| MT12755 |
ceh-32(ok343) V/nT1 [unc-?(n754) let-?] (IV;V). |
C. elegans |
Heterozygotes are Unc. ok343 is lethal or has a linked lethal. |
| RB1000 |
gcy-5(ok921) II. |
C. elegans |
ZK970.6 Homozygous. Outer Left Sequence: CGGTGTCATTTCAGAGAGCA. Outer Right Sequence: GTTGAGGCAACCTTAAGCGA. Inner Left Sequence: TTGCTCAGCTTTTGGCCTAT. Inner Right Sequence: AGTGCGGATTGTCTGGAAAG. Inner Primer WT PCR Product: 3316. Deletion size: 1545 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1001 |
C01F6.1(ok922) IV. |
C. elegans |
C01F6.1 Homozygous. Outer Left Sequence: GGTTTTAGGAAACGGCATCA. Outer Right Sequence: AGCGTTACGAATTTTGGCAC. Inner Left Sequence: CTAGCAGGAGTGGTCTTGCC. Inner Right Sequence: GGATCAAAATGGAACATCCG. Inner Primer WT PCR Product: 2438. Deletion size: 1583 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1002 |
T19D2.1(ok923) X. |
C. elegans |
T19D2.1. Homozygous. Outer Left Sequence: GAGGAAATCGCGATGAAGAG. Outer Right Sequence: TCTCCGCAGTTTACAGAGCA. Inner Left Sequence: AGAGTTGGCTGTATTTGCGG. Inner Right Sequence: CGGCACATTCTGAAAGTCAA. Inner Primer WT PCR Product: 3298. Deletion size: 1666 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1003 |
aco-1(ok924) X. |
C. elegans |
ZK455.1. Previously called gei-22. Homozygous. Outer Left Sequence: CACACACAAAAACGGACAGG. Outer Right Sequence: TCGTTGCTCCAAATCACAAA. Inner Left Sequence: AGACGAGCTTCCAATCTCCA. Inner Right Sequence: TTCCTCCGTTGCGGTAATAG. Inner Primer WT PCR product: 2984. Deletion size: 540 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1004 |
K08E3.4(ok925). |
C. elegans |
K08E3.4. Homozygous. Outer Left Sequence: GGATGGACTCGAACCAAAAA. Outer Right Sequence: TTCTGGAGGGTCTCTGCCTA. Inner Left Sequence: TTGCAGGAAACACAACGAAG. Inner Right Sequence: CAAATTTGCCATATGTTGCG. Inner Primer WT PCR product: 2983. Deletion size: 1146 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1005 |
R02D3.1(ok926) IV. |
C. elegans |
R02D3.1. Homozygous. Outer Left Sequence: TGTTCAAGCGTAACACGACC. Outer Right Sequence: AAACCATTTGGATTGCCGTA. Inner Left Sequence: CAGATGTCTGCCGCTGTAAC. Inner Right Sequence: TTCAACACAACCAAATCCGA. Inner Primer WT PCR product: 3055. Deletion size: 923 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1006 |
C08B6.4(ok890) V. |
C. elegans |
C08B6.4. Homozygous. Outer Left Sequence: AACACAACGAGGGACCTGAC. Outer Right Sequence: TGAACGCATCTGGATCATGT. Inner Left Sequence: GAGTCGGGGAAAAAGGGATA. Inner Right Sequence: GGTCGACCTAATGGAGACCA. Inner Primer WT PCR product: 2177. Deletion size: 1624 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1007 |
C16C10.12(ok927) III. |
C. elegans |
C16C10.12. Homozygous. Outer Left Sequence: GAGAAAGTGAGCTCCGCAAT. Outer Right Sequence: GCCTACAAAAATGCCATTCG. Inner Left Sequence: ATCACATCGAGGCAAGCTCT. Inner Right Sequence: CAATCGATACAAGCAGCCAA. Inner Primer WT PCR Product: 2693. Deletion size: 635 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1008 |
cri-2(ok928) V. |
C. elegans |
K07C11.5. Homozygous. Outer Left Sequence: GAACGGCCTATGGTGACACT. Outer Right Sequence: TGAGCAGAACGAAAGGAGGT. Inner Left Sequence: GACAATTGTTTTTGGACGGG. Inner Right Sequence: CCGAGCAAATTTGGAAACAT. Inner Primer WT PCR product: 2642. Deletion size: 1680 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1009 |
Y48C3A.14(ok929) II. |
C. elegans |
Y48C3A.14 [Merged Y48C3A.15 in to this gene based on BLASTX homologies.] Homozygous. Outer Left Sequence: GACACCCTTGGTGTTCAGGT. Outer Right Sequence: ATCACTTTTCCTCGGGGAGT. Inner Left Sequence: TTGTGGCGACTCTGATGAAG. Inner Right Sequence: ACGAACATTTGAATTTCCCG. Inner Primer WT PCR Product: 2998. Deletion size: 2275 bp; includes insertion of approximately 1150 bp at break. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1010 |
gcy-5(ok930) II. |
C. elegans |
ZK970.6. Homozygous. Outer Left Sequence: CGGTGTCATTTCAGAGAGCA. Outer Right Sequence: GTTGAGGCAACCTTAAGCGA. Inner Left Sequence: TTGCTCAGCTTTTGGCCTAT. Inner Right Sequence: AGTGCGGATTGTCTGGAAAG. Inner Primer WT PCR Product: 3316. Deletion size: 2542 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1011 |
crb-1(ok931) X. |
C. elegans |
F11C7.4 Homozygous. Outer Left Sequence: TGAATCTTTGCAATTCGTGG. Outer Right Sequence: CTTGGTGTTCAACATGACCG. Inner Left Sequence: ATTGGCAAACGATTTTCTCG. Inner Right Sequence: CAGTCAACGGACAGCTTGAA. Inner Primer WT PCR Product: 3232. Deletion size: 843 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1012 |
egl-8(ok934) V. |
C. elegans |
