Laboratory Information
| Name | UJ View on WormBase |
|---|---|
| Allele designation | miz |
| Head | Kota Mizumoto |
| Institution | University of British Columbia, Vancouver, BC, Canada |
| Address | 2350 Health Sciences Mall LSC2406 Vancouver V6T1Z3 Canada |
| Gene classes |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| UJ1300 | unc-9(miz81[unc-9::7xGFP11]) X; juIs463. | C. elegans | juIs463 [flp-13p::GFP1-10 + ttx-3p::RFP]. 7xGFP11 tag inserted into endogenous unc-9 locus. unc-9(miz81) is Unc, possibly due to increased channel activity. Reference: Hendi A, et al. Elife. 2022 Nov 15;11:e80555. doi: 10.7554/eLife.80555. PMID: 36378164. |
| UJ1940 | syd-2(miz231[7xGFP11::syd-2]) X. | C. elegans | 7xGFP11 tag inserted at 5' end of endogenous syd-2 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832. |
| UJ2015 | rab-3(miz237[4xwrmScarlet11::rab-3b]) II. | C. elegans | 4xwrmScarlet11 tag inserted inserted at 5' end of rab-3b locus using CRISPR/Cas9. Insertion confirmed by sequencing. wrmScarlet11::RAB-3B shows smaller RAB-3 puncta compared to over-expression reporters. The fusion protein is likely non-functional as the strain shows strong aldicarb resistance; however, the localization pattern of 4×wrmScarlet::RAB-3 is similar to that of transgenically expressed RAB-3. 4×wrmScarlet11::rab-3b strain also labels rab-3a; it is possible that 4×wrmScarlet11 inserted in the middle of rab-3a isoform disrupts the functions of RAB-3 in neurotransmission. Reference: Kurashina M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832. |
| UJ2587 | elks-1(miz365[elks-1::7xGFP11]) IV. | C. elegans | 7xGFP11 tag inserted into endogenous elks-1 locus. ELKS-1::7xGFP localizes to tip of synapses similar to CLA-1. miz365 genotyping primers: F: TACCGGCTCCAGTGATTCC / R: tgtgtgccattggatgtgag (wt = 203bp, mutant = 676bp). Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832. |
| UJ2719 | unc-10(miz404[unc-10::7xGFP11]) X. | C. elegans | 7xGFP11 tag inserted into endogenous unc-10 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832. |
| UJ2820 | cla-1(miz321[cla-1::7xGFP11]) IV. | C. elegans | 7xGFP11 tag inserted into endogenous cla-1 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832. |
| UJ3045 | rimb-1(miz458[7xGFP11::rimb-1]) III. | C. elegans | 7xGFP11 tag inserted into 5' end of endogenous rimb-1 locus using CRISPR/Cas9. Reference: Kurashina M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832. |
| UJ3103 | sng-1(miz488[sng-1::4xmScarlet11]) X; mizIs41. | C. elegans | mizIs41 [mig-13p::mScarlet1-10::SL2::GFP1-10 + odr-1p::GFP]. 4xmScarlet11 tag inserted into endogenous sng-1 locus. miz488 genotyping primers: F: CGCACCTCCACCTCAATCC / R: AACACAACAAGACGGAAATACG. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832. |
| UJ3233 | cla-1(miz378[cla-1::8xwrmScarlet11]) IV. | C. elegans | 8xmScarlet11 tag inserted into endogenous cla-1 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832. |
| UJ3321 | syd-2(miz329 [8xwrmScarlet11::syd-2]) X. | C. elegans | 8xwrmScarlet11 tag inserted at 5' end of endogenous syd-2 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832. |
This laboratory hasn't submitted any alleles to the CGC.