| BW1932 |
ctIs39. |
ctIs39 [hbl-1p::GFP::NLS::hbl-1 3'UTR + rol-6(su1006)]. Rollers. Reporter encodes the first 133 amino acids of HBL-1 followed by GFP with SV40 NLS and 1.4 kb of hbl-1 3' UTR. Reference: Fay DS, et al. Dev Biol. 1999 Jan 15;205(2):240-53. |
| CT11 |
hbl-1(mg285) X. |
Egl. Slightly Pvl. |
| MLC618 |
hbl-1(luc32) X. |
luc32 is a 670 bp deletion in the hbl-1 3'UTR. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047. |
| RG559 |
hbl-1(ve18) X. |
Pvul. Egl. Precocious alae. Heterochronic defects are suppressed in post-dauer stage animals. Reference: Abrahante JE, et al. Dev Cell. 2003 May;4(5):625-37. |
| VT1146 |
nDf51 V; hbl-1(ve18) mir-84(n4037) X. |
Weak retarded heterochronic phenotype with incomplete alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA). |
| VT3500 |
wIs51 V; hbl-1(ma354) X. |
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111. |
| VT3751 |
maIs105 V; hbl-1(ma430[hbl-1::mScarlet-I]) X. |
maIs105 [col-19::GFP] V. hbl-1(ma430) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1. Reference: Ilbay O & Ambros V. Curr Biol. 2019 Jun 3;29(11):1735-1745.e4. |
| VT3869 |
wIs51 V; hbl-1(ma430ma475[hbl-1::mScarlet-I::partial deletion of hbl-1 3'UTR]) X |
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Retarded Heterochronic defects: extra seam cells and partial or no alae in young adults. hbl-1(ma430ma475) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1 and part of the 3' UTR removed. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21). |
| VT3922 |
lin-28(n719) I; daf-12(ma497[daf-12::gfp]) hbl-1(ma430[hbl-1::mScarlet-I]) X. |
Precocious heterochronic phenotypes as preciously reported for lin-28(n719). Endogenous daf-12 locus tagged with GFP. hbl-1(ma430) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21). |