B0348.4a Homozygous. Outer Left Sequence: ACATCCGGAGCTAAAGCAGA. Outer Right Sequence: CGCCGAGAAAGCAATAGAAC. Inner Left Sequence: TGCTACCTATTGGGTTTCGG. Inner Right Sequence: TGGCCGAGTTTTCTCATCTC. Inner Primer PCR Length: 2928. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1013 |
pax-2(ok935) IV. |
C. elegans |
K06B9.5. Homozygous. Outer Left Sequence: GGGCAGAACACGAATTTTTC. Outer Right Sequence: GCACATCCCTGGTTGAAACT. Inner Left Sequence: CGCAAATTTGGTCCTGAAAT. Inner Right Sequence: CTCCGCCTACTGTTAGCTCG. Inner Primer WT PCR product: 2959. Deletion size: 1620 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1015 |
nhr-66(ok940). |
C. elegans |
T09A12.4. Homozygous. Outer Left Sequence: GGTATCTGCCTTGTTCTGCC. Outer Right Sequence: GAAACGATGCTCATGCTCAA. Inner Left Sequence: AACCGCGAACAACGAGTTAC. Inner Right Sequence: CAGGGGAACCGCTAGACATA. Inner Primer WT PCR product: 3091. Deletion size: 1317 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1017 |
nab-1(ok943). |
C. elegans |
C43E11.6. Homozygous. Outer Left Sequence: ATCGCAATTTTCTCCATTCG. Outer Right Sequence: GCGTACTTCTTTCGGAGTGG. Inner Left Sequence: TATTCCGATTCCACACAGCA. Inner Right Sequence: CGATGCGTCAATTTATGTGG. Inner Primer WT PCR Product: 3254. Deletion size: 1032 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1018 |
cgr-1(ok944) X. |
C. elegans |
T27A10.7. Homozygous. Outer Left Sequence: TCCATGCGAATTGTTGAAAA. Outer Right Sequence: ATCCGCATCTGAATGAGCTT. Inner Left Sequence: TGTCTCCACTGCTAACACGC. Inner Right Sequence: CCGCCCATCAAAAAGATAAA. Inner Primer WT PCR product: 2628. Deletion size: 1242 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1019 |
pax-2(ok946) IV. |
C. elegans |
K06B9.5. Homozygous. Outer Left Sequence: GGGCAGAACACGAATTTTTC. Outer Right Sequence: GCACATCCCTGGTTGAAACT. Inner Left Sequence: CGCAAATTTGGTCCTGAAAT. Inner Right Sequence: CTCCGCCTACTGTTAGCTCG. Inner Primer WT PCR product: 2959. Deletion size: 712 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1020 |
C26D10.4(ok947) II. |
C. elegans |
C26D10.4. Homozygous. Outer Left Sequence: GTTACTGAATTGCCGTGCCT. Outer Right Sequence: CAAAAGTGTACCGCTGGGTT. Inner Left Sequence: AAAAATCACGAGATTCCGCA. Inner Right Sequence: CATCATCATTGATCGCTTGG. Inner Primer WT PCR Product: 3275. Deletion size: 1473 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1021 |
crt-1(ok948) V. |
C. elegans |
Y38A10A.5. Homozygous. Outer Left Sequence: TATGGCACTTCGTCAGATGG. Outer Right Sequence: CATTGTCGTAGCAGACGAGC. Inner Left Sequence: TGTCGAGAGGAATCGATGTG. Inner Right Sequence: TTTGCTCTTGTTCGGTTTCA. Inner Primer WT PCR product: 2134. Deletion size: 1287 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1022 |
R11A5.2(ok949) I. |
C. elegans |
R11A5.2. Homozygous. Outer Left Sequence: AATGCTGGCGTTCTCTGTCT. Outer Right Sequence: TGCTGCCTATCGTGAGTTTG. Inner Left Sequence: TGAAATGGAGGATCCCTGAG. Inner Right Sequence: ATTTCGTGTGGGAAATTGGA. Inner Primer WT PCR product: 2183. Deletion size: 1109 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1023 |
C49C8.4(ok950) IV. |
C. elegans |
C49C8.4. Homozygous. Outer Left Sequence: CCCCTTGTGCTACGAAAAGA. Outer Right Sequence: CTCCCTTTTCTGACCTGCTG. Inner Left Sequence: AGGTTACGGTATCGGTGCTG. Inner Right Sequence: TTCACTGGCGTGTATTTTGG. Inner Primer WT PCR product: 2871. Deletion size: 1439 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1024 |
drh-2(ok951) IV. |
C. elegans |
C01B10.1. Homozygous. Outer Left Sequence: TTGTTTGAACATCTCGCTGC. Outer Right Sequence: CGGTTTTGGGAGGATGAATA. Inner Left Sequence: TTGGGGCTCACTCTCACTTT. Inner Right Sequence: CCGTAGGGGTGCAAAACTAA. Inner Primer WT PCR product: 3101. Deletion size: 789 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1025 |
set-2(ok952) III. |
C. elegans |
C26E6.9a. Homozygous. Outer Left Sequence: TATAGGTCCCCATGGAGCTG. Outer Right Sequence: GGCCTGAATCAAGAAATGGA. Inner Left Sequence: TGCACGGTGAATGATCAAAT. Inner Right Sequence: CATCGGGAAGCTCTTCTGTC. Inner Primer WT PCR product: 3324. Deletion size: 1269 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1026 |
R03E9.3(ok953) X. |
C. elegans |
R03E9.3. Homozygous. Outer Left Sequence: AAAATGGCGAAAGGGCTAGT. Outer Right Sequence: CGGAACTACGGTAAATGCGT. Inner Left Sequence: GCCGACATTTTGGAAAAGAA. Inner Right Sequence: TTTTGCCGTTCTAGGTGTCC. Inner Primer WT PCR product: 2667. Deletion size: 1196 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1027 |
R03E9.3(ok954) X. |
C. elegans |
R03E9.3. Homozygous. Outer Left Sequence: AAAATGGCGAAAGGGCTAGT. Outer Right Sequence: CGGAACTACGGTAAATGCGT. Inner Left Sequence: GCCGACATTTTGGAAAAGAA. Inner Right Sequence: TTTTGCCGTTCTAGGTGTCC. Inner Primer WT PCR product: 2667. Deletion size: 832 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1028 |
