Laboratory Information
| Name | RJP View on WormBase |
|---|---|
| Allele designation | rp |
| Head | Roger David Pocock |
| Institution | Monash University, Clayton, Australia |
| Address | Monash University Dept of Anatomy & Developmental Biology Level 3, Building 75, 15 Innovation Walk Clayton 3800 Australia |
| Website | https://www.monash.edu/discovery-institute/pocock-lab |
| Gene classes | dvc |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| HRN666 | wrt-10(aus36) II. | C. elegans | 5-bp deletion. Superficially wild-type. Reference: https://www.micropublication.org/journals/biology/micropub-biology-000169/ |
| HRN667 | wrt-10(aus37) II. | C. elegans | 2-bp deletion. Superficially wild-type. Reference: https://www.micropublication.org/journals/biology/micropub-biology-000169/ |
| HRN680 | wrt-6(aus41) X. | C. elegans | 49-bp deletion. Superficially wild-type. Reference: https://www.micropublication.org/journals/biology/micropub-biology-000169/ |
| RJP5269 | unc-31(rp166[GFP::TEV::AID::FLAG::unc-31]) IV. | C. elegans | N-terminal GFP::TEV::degran::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635 |
| RJP5296 | reSi7 I; unc-31(rp166[GFP::TEV::AID::FLAG::unc-31]) IV. | C. elegans | reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor with N-terminal GFP::TEV::degran::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9 can be used for conditional depletion of UNC-31 in the nervous system. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635 |
| RJP56 | egl-46(rp4) vsIs33 V; rpIs3. | C. elegans | rpIs3 [gcy-33p::GFP]. vsIs33 [dop-3::RFP] V. Loss of BAG neuron specification. egl-46(rp4) is a point mutation that causing a single amino acid change (C185Y) in the zinc finger domain of EGL-46; it behaves like a null for BAG specification phenotypes. |
This laboratory hasn't submitted any alleles to the CGC.