Laboratory Information
| Name | RJP View on WormBase |
|---|---|
| Allele designation | rp |
| Head | Roger David Pocock |
| Institution | Monash University, Clayton, Australia |
| Address | Monash University Dept of Anatomy & Developmental Biology Level 3, Building 75, 15 Innovation Walk Clayton 3800 Australia |
| Website | https://www.monash.edu/discovery-institute/pocock-lab |
| Gene classes | dvc |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| HRN666 | wrt-10(aus36) II. | C. elegans | 5-bp deletion. Superficially wild-type. Reference: https://www.micropublication.org/journals/biology/micropub-biology-000169/ |
| HRN667 | wrt-10(aus37) II. | C. elegans | 2-bp deletion. Superficially wild-type. Reference: https://www.micropublication.org/journals/biology/micropub-biology-000169/ |
| HRN680 | wrt-6(aus41) X. | C. elegans | 49-bp deletion. Superficially wild-type. Reference: https://www.micropublication.org/journals/biology/micropub-biology-000169/ |
| RJP3221 | rpIs109. | C elegans | rpIs109 [dpy-7p::NLS::dsRed2 + rol-6(su1006)]. Nuclear red fluorescence in hypodermal cells. Reference: Romanos TR, et al. Sci Rep. 2017 Aug 4;7(1):7294. doi: 10.1038/s41598-017-07876-4. PMID: 28779171. |
| RJP5269 | unc-31(rp166[GFP::TEV::AID*::FLAG::unc-31]) IV. | C. elegans | N-terminal GFP::TEV::AID*::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635 |
| RJP5296 | reSi7 I; unc-31(rp166[GFP::TEV::AID*::FLAG::unc-31]) IV. | C. elegans | reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor with N-terminal GFP::TEV::AID*::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9 can be used for conditional depletion of UNC-31 in the nervous system. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp). |
| RJP56 | egl-46(rp4) vsIs33 V; rpIs3. | C. elegans | rpIs3 [gcy-33p::GFP]. vsIs33 [dop-3::RFP] V. Loss of BAG neuron specification. egl-46(rp4) is a point mutation that causing a single amino acid change (C185Y) in the zinc finger domain of EGL-46; it behaves like a null for BAG specification phenotypes. |
This laboratory hasn't submitted any alleles to the CGC.