mrp-3(ok955) X. |
C. elegans |
E03G2.2. Homozygous. Outer Left Sequence: GCCTGAGATCAACGACTTCC. Outer Right Sequence: CACAAACTATTGGTGTGGCG. Inner Left Sequence: TGTCTTTTGCGAGTCGATTG. Inner Right Sequence: TGTCAAGTTGTCTGCTTGGG. Inner Primer WT PCR Product: 3071. Deletion size: 658 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1029 |
hdl-1(ok956) IV. |
C. elegans |
ZK829.2. Homozygous. Outer Left Sequence: TCTCGGCATGTTGTTAGCTG. Outer Right Sequence: TTGGCTGCTGTTCTGATACG. Inner Left Sequence: TGAAGAGGAAGCTTTTGGGA. Inner Right Sequence: CCGGAAAAGTCTTGATTGGA. Inner Primer WT PCR Product: 3232. Deletion size: 895 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1030 |
snf-9(ok957) IV. |
C. elegans |
C49C3.1 Homozygous. Outer Left Sequence: CTATTGTCAGGGACTCGGGA. Outer Right Sequence: TGACATGTTTCCACGGCTTA. Inner Left Sequence: CTGGAGATTTCCGACGAGAG. Inner Right Sequence: CGGGGGTATAGTGGGCTAAT. Inner Primer PCR Length: 3002. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1031 |
fat-4(ok958) IV. |
C. elegans |
T13F2.1. Homozygous. Outer Left Sequence: AAATACGGTCTTGACACGCC. Outer Right Sequence: CAGGCATTGCGCCTATAAAT. Inner Left Sequence: CGCACACCTTTGCTCATTTA. Inner Right Sequence: AAACAGTAAGCGCATCCACC. Inner Primer WT PCR product: 3114. Deletion size: 715 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1032 |
osr-1(ok959) I. |
C. elegans |
C32E12.3. Homozygous. Outer Left Sequence: CGAATATTCCCGAAAAACGA. Outer Right Sequence: CCACGACTTCTCCCTTTCAA. Inner Left Sequence: AATCCCAGTGCAGGCATATC. Inner Right Sequence: ATTTCCAGCACCATTATCGG. Inner Primer WT PCR product: 2824. Deletion size: 983 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1033 |
C16C10.12(ok962) III. |
C. elegans |
C16C10.12. Homozygous. Outer Left Sequence: CGGATTGTCCACTTGAGACC. Outer Right Sequence: TGAAGCAATTTTGTTCAGCG. Inner Left Sequence: GTACGAAGCCGTTCAAAAGC. Inner Right Sequence: GGAGAAGAATGGAACCGTGA. Inner Primer WT PCR product: 3027. Deletion size: 2510 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1034 |
C36B1.10(ok970) I. |
C. elegans |
C36B1.10. Homozygous. Outer Left Sequence: ACAGAGTCGTCTGCTCGGAT. Outer Right Sequence: TCCCTTGGTCTCTGAATCGT. Inner Left Sequence: CGATCTCTTTGGAAACTCGC. Inner Right Sequence: ACCGATGTCTGTTGAAAGCC. Inner Primer WT PCR Product: 3303. Deletion size: 1202 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1035 |
F22D3.2(ok975) II. |
C. elegans |
F22D3.2. Homozygous. Outer Left Sequence: CTTGCCAAATTTGATTGGCT. Outer Right Sequence: ACCAACTTGGCATTTTTCCA. Inner Left Sequence: ACGGTCTCTCGTGTTCTCGT. Inner Right Sequence: TCCGATAACTTCTCGCCAGT. Inner Primer WT PCR Product: 2887. Deletion size: 817 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1036 |
hyl-1(ok976) IV. |
C. elegans |
C09G4.1. Homozygous. Outer Left Sequence: CATAGGCGGTCTAGGAGCAG. Outer Right Sequence: ATGGCGAGCTTTTCTGTCAT. Inner Left Sequence: GCCCCGTAAATAAGCACAAA. Inner Right Sequence: TCGTGTTCTTTCACGTCTCG. Inner Primer WT PCR Product: 2824. Deletion size: 863 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1037 |
M04F3.4(ok981) I. |
C. elegans |
M04F3.4. Homozygous. Outer Left Sequence: GCGAGAAACTGAAGTCGGTC. Outer Right Sequence: ATCCAGCACATCCACAACAA. Inner Left Sequence: GTCAGGAACTGCTCGTAGCC. Inner Right Sequence: ATGGTCAAGCTTCAGCGACT. Inner Primer WT PCR Product: 2480. Deletion size: 328 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1038 |
C09G4.2(ok966) IV. |
C. elegans |
C09G4.2. Homozygous. Outer Left Sequence: TCCAGTGCCTATTTTCTGGG. Outer Right Sequence: TCATTTCGGTGCAAAATTCA. Inner Left Sequence: CATTGAGTTCAAGCCGTTCA. Inner Right Sequence: CTTCTTCCGGATAACCACCA. Inner primer WT PCR product: 2924. Deletion size: 1192 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1039 |
C17E7.5(ok985) V. |
C. elegans |
C17E7.5. Homozygous. Outer Left Sequence: TTCTTGTGCGAAAAATTCCC. Outer Right Sequence: TATGCACCAAACACGCAAAT. Inner Left Sequence: CTCAGACAACTGTGGCGAAA. Inner Right Sequence: ATTGCGCAACGTGAATTTTT. Inner Primer PCR Length: 3294 bp. Deletion Size: 1242 bp. Deletion left flank: AAAACTCCATAAAAATTACCTTTTTAAAAA. Deletion right flank: ACACAGTAGTGTTTAAGCAAGATTTTCTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1041 |
pgp-15(ok987) X. |
C. elegans |
F22E10.4. Homozygous. Outer Left Sequence: GATCTCGAACCAACGCTCTC. Outer Right Sequence: TGGAGTCGCAATGCTTGTAG. Inner Left Sequence: CCTTCTCTCCGACGTCAGTC. Inner Right Sequence: CGTTGCACCCACTTGTATTG. Inner Primer WT PCR product: 3156. Deletion size: 2256 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1042 |
