTTCAAAT with a AATATATTTTCGAGTTTCGAAACATATTTTCGAGTTTCGAAACAC insertion. Reference: Lee JS, et al. Proc Natl Acad Sci USA. 2017 Dec 12;114(50):E10726-E10735. PMID: 29167374