Caenorhabditis Genetics Center (CGC)

Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB846 C. elegans F01D5.9(ok673) II. Show Description
F01D5.9. Homozygous. Outer Left Sequence: ATCATCAGTTTTCTTGGCGG. Outer Right Sequence: TTTTGCAGTGAGCGAAAATG. Inner Left Sequence: CTCTCCATTTCTCACCGCTC. Inner Right Sequence: TTCATGCGGAAATTGTTGAA. Inner primer WT PCR product: 2808. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
SOZ300 C.elegans cyp-37A1(ssd9) II. Show Description
ssd9 is a Class III supersized lipid droplet mutation. 68bp deletion 5' flanking sequence: cacacatccgtacgtggtgg. 3' flanking sequence: cgacaactgattggttatga References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846. cyp-37A1 previously known as drop-1.
SOZ0300 C.elegans drop-1/cyp-37A1(ssd9) Show Description
drop-1 a.k.a.- cyp-37A1. ssd9 is a Class III supersized lipid droplet mutation. 68bp deletion 5' flanking sequence: cacacatccgtacgtggtgg. 3' flanking sequence: cgacaactgattggttatga References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846.