parp-1(ok988) I. |
C. elegans |
Y71F9AL.18. Homozygous. Outer Left Sequence: GTCGGTGTACGGCATTCTTT. Outer Right Sequence: TCATTTTTGGGGGATTTCAG. Inner Left Sequence: TCCCAGAGAAGATCGGATTG. Inner Right Sequence: AAAGAATCGAATCGCAAAGC. Inner Primer WT PCR Product: 2473. Deletion size: 1007 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1043 |
F25B5.1(ok989) III. |
C. elegans |
F25B5.1. Homozygous. Outer Left Sequence: TTTTCAGTCGCCCAATTACC. Outer Right Sequence: ATCATTCAATCCCTTGTGCC. Inner Left Sequence: GGCAGAGGAAGAAGTTGTCG. Inner Right Sequence: TCGTGTTGTCCAGTGAGGAG. Inner Primer WT PCR product: 2735. Deletion size: 1956 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1044 |
Y47H9C.2(ok990) I. |
C. elegans |
Y47H9C.2. Homozygous. Outer Left Sequence: GAGTGAGTTGGTAGCTCCGC. Outer Right Sequence: TGGTGCATCGATCGAAATTA. Inner Left Sequence: GCCACGTGTCGATAACATTG. Inner Right Sequence: CCATGAATCTTTGACGGCTT. Inner Primer PCR Length: 2844 bp. Deletion Size: 890 bp. Deletion left flank: GGTGCGGTCCACGGCTGGTCCCTATATATT. Deletion right flank: ACTATAACAAAAAGAAAACAAATACATTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1045 |
pgp-10(ok991) X. |
C. elegans |
C54D1.1. Homozygous. Outer Left Sequence: AGCTCTTCACTTCCGCGATA. Outer Right Sequence: GTGGCGTTGTACATTCGTTG. Inner Left Sequence: TGGTAGTGGAAAAAGCACCC. Inner Right Sequence: ACCCGGAAGGTCCTACAAGT. Inner Primer WT PCR product: 3218. Deletion size: 2060 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1046 |
elo-9(ok993) II. |
C. elegans |
Y53F4B.2. Homozygous. Outer Left Sequence: GAATGAGGCGTAGATTCCGA. Outer Right Sequence: ATTTTCAGCATGCGACCTCT. Inner Left Sequence: TTGTTGGCACATCTGGAAAA. Inner Right Sequence: TCTCACGAAAAACCAGGTGA. Inner Primer WT PCR Product: 3162. Deletion size: 1227 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1047 |
pgp-7&pgp-6(ok994) X. |
C. elegans |
T21E8.2&T21E8.1. Homozygous. Outer Left Sequence: GCTGCAGATCCAGCCATATT. Outer Right Sequence: AAGTGACAACAGCAAACCCC. Inner Left Sequence: AGCACCCTGAACGATATTGG. Inner Right Sequence: ACGTTGGAGACAACACGACA. Inner Primer WT PCR product: 3265. Deletion size: 8345 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1048 |
gcy-32(ok995) V. |
C. elegans |
C06B3.8. Homozygous. Outer Left Sequence: CCTAACAACGAACACGGCTT. Outer Right Sequence: GCATTCGGCAATTGGTTATT. Inner Left Sequence: ACACGCACCAATCAACTGAA. Inner Right Sequence: GCGAAGATACGTGGACACAA. Inner Primer WT PCR Product: 3151. Deletion size: 1988 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1049 |
rom-2(ok996) III. |
C. elegans |
C48B4.2. Homozygous. Outer Left Sequence: CCCATCGAGAGAATTGGAAA. Outer Right Sequence: ATGCGTGAAGGAAAACCTGT. Inner Left Sequence: CGGAGATGAACAGAGCACAA. Inner Right Sequence: CAGATGAGCAAATGCAAAGG. Inner Primer WT PCR product: 2823. Deletion size: 530 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1050 |
F15C11.2(ok997) I. |
C. elegans |
F15C11.2a. Homozygous. Outer Left Sequence: AGCTGCTCTTGAACGGTTGT. Outer Right Sequence: TGAATAAAAGGGGAACGTCG. Inner Left Sequence: CAGGAGCCCTTGCTCAATAG. Inner Right Sequence: GCTTATTAAAGGGGCCGAAG. Inner Primer WT PCR product: 2991. Deletion size: 1147 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1052 |
trpa-1(ok999) IV. |
C. elegans |
C29E6.2. Homozygous. Outer Left Sequence: TCGGCTCTCTTTTCCTGTGT. Outer Right Sequence: GGTACACCGAAGTGCCATCT. Inner Left Sequence: GCTGGAATTGGAAGGATTGA. Inner Right Sequence: TCGTGACACTACCATTCCCA. Inner Primer WT PCR Product: 3280. Deletion size: 1334 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1053 |
R05F9.10(ok1000) II. |
C. elegans |
R05F9.10, R05F9.1b. Homozygous. Outer Left Sequence: TTGTAAGGGGAAATTCTGCG. Outer Right Sequence: TGACGAGGGACACACAAAAA. Inner Left Sequence: AGGAGATTGGCGGAAGAGAT. Inner Right Sequence: AGTCGCAGGTTTAGCTCCAA. Inner Primer WT PCR Product: 3317. Deletion size: 2275 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1054 |
ndx-4(ok1003) I. |
C. elegans |
Y37H9A.6. Homozygous. Outer Left Sequence: CATATTGCCCAGAAATGGCT. Outer Right Sequence: CCGAGAAGCTTTTGCTCTGT. Inner Left Sequence: AGTGGCAAAAATGGCAAAAA. Inner Right Sequence: GATTTGAAGCCCAAAGAGCA. Inner Primer WT PCR Product: 2133. Deletion size: 785 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1055 |
R57.1(ok1004) X. |
C. elegans |
R57.1. Homozygous. Outer Left Sequence: GACCCCAACCAATATCATGC. Outer Right Sequence: TGGATACGTGTCCCATGTTG. Inner Left Sequence: CGTTTCGGTTTCAAAGTGGT. Inner Right Sequence: TGAAGTTGATCACCGGAACA. Inner Primer WT PCR Product: 2805. Deletion size: 1523 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1056 |
