| UDN100022 |
rab-5(udn11)/tmC18 [dpy-5(tmIs1200)] I. |
C. elegans |
rab-5 [D135D]. Silent BstAPI site added in D135D allele for ease of genotyping. Balancer marked with myo-2p::Venus. Reference: Huang et al. 2022. PMID: 35121658 |
| UDN100028 |
rab-5(udn14)/tmC18 [dpy-5(tmIs1200)] I. |
C. elegans |
Must be maintained at >20 degrees; grows better at 25C. Homozygous lethal rab-5 [D135H] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5[D135H] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent BstAPI site added in D135H for genotyping ease. Heterozygous rab-5[D135H] animals are small and have decreased locomotion. Reference: Huang et al. 2022. PMID: 35121658 |
| UDN100035 |
rab-5(udn17)/tmC18 [dpy-5(tmIs1200)] I. |
C. elegans |
Homozygous lethal rab-5 [Q78R] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78R] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent KpnI site added in Q78R for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658 |
| UDN100037 |
rab-5(udn15)/tmC18 [dpy-5(tmIs1200)] I. |
C. elegans |
rab-5 [Q78Q]/tmC18 I. Control edit mutation maintained over tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78Q] homozygotes (viable and fertile), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. NOTE: udn15 is essentially wild-type. Pick Venus+ to prevent non-Venus rab-5 [Q78Q] homozygotes from taking over the population and losing the balancer! Silent KpnI site added in Q78Q allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658 |
| UDN100039 |
sel-2(udn20) III. |
C. elegans |
Variant edit allele, G1514R. SpeI restriction site created by synonymous changes for ease of genotyping. |
| UDN100043 |
sel-2(udn24) III. |
C. elegans |
Control edit allele, G1514G. SpeI restriction site created by synonymous changes for ease of genotyping. |
| UDN100047 |
let-413(udn25) V. |
C. elegans |
let-413 [L248L]. Control edit. ApoI-HF restriction site created by synonymous changes for ease of genotyping. Wild-type looking. |
| UDN100049 |
let-413(udn27)/tmC3[egl-9(tmIs1230)] V. |
C. elegans |
let-413 [L248P]. Variant edit. Homozygous lethal or sterile deletion balanced by tmC3. Heterozygotes are wild-type mCherry+ and segregate mCherry+ heterozygotes, udn27 homozygotes (arrest stage unknown), and mCherry+ tmC3 homozygotes (Unc-23 Lon-3). Pick viable fertile mCherry+ animals to maintain. ApoI-HF restriction site created by synonymous changes for ease of genotyping. |
| UDN100052 |
let-413(udn30)V. |
C. elegans |
let-413 [L173L]. Control edit. DdeI restriction site created by synonymous changes for ease of genotyping. Wild-type looking. |
| UDN100054 |
let-413(udn32) V. |
C. elegans |
let-413 [L173M]. Variant edit. DdeI restriction site created by synonymous changes for ease of genotyping. Wild-type looking. |
| UDN100067 |
rab-5(udn14) I; udnSi38 II. |
C. elegans |
udnSi38 [rab5p::rab-5] II. rab-5 [D135H]. rab-5 variant edit #2. Homozygous lethal rab-5 [D135H] mutation rescued by a single copy of wild-type rab-5 integrated into chromosome II at ttTi5605 site (II: 0.77). Maintain at 20 degrees. Reference: Huang et al. 2022. PMID: 35121658 |
| UDN100080 |
unc-116(udn42) III. |
C. elegans |
Control edit allele T90T. Wild-type looking. TspRI restriction site created by synonymous changes for ease of genotyping. |
| UDN100083 |
unc-116(udn45)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. |
C. elegans |
nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Pick slightly dumpy GFP+ to maintain. Heterozygotes are slightly dumpy GFP+ (pharynx), and segregate slightly dumpy GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), non-GFP udn45 homozygotes (early larval arrest and Unc), and a few slow-growing wild-type looking or thin GFP+ heterozygotes. These thin GFP+ animals give rise to almost exclusively GFP+ progeny; a possible interaction between unb45 and qC1 is suspected. Variant edit allele T90I. TspRI restriction site created by synonymous changes for ease of genotyping. |
| UDN100103 |
rab-5(udn49)/tmC18 [dpy-5(tmIs1200)] I. |
C. elegans |
Homozygous lethal rab-5 [A29P] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29P] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent DdeI site added in A29P for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658 |
| UDN100126 |
rab-5(udn64)/tmC18 [dpy-5(tmIs1236)] I; udnSi38 II. |
C. elegans |
udnSi38 [rab5p::rab-5] II. Maintain at 20 degrees. rab-5 [D135N] variant edit #2 with a single copy of wild-type rab-5 integrated into chromosome II at ttTi5605 site (II: 0.77). Homozygous lethal rab-5 [D135N] mutation balanced by tmC18. Balancer marked with myo-2p::mCherry. Heterozygotes are WT with pharyngeal mCherry fluorescence, and segregate mCherry + heterozygotes, non-mCherry rab-5 [D135N] homozygotes (L1 lethal), and Dpy mCherry+ tmC18 homozygotes. Pick fertile wild-type mCherry+ to maintain. [D135N]/ [D135N]; udnSi38/udnSi38 double homozygotes are lethal. Reference: Huang et al. 2022. PMID: 35121658 |
| UDN100138 |
rab-5(udn11) I; udnSi38 II. |
C. elegans |
udnSi38 [rab5p::rab-5] II. rab-5[D135D]. rab-5 Control edit #1 with a single
copy of wild-type rab-5 integrated into chromosome II at ttTi5605 site (II: 0.77). Maintain at 20 degrees. Wild-type looking. |
| UDN100140 |
nekl-1(udn66) I. |
C. elegans |
nekl-1 Control edit H292H. AvaII restriction site created by synonymous changes for ease of genotyping. Wild-type looking. |
| UDN100142 |
nekl-1(udn68) I. |
C. elegans |
nekl-1 Variant edit H292Q. AvaII restriction site created by synonymous changes for ease of genotyping. Wild-type looking. |
| UDN100145 |
rab-5(udn47)/tmC18 [dpy-5(tmIs1200)] I. |
C. elegans |
rab-5 [A29A]/tmC18 I. Control edit mutation maintained over tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29A] homozygotes (viable and fertile), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. NOTE: udn47 is essentially wild-type. Pick Venus+ to prevent non-Venus rab-5 [A29A] homozygotes from taking over the population and losing the balancer! Silent DdeI site added in A29A allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658 |
| UDN100154 |
vps-34(udn80) I. |
C. elegans |
vps-34 [Y752C] #2. StyI restriction site created by synonymous changes, ease for genotyping. vps-34 [Y752C] are wild-type for the following phenotypes: Length, Width, Body wavelength, Crawl speed, Thrash rate, Pharyngeal Pump frequency, duration, R/E ratio, Germ cell corpse engulfment, coelomocyte endocytosis, coelomocyte size, gut vesicle size, and RAB-7(+) gut vesicle size. |
| UDN100156 |
vps-34(udn82) I. |
C. elegans |
vps-34 [Y752Y] #1. Control edit for vps-34(udn80). StyI restriction site created by synonymous changes for ease for genotyping. |
| UDN100161 |
pph-5(udn91) V. |
C. elegans |
pph-5 [A48T] #2 variant edit from Fielder, et al. (2022). Includes addition of silent AvaII restriction site and silent PAM ablation. Homozygous viable and superficially wild-type. Genotype using primers Forward: accggaaattgtcccaaaat, Reverse: tttccgactttctggaggtg. Digest with AvaII restriction enzyme for resulting sizes of 401bp +403bp. Wild-type product will not be digested. |
| UDN100163 |
pph-5(udn93) V. |
C. elegans |
pph-5 [A48A] #1 control edit for strain UDN100160 from Fielder, et al. (2022). Wild-type sequence except for addition of silent AvaII restriction site and silent PAM ablation. Homozygous viable and wild-type appearance. Genotype using primers Forward: accggaaattgtcccaaaat, Reverse: tttccgactttctggaggtg. Digest with AvaII restriction enzyme for resulting sizes of 401bp +403bp. Wild-type product will not be digested. |
| UDN100169 |
unc-116(gk5722udn86)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. |
C. elegans |
nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), and non-GFP gk5722udn86 homozygotes (larval arrest; few escapers). Derived from VC4653; selection cassette in VC4653 was removed, and then crossed with qC1 nIs189 [myo-2::GFP] balancer. |
| UDN100194 |
popl-5(udn113)/tmC29 [unc-49(tmIs1259)] III. |
C. elegans |
popl-5 [S99I]/tmC29 III. Variant edit. Lethal mutation balanced by tmC29. Balancer marked with myo-2p::GFP. Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP popl-5 [S99I] homozygotes (larval lethal), and Unc GFP+ tmC29 homozygotes. Pick fertile wild-type GFP+ to maintain. NOTE: udn113 homozygotes are partially L3 larval lethal: some homozygotes can develop into sterile adults with protruding vulvae. Pick fertile GFP+ to maintain. AvaII site added in S99I allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658 |
| UDN100201 |
jsSi1579 jsSi1606 II. |
C. elegans |
jsSi1606 [loxP::unc-116(+)::FRT3] II. Single copy unc-116(+) insertion at the standard Chr II ttTi5605 mosSCI site. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/). |
| UDN100215 |
popl-5(udn109)/tmC29 [unc-49(tmIs1259)] III. |
C. elegans |
popl-5 [S99S]/tmC29 III. Control edit mutation maintained over tmC29. Balancer marked with myo-2p::GFP. Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP popl-5 [S99S] homozygotes (viable and fertile), and Unc GFP+ tmC29 homozygotes. Pick fertile wild-type GFP+ to maintain. NOTE: udn109 is essentially wild-type. Pick GFP+ to prevent non-GFP popl-5 [S99S] homozygotes from taking over the population and losing the balancer! Silent AvaII site added in S99S allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658 |