Laboratory Information

NameSOZ View on WormBase
Allele designationssd
HeadZhang, Shaobing
InstitutionCapital Normal University, Beijing, China
Address College of Life Sciences
Capital Normal University
105 Xi-San-Huan-Bei-Lu
Beijing 100048
China
Website http://smkxxy.cnu.edu.cn/szll/zrjs/js/62954.htm
Gene classes drop 

Strains contributed by this laboratory

Strain Genotype Species Description
SOZ0259 prx-10(ssd68) C. elegans Class I supersized lipid droplet mutant. Peroxisomal import defective. Homozygous viable. TGT-->TAT mutation, 5' flanking sequence acatttattctgttggacgt, 3' flanking sequence tattcaggagcacgcagtag .
SOZ0300 drop-1/cyp-37A1(ssd9) C.elegans drop-1 a.k.a.- cyp-37A1. ssd9 is a Class III supersized lipid droplet mutation. 68bp deletion 5' flanking sequence: cacacatccgtacgtggtgg. 3' flanking sequence: cgacaactgattggttatga References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846.
SOZ0471 drop-4/sams-1(ssd206) C. elegans Class IV supersized lipid droplet mutant. GCT-->GTT mutation. 5' flanking sequence: agatccaaatgcaaaggttg. 3' flanking sequence: ttgcgagaccgtaacaaaaa
SOZ0511 drop-8/emb-8(ssd89) C. elegans Class III supersized lipid droplet mutant. GGT-->GAT mutation. 5' flanking sequence: ggtgctcactctgctcgctg. 3' flanking sequence: tggagcaattatattccttt
SOZ259 prx-10(ssd68) C. elegans Class I supersized lipid droplet mutant. Peroxisomal import defective. Homozygous viable. TGT-->TAT mutation, 5' flanking sequence acatttattctgttggacgt, 3' flanking sequence tattcaggagcacgcagtag .
SOZ300 cyp-37A1(ssd9) II. C.elegans ssd9 is a Class III supersized lipid droplet mutation. 68bp deletion 5' flanking sequence: cacacatccgtacgtggtgg. 3' flanking sequence: cgacaactgattggttatga References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846. cyp-37A1 previously known as drop-1.
SOZ471 sams-1(ssd206) X. C. elegans sams-1 (a.k.a.- drop-4) Class IV supersized lipid droplet mutant. GCT-->GTT mutation. 5' flanking sequence: agatccaaatgcaaaggttg. 3' flanking sequence: ttgcgagaccgtaacaaaaa References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846.
SOZ511 emb-8(ssd89) III. C. elegans emb-8 (a.k.a.- drop-8) Class III supersized lipid droplet mutation. ssd89 is a GGT-->GAT mutation. 5' flanking sequence: ggtgctcactctgctcgctg. 3' flanking sequence: tggagcaattatattccttt References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846.
This laboratory hasn't submitted any alleles to the CGC.