cec-1(ok1005) III. |
C. elegans |
ZK1236.2. Homozygous. Outer Left Sequence: AATTGTAGAACCATGGCCGA. Outer Right Sequence: AACATGTGCAACAATTCCGA. Inner Left Sequence: CGTTCGGTTTGAGATGGATT. Inner Right Sequence: AGATGAGAGGCGCAGACATT. Inner Primer WT PCR Product: 2703. Deletion size: 2221 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1057 |
C10G8.8(ok1006) V. |
C. elegans |
C10G8.8. Homozygous. Outer Left Sequence: ACCACTTTTTCACGGACCAG. Outer Right Sequence: GCCATCACCCTCTCTTTTCA. Inner Left Sequence: CTTCTCAACTCGCTCCATCC. Inner Right Sequence: CTCATTCGGGAAAAGAACCA. Inner Primer WT PCR Product: 3004. Deletion size: 1524 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1058 |
F02E11.1(ok1007) II. |
C. elegans |
F02E11.1. Homozygous. Outer Left Sequence: ATGGTAGCGAGAAGGGAAGG. Outer Right Sequence: CGAAAAGAACGGGAAAATCA. Inner Left Sequence: CAGGAAGGAGGTGATCAGGA. Inner Right Sequence: TGACACGAATCTTCAAAGCG. Inner Primer WT PCR Product: 2485. Deletion size: 2082 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1059 |
nhr-3(ok1008) X. |
C. elegans |
H01A20.1. Homozygous. Outer Left Sequence: CCCTGTATTCCTCGCATTGT. Outer Right Sequence: GGACAAACACGAGACCGAGT. Inner Left Sequence: TTGATGGCCTGTCATCTGAA. Inner Right Sequence: CCCGTCACAATGAAACACTG. Inner Primer WT PCR Product: 3070. Deletion size: 1296 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1060 |
R07E5.15&R07E5.17(ok1009) III. |
C. elegans |
R07E5.15, R07E5.17. Homozygous. Outer Left Sequence: TCACGGTCATCGATTGGTTA. Outer Right Sequence: TGGCCCGGTATCACAATAAT. Inner Left Sequence: CTTGAAAAGCAACTCGGACC. Inner Right Sequence: CGGAAAATTCGACCAGAGAA. Inner Primer WT PCR Product: 2236. Deletion size: 992 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1061 |
tnt-3(ok1011) X. |
C. elegans |
C14F5.3 Homozygous. Outer Left Sequence: AGCGGGATCAATTCCTTTCT. Outer Right Sequence: TATGCAACGTCTTTTGGCAG. Inner Left Sequence: CGGATGCGTTTGGTATTTCT. Inner Right Sequence: TCATTCGGGAGGAACGATAC. Inner Primer PCR Length: 3234. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1062 |
cpz-2(ok1012) V. |
C. elegans |
M04G12.3 Homozygous. Outer Left Sequence: GAGCTACCGCTCCACTTTTG. Outer Right Sequence: CGAGCAACTTGAAACGATGA. Inner Left Sequence: AAGTTTTCAGCTTCTGGGCA. Inner Right Sequence: TGAGCCATGCGAGTATGAAG. Inner Primer PCR Length: 3062. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1063 |
fut-3(ok1013) II. |
C. elegans |
F59E12.13 Homozygous. Outer Left Sequence: GAAAGTTCCAATGGGCTCAA. Outer Right Sequence: TCAACATTTTGAGCAGACGC. Inner Left Sequence: TCGTTGTCAAACCATTTCCA. Inner Right Sequence: TTGAAACCGCCAAGTGATTT. Inner Primer PCR Length: 3345. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1064 |
T28B8.5(ok1014) I. |
C. elegans |
T28B8.5 Homozygous. Outer Left Sequence: TGTGCTAGCTTTCCAAACCC. Outer Right Sequence: GATGGGTGTATTTTGGACCG. Inner Left Sequence: CCTGGAAGGCATTTTTGTGT. Inner Right Sequence: TTCACGGATTTTTCGTGTTG. Inner Primer PCR Length: 3066. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1066 |
Y52B11A.4(ok1023) I. |
C. elegans |
Y52B11A.4 Homozygous. Outer Left Sequence: ATAGGCGGAGCTTAAACGGT. Outer Right Sequence: CTGATTTTTCCAGAGTCCGC. Inner Left Sequence: CGTCGCCAATTTTTGAATTT. Inner Right Sequence: TGGTGACTCATTCCGTCGTA. Inner Primer PCR Length: 2468. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1067 |
his-24(ok1024) X. |
C. elegans |
M163.3 Homozygous. Outer Left Sequence: GAGGACTCGCACAGTCATCA. Outer Right Sequence: TTCATTTGAGCAATTGAGCG. Inner Left Sequence: TTTCAAGTGTCACCCAACCA. Inner Right Sequence: CCATCCGTGCAAAGTTTCTT. Inner Primer PCR Length: 2807. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1068 |
T28F3.1(ok1025) IV. |
C. elegans |
T28F3.1 Homozygous. Outer Left Sequence: ACAAGGAATTGGCGGAATTT. Outer Right Sequence: TTGAACGCTAAACAACACGC. Inner Left Sequence: TAGGCGGTGCAGAAGCTATT. Inner Right Sequence: GGAGCATCGTTGTTTCGTTT. Inner Primer PCR Length: 3197. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1069 |
gly-12(ok1026) X. |
C. elegans |
F48E3.1 Homozygous. Outer Left Sequence: TTTCATCTCTGGTTCTCGGG. Outer Right Sequence: GGTCGGAGTTTGCACATTTT. Inner Left Sequence: CTAGCCGCATTCTTCTTTGG. Inner Right Sequence: TCCAATCGTTTCTTCCATCC. Inner Primer PCR Length: 2828. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1070 |
mrp-6(ok1027) X. |
C. elegans |
F20B6.3 Homozygous. Outer Left Sequence: GTTGCGAACCTAGGCATTGT. Outer Right Sequence: TCGGAAATGGATCTCTGGAC. Inner Left Sequence: TCTGGATGCAAGCATCTGTC. Inner Right Sequence: CGCCACCATCTCCAGTAAAT. Inner Primer PCR Length: 3296. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1071 |
