Laboratory Information
| Name | MC View on WormBase |
|---|---|
| Allele designation | gc |
| Head | Charles Michael Crowder |
| Institution | University of Washington Medicine, Seattle, WA |
| Address | University of Washington, Mitochondria & Metabolism Center 850 Republican Street Seattle 98109 United States |
| Website | http://depts.washington.edu/mmcslu/ |
| Gene classes | erfa hyp |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| MC339 | unc-64(md130) III. | C. elegans | Recessive. Mild uncoordination and aldicarb resistance. Marked resistance to volatile anesthetics, isoflurane and halothane, is semi-dominant. Isolated in RM25 (essentially the same as TR403 - high copy Tc1). [NOTE (07/09/2020): a user has reported their stock received in Dec 2019 is not resistant to isofluorane] |
| MC805 | tars-1(gc52) II. | C. elegans | gc52 mutants are hypoxia-resistant and have a reduced translation rate. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031. |
| MC814 | rtcb-1(gc50) I. | C. elegans | gc50 mutants are hypoxia-resistant. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031. |
| MC817 | ddx-52(gc51) I. | C. elegans | Temperature-sensitive: can be maintained at 20C, larval arrest (L3) at 25C. gc51 mutants are hypoxia-resistant. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031. |
| MC818 | xpo-3(gc59) IV. | C. elegans | gc59 mutants are hypoxia-resistant. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031. |
| MC894 | ulp-4(gc54) II. | C. elegans | Suppresses hypoxia resistance of ddx-52(gc51). gc54 and gc55 are both missense alleles of ulp-4, but may behave somewhat differently. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031. |
| MC895 | ulp-4(gc55) II. | C. elegans | Suppresses hypoxia resistance of ddx-52(gc51). gc54 and gc55 are both missense alleles of ulp-4, but may behave somewhat differently. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031. |
| MC896 | nol-10(gc58) IV. | C. elegans | Gain-of-function mutation. Suppresses hypoxia resistance of ddx-52(gc51). Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031. |
| MC907 | aatf-1(gc63 gc64) I. | C. elegans | Gain-of-function mutation. Suppresses hypoxia resistance of ddx-52(gc51). gc63 gc64 occurred in the same mutagenesis; unclear which allele (or if both) is causing the gain of function. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031. |
| XMN1253 | daf-15(bgg95) IV. | C. elegans | Maintain at 20C for best fecundity and most rapid development. Variable temperature-sensitive phenotypes. 20C: wild type; 22C: hypoxia resistant and long lifespan; 25C fully penetrant L3 developmental arrest. daf-15(bgg95) is an engineered I1033K missense mutation that also introduced three silent wobble mutations in nearby bases affecting restriction sites (cagGTTGCCCGAATGGCTCAAAAAATAGTGCAT -> cagGTGGCACGGATGGCTCAAAAAAAAGTGCAT). Strain can be genotyped by digest with either Bcc1 (silent wobble mutation generates additional cut in bgg95) or with Bgl1 (silent wobble mutation eliminates cut in bgg95). daf-15 crRNA: aucucgucagguugcccgaa. Repair ssODN: CATTTCGGGCATTCCTGCTTCGACGCGATGCACTTTTTTTTGAGCCATCCGTGCCACCTGACGAGATGTATTGGTTGTATTACACAGAC. Reference: Sun CL, et al. Curr Biol. 2025 Jun 9;35(11):2567-2582.e5. doi: 10.1016/j.cub.2025.04.040. PMID: 40339571. |
This laboratory hasn't submitted any alleles to the CGC.