Laboratory Information
| Name | SOZ View on WormBase |
|---|---|
| Allele designation | ssd |
| Head | Zhang, Shaobing |
| Institution | Capital Normal University, Beijing, China |
| Address | College of Life Sciences Capital Normal University 105 Xi-San-Huan-Bei-Lu Beijing 100048 China |
| Website | http://smkxxy.cnu.edu.cn/szll/zrjs/js/62954.htm |
| Gene classes | drop |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| SOZ259 | prx-10(ssd68) | C. elegans | Class I supersized lipid droplet mutant. Peroxisomal import defective. Homozygous viable. TGT-->TAT mutation, 5' flanking sequence acatttattctgttggacgt, 3' flanking sequence tattcaggagcacgcagtag . |
| SOZ300 | cyp-37A1(ssd9) II. | C.elegans | ssd9 is a Class III supersized lipid droplet mutation. 68bp deletion 5' flanking sequence: cacacatccgtacgtggtgg. 3' flanking sequence: cgacaactgattggttatga References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846. cyp-37A1 previously known as drop-1. |
| SOZ511 | emb-8(ssd89) III. | C. elegans | emb-8 (a.k.a.- drop-8) Class III supersized lipid droplet mutation. ssd89 is a GGT-->GAT mutation. 5' flanking sequence: ggtgctcactctgctcgctg. 3' flanking sequence: tggagcaattatattccttt References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846. |
This laboratory hasn't submitted any alleles to the CGC.