F14F3.3(ok1028) X. |
C. elegans |
F14F3.3 Homozygous. Outer Left Sequence: GGAGCGAGAAAATGGTTTTG. Outer Right Sequence: GCAGTCATCGCATTCCTTTT. Inner Left Sequence: GATGCAAAGGGCGAAAATAA. Inner Right Sequence: TAGTAATGCGTCCGCAAACA. Inner Primer PCR Length: 2829. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1072 |
sod-2(ok1030) I. |
C. elegans |
F10D11.1 Homozygous. Outer Left Sequence: ACTGCTCGACAGACTCCGAT. Outer Right Sequence: GACGCATTCACCAACAAATG. Inner Left Sequence: TCGAGGCTGGAACTTCAACT. Inner Right Sequence: CCCCTAATAACTGCACCGAA. Inner Primer PCR Length: 2320. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1073 |
dgk-4(ok1031) IV. |
C. elegans |
F42A9.1a Homozygous. Outer Left Sequence: CACCAACTCCTGGAGCAACT. Outer Right Sequence: AATCTCATGACTGGGGCAAG. Inner Left Sequence: TGAGCCATCGACTGCTTATG. Inner Right Sequence: CGGCGTTGGTAGTTTTCAGT. Inner Primer PCR Length: 3388. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1074 |
smf-3(ok1035) IV. |
C. elegans |
Y69A2AR.4 Homozygous. Outer Left Sequence: TTCAGCTTGTCAAGGGCTTT. Outer Right Sequence: CTTCCATTGGGGAAGTTTGA. Inner Left Sequence: CCCAAAGTGATCGGAACCTA. Inner Right Sequence: GGGATTATTTGGACCCGACT. Inner Primer PCR Length: 2195. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1075 |
pes-9(ok1037) V. |
C. elegans |
R11H6.1 Homozygous. Outer Left Sequence: CTTCGATGAGACAGCCACAA. Outer Right Sequence: TTACTGGAAGTTTCCCCGTG. Inner Left Sequence: CAACGGCAACAAGATTAGGG. Inner Right Sequence: GTGAAGCAGTGGCAATTCAA. Inner Primer PCR Length: 2301. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1077 |
rgs-10(ok1039) X. |
C. elegans |
F45B8.2 Homozygous. Outer Left Sequence: AAACCACAGGGTCTGACAGG. Outer Right Sequence: CTTGCGCGACATCAAAAGTA. Inner Left Sequence: GGCATGTTCACTCGGAATTT. Inner Right Sequence: CGTTTGTGCAGAGTGAAGGA. Inner Primer PCR Length: 2185. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1078 |
T10G3.5(ok1040) V. |
C. elegans |
T10G3.5 Homozygous. Outer Left Sequence: GCTTCCAATTCTCTTGCTCG. Outer Right Sequence: ATTTAAGCGGAACAGCCTCA. Inner Left Sequence: TGAACTGCGTCTTCAATTCG. Inner Right Sequence: GAAATCAGAGGGAATCCGGT. Inner Primer PCR Length: 2757. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1079 |
alg-4(ok1041) III. |
C. elegans |
ZK757.3 Homozygous. Outer Left Sequence: GGATTTGGTCCGAAGTAGCA. Outer Right Sequence: GCCGATGATCAAGGATCTGT. Inner Left Sequence: GAGTTGGAATGGAGACCGAA. Inner Right Sequence: CAATATGCGTGAGGTGGTTG. Inner Primer PCR Length: 2888. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1080 |
haf-4(ok1042) I. |
C. elegans |
W04C9.1. Homozygous. Outer Left Sequence: AGTCCTTGGGTCTCACAACG. Outer Right Sequence: ACGATTTGTTCCTGCCAATC. Inner Left Sequence: CCGTGAAAAAGTACGCGTTT. Inner Right Sequence: GCACTCTAAACACTTCCGGC. Inner Primer PCR Length: 2570 bp. Deletion Size: 1678 bp. Deletion left flank: ACACGGGACAAGTCATCGCTACCGTGGTCG. Deletion right flank: GCGTCAATTTCGGTTCGACAAATCGTTTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1081 |
klf-2(ok1043) V. |
C. elegans |
F53F8.1 Homozygous. Outer Left Sequence: GTTACTGTTTGCCCATGCCT. Outer Right Sequence: CGTCTTGTTCATCCGTTTCA. Inner Left Sequence: GAAATGCCCAAAAGTGTCGT. Inner Right Sequence: CTCGAAAATTTCCTGGAGCA. Inner Primer PCR Length: 3195. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1082 |
K12G11.2(ok1048) V. |
C. elegans |
K12G11.2 Homozygous. Outer Left Sequence: TGTCAGGTGGAATACGACGA. Outer Right Sequence: ACATATTCCGAAAAGTGCCG. Inner Left Sequence: TGTTCCATTCACTTCCGTCA. Inner Right Sequence: TGCACGTACACATTCTGCAA. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1083 |
F27C8.5(ok1050) IV. |
C. elegans |
F27C8.5 Homozygous. Outer Left Sequence: AGATTGCGTCTGTGTGATCG. Outer Right Sequence: CTAGAGAAAGGTGCATCGGC. Inner Left Sequence: CGCGGCTTCACAAATAAAAT. Inner Right Sequence: AGAACCTCTTTTCCGGTGGT. Inner Primer PCR Length: 3168. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1084 |
oct-1(ok1051) I. |
C. elegans |
F52F12.1 Homozygous. Outer Left Sequence: TATCGGAGTGTCGATGCAAG. Outer Right Sequence: CAGCCTACCTTCGTGCCTAC. Inner Left Sequence: GATTCTCGTTTCTTGGCTGC. Inner Right Sequence: GCAAGAGGCAGGCATAGTTC. Inner Primer PCR Length: 3239. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1085 |
tir-1(ok1052) III. |
C. elegans |
F13B10.1a Homozygous. Outer Left Sequence: GCAATCAAAGTTTCCAGCGT. Outer Right Sequence: CCTTGTCCTACTCAGCCAGC. Inner Left Sequence: AGATAAAGTCGGCAACCTGC. Inner Right Sequence: CAAATGGCGATCTGTACCCT. Inner Primer PCR Length: 3224. Estimated Deletion Size: about 1900 bp. From Nathalie Pujol 11/04: breakpoints, with a 8 bases insertion, AAATGTCGCCGGATCGTGAACTTGCAAGAAT/AGAATAAA/TGTAGACAGTGCTGGCGT AATTCGCCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1086 |
inx-5(ok1053) X. |
C. elegans |
R09F10.4 Homozygous. Outer Left Sequence: TTGCAAGCATTATTTGCGAG. Outer Right Sequence: ATTCCATTTTCCCATCCTCC. Inner Left Sequence: GGCAGCTTGACACAATTGAA. Inner Right Sequence: TTATTGCCGGTGGTTCTGAT. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1087 |
kal-1(ok1056) I. |
C. elegans |
K03D10.1 Homozygous. Outer Left Sequence: TTTTCCGGAAGATTCCAGTG. Outer Right Sequence: AAAAATGCGGGAATGTTTTG. Inner Left Sequence: GCTGAAAAATCGTGGGAAAA. Inner Right Sequence: CCCATTTTCTTTTGCAGGAA. Inner Primer PCR Length: 2786. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1088 |
magu-2(ok1059) V. |
C. elegans |
C01B7.4 Homozygous. Outer Left Sequence: AAAGACCGGGGAGAGATGAT. Outer Right Sequence: GCATATTCTTTTTGGCGCTC. Inner Left Sequence: TAGCACGCTGTCCATGTAGC. Inner Right Sequence: TTGACTCATACGCCCAATCA. Inner Primer PCR Length: 3137. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1089 |
hpl-1(ok1060) X. |
C. elegans |
K08H2.6 Homozygous. Outer Left Sequence: CCGACATAGGTTTGCACCTT. Outer Right Sequence: CGAAGTGGAATTGGTGGTCT. Inner Left Sequence: CAAGATGCTCCGTTGTTTCA. Inner Right Sequence: GGAGTCGGGAATCAGTCAGA. Inner Primer PCR Length: 2728. Upper breakpoint flanking sequence: TTCGGATTTGAAAGAGTCTGAAAAAGAT. Lower breakpoint flanking sequence: TTGAACTGTAGTCTTTGCTACTTCTT. Deletion Size: 1948 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1090 |
hpl-2(ok1061) III. |
C. elegans |
K01G5.2 Homozygous. Outer Left Sequence: TTTTTACGGGCGAAATTCAG. Outer Right Sequence: AATTCAGTGATGACACGGCA. Inner Left Sequence: AATTTGTCGATGCACCATGA. Inner Right Sequence: CAGTCGGTGAGTTTGGGAAT. Inner Primer PCR Length: 2358. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1091 |
Y64G10A.7(ok1062) IV. |
C. elegans |
Y64G10A.7 Homozygous. Outer Left Sequence: AAAGACCGGACCACTTTGTG. Outer Right Sequence: AACTCACGTTGGACCGAATC. Inner Left Sequence: GTGCGCACACTTGTTCTTGT. Inner Right Sequence: CGATTGACATGCAATTTTCG. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 2700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1092 |
E02H1.2(ok1070) II. |
C. elegans |
E02H1.2 Homozygous. Outer Left Sequence: TTTTCCAAGGTGGACCAAAG. Outer Right Sequence: CTTTTCTCGACGGCTTCAAC. Inner Left Sequence: TTGCTAGGGAGCATCCAAGT. Inner Right Sequence: CCCAATACAACCAGCAACAA. Inner Primer PCR Length: 2359. Estimated Deletion Size: about 350 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1093 |
C08H9.2(ok1071) II. |
C. elegans |
C08H9.2 Homozygous. Outer Left Sequence: CATCTTTTCCTGCAACGACA. Outer Right Sequence: AACATCACTTTCCGTTTGGC. Inner Left Sequence: GGATCTTCTGCTCCTTGACG. Inner Right Sequence: GGACGTCTCATTGGAAAGGA. Inner Primer PCR Length: 3020. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1094 |
tag-52(ok1072) X. |
C. elegans |
C02F12.4 Homozygous. Outer Left Sequence: GCAAATACCACCACCACACA. Outer Right Sequence: TATAAACGACGGGAAAACGC. Inner Left Sequence: AAGCTCACCGCAAACTCAAT. Inner Right Sequence: ACATACAGCACGGCATTTGA. Inner Primer PCR Length: 2998. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1095 |
chup-1(ok1073) X. |
C. elegans |
ZK721.1 Homozygous. Outer Left Sequence: AATTTCAGGCGCTATGAGGA. Outer Right Sequence: CTTGAAATAAAAGCGCGAGG. Inner Left Sequence: TGGGATGTGGTGTACGAAAA. Inner Right Sequence: CAGGAAATGACAGCAGCAAA. Inner Primer PCR Length: 2993. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1096 |
R06C7.1(ok1074) I. |
C. elegans |
R06C7.1 Homozygous. Outer Left Sequence: GCTCCACCAGGAGCTATGAC. Outer Right Sequence: AAATCGAACAAAATTCCCCC. Inner Left Sequence: TGTACATGAAGCCAACCGAA. Inner Right Sequence: CGGTTTGTTTGTAGCCGATT. Inner Primer PCR Length: 2933. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1097 |
grl-4(ok1076) IV. |
C. elegans |
F42C5.7 Homozygous. Outer Left Sequence: AAGCCACGTAACAAAATCCG. Outer Right Sequence: AGTGATCAGAGATGGGCTGG. Inner Left Sequence: TACTGTCCAGGGGAGATTCG. Inner Right Sequence: GGCAATGTCGAGAAGGAAAC. Inner Primer PCR Length: 2926. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1098 |
hsp-12.6(ok1077) IV. |
C. elegans |
F38E11.2 Homozygous. Outer Left Sequence: GTGACGATTCGAGAGCAACA. Outer Right Sequence: CGTGCGAAGATTGAACAGAA. Inner Left Sequence: TTCGAAGCTCAATGAACGAA. Inner Right Sequence: AGCCCAAGATGACAATGGAC. Inner Primer PCR Length: 2303. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1099 |
F55A12.1(ok1078) I. |
C. elegans |
F55A12.1 Homozygous. Outer Left Sequence: GAAAGCCAATAACTCGAGCG. Outer Right Sequence: ACGAACATCAGGAAGAACCG. Inner Left Sequence: GGCAGACTTGCATCCATTTT. Inner Right Sequence: AATTGTTGTTGCCTCGATCC. Inner Primer PCR Length: 2978. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1100 |
ver-4(ok1079) X. |
C. elegans |
F59F3.5 Homozygous. Outer Left Sequence: CCAAAAATGCACATGTACCG. Outer Right Sequence: TGATGAAGAAGCTCCAGCAA. Inner Left Sequence: TCTCCGAGGGGCAATACTAA. Inner Right Sequence: TTCGTTGCAGAACACCAAAA. Inner Primer PCR Length: 2587. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1101 |
scpl-1(ok1080) I. |
C. elegans |
B0379.4 Homozygous. Outer Left Sequence: GAAGAACCGGGAGTCAACTG. Outer Right Sequence: AATTTTGAGGGCAGCTACGA. Inner Left Sequence: TTGAAAATTGGAACGAAGGC. Inner Right Sequence: AAGTATGCGGGAACCACAAC. Inner Primer PCR Length: 2908. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1102 |
ZK370.3(ok1081) III. |
C. elegans |
ZK370.3. Homozygous. Outer Left Sequence: GTGCACAAATTGCTTCGAGA. Outer Right Sequence: CCAACACTCTAGCAGCCACA. Inner Left Sequence: TGGTCCATGCATTGAGTCAT. Inner Right Sequence: TAGAATTCTGCAGGCGATCC. Inner Primer PCR Length: 3308 bp. Deletion Size: 1444 bp. Deletion left flank: GCAGAGCCACAACAAGCGAGTCCATCGAGT. Deletion right flank: AAGAAATTTTGGATAAATGTATTTTTTTTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1103 |
ceh-18(ok1082) X. |
C. elegans |
ZC64.3 Homozygous. Outer Left Sequence: TCGGTCATTTTGGCATGATA. Outer Right Sequence: GCTGACCCCTATTCCCTCAT. Inner Left Sequence: CGATGTTGCGTTCATAGTGG. Inner Right Sequence: CGCCCAAAATTTTTCATCAT. Inner Primer PCR Length: 3110. Estimated Deletion Size: about 2100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1104 |
hsp-3(ok1083) X. |
C. elegans |
C15H9.6 Homozygous. Outer Left Sequence: GGGGTAGGAGAGCCATTTTC. Outer Right Sequence: ACTTGGCCTTTTCCGATTTT. Inner Left Sequence: CGATCGTTTAGAGCTCGTCC. Inner Right Sequence: CCTGCCGTTTCCATAACAGT. Inner Primer PCR Length: 2947. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1105 |
brp-1(ok1084) III. |
C. elegans |
Y79H2A.1 Homozygous. Outer Left Sequence: TTGTGCGCATTGATCTCTTC. Outer Right Sequence: GTATCAGAAACCTCAGCGGC. Inner Left Sequence: CAGCTGATTTCGCATGGTTA. Inner Right Sequence: GAATGCAGTGTTGATGGGTG. Inner Primer PCR Length: 3016. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1106 |
ape-1(ok1085) V. |
C. elegans |
F46F3.4 Homozygous. Outer Left Sequence: CAAACAATTGAAATGTGCGG. Outer Right Sequence: GGATTTCGAAAAATGGGGAT. Inner Left Sequence: CAAAAGCTCCAATTCGCTTC. Inner Right Sequence: AGCGTCTTCGTCTGATTGGT. Inner Primer PCR Length: 2748. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1107 |
haf-3(ok1086) V. |
C. elegans |
F57A10.3. Homozygous. Outer Left Sequence: TTTCGGAAATTTTATTGCGG. Outer Right Sequence: CCGTGCATTGATCACTTGTT. Inner Left Sequence: TTTGCATTCCTTCCAAATCC. Inner Right Sequence: TTGAAAACCCTCCTCGTGTC. Inner Primer PCR Length: 2930 bp. Deletion Size: 1150 bp. Deletion left flank: GTGTTTCAGGGAAAAAAATCTACAAAATTT. Deletion right flank: TATTTTTGAAGAAATTTTCTTAATTTTTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1108 |
pmp-3(ok1087) V. |
C. elegans |
C54G10.3 Homozygous. Outer Left Sequence: AAACGATCGAAAAGCAGGAA. Outer Right Sequence: CACCAAAATGCCAGTGTGAC. Inner Left Sequence: ATTTTTGAAATCGTGCCGAG. Inner Right Sequence: GTCGTTCTGAACTAAGGCGG. Inner Primer PCR Length: 3268. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1109 |
cit-1.1(ok1088) III. |
C. elegans |
F44B9.4 Homozygous. Outer Left Sequence: TTTGGAGCTTTGGAGCAGTT. Outer Right Sequence: CTTCACCAAAGAGGAGGTGC. Inner Left Sequence: ATTCTCCACCAGCTCATTCG. Inner Right Sequence: AGCGAGCATTCAAGAAGGAA. Inner Primer PCR Length: 3011. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1110 |
C17E4.9(ok1089) I. |
C. elegans |
C17E4.9 Homozygous. Outer Left Sequence: AAAATTTGCCCTCCTTCCAT. Outer Right Sequence: CTCATCCACACCGAAAACCT. Inner Left Sequence: CAAACTTCCCCCTCTTCCTC. Inner Right Sequence: ATGAGAAGAGACCTGCCTCG. Inner Primer PCR Length: 2190. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1111 |
srp-7(ok1090) V. |
C. elegans |
F20D6.4 Homozygous. Outer Left Sequence: ATTCGTTCTTTTGACACCGC. Outer Right Sequence: TTTCATCTTTTTCCGGCATC. Inner Left Sequence: CAACATAACCTTTCGTCGCA. Inner Right Sequence: CCGCAACAGCTACAGTACCA. Inner Primer PCR Length: 2226. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1112 |
C45B2.6(ok1098) X. |
C. elegans |
C45B2.6 Homozygous. Outer Left Sequence: ACACAGTCCGACAAAACGTG. Outer Right Sequence: GTTTTCCCCGAAