Laboratory Information

NameMC View on WormBase
Allele designationgc
HeadCharles Michael Crowder
InstitutionUniversity of Washington Medicine, Seattle, WA
Address University of Washington, Mitochondria & Metabolism Center
850 Republican Street
Seattle 98109
United States
Website http://depts.washington.edu/mmcslu/
Gene classes erfa  hyp 

Strains contributed by this laboratory

Strain Genotype Species Description
MC339 unc-64(md130) III. C. elegans Recessive. Mild uncoordination and aldicarb resistance. Marked resistance to volatile anesthetics, isoflurane and halothane, is semi-dominant. Isolated in RM25 (essentially the same as TR403 - high copy Tc1). [NOTE (07/09/2020): a user has reported their stock received in Dec 2019 is not resistant to isofluorane]
MC805 tars-1(gc52) II. C. elegans gc52 mutants are hypoxia-resistant and have a reduced translation rate. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
MC814 rtcb-1(gc50) I. C. elegans gc50 mutants are hypoxia-resistant. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
MC817 ddx-52(gc51) I. C. elegans Temperature-sensitive: can be maintained at 20C, larval arrest (L3) at 25C. gc51 mutants are hypoxia-resistant. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
MC818 xpo-3(gc59) IV. C. elegans gc59 mutants are hypoxia-resistant. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
MC894 ulp-4(gc54) II. C. elegans Suppresses hypoxia resistance of ddx-52(gc51). gc54 and gc55 are both missense alleles of ulp-4, but may behave somewhat differently. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
MC895 ulp-4(gc55) II. C. elegans Suppresses hypoxia resistance of ddx-52(gc51). gc54 and gc55 are both missense alleles of ulp-4, but may behave somewhat differently. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
MC896 nol-10(gc58) IV. C. elegans Gain-of-function mutation. Suppresses hypoxia resistance of ddx-52(gc51). Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
MC907 aatf-1(gc63 gc64) I. C. elegans Gain-of-function mutation. Suppresses hypoxia resistance of ddx-52(gc51). gc63 gc64 occurred in the same mutagenesis; unclear which allele (or if both) is causing the gain of function. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
XMN1253 daf-15(bgg95) IV. C. elegans Maintain at 20C for best fecundity and most rapid development. Variable temperature-sensitive phenotypes. 20C: wild type; 22C: hypoxia resistant and long lifespan; 25C fully penetrant L3 developmental arrest. daf-15(bgg95) is an engineered I1033K missense mutation that also introduced three silent wobble mutations in nearby bases affecting restriction sites (cagGTTGCCCGAATGGCTCAAAAAATAGTGCAT -> cagGTGGCACGGATGGCTCAAAAAAAAGTGCAT). Strain can be genotyped by digest with either Bcc1 (silent wobble mutation generates additional cut in bgg95) or with Bgl1 (silent wobble mutation eliminates cut in bgg95). daf-15 crRNA: aucucgucagguugcccgaa. Repair ssODN: CATTTCGGGCATTCCTGCTTCGACGCGATGCACTTTTTTTTGAGCCATCCGTGCCACCTGACGAGATGTATTGGTTGTATTACACAGAC. Reference: Sun CL, et al. Curr Biol. 2025 Jun 9;35(11):2567-2582.e5. doi: 10.1016/j.cub.2025.04.040. PMID: 40339571.
This laboratory hasn't submitted any alleles to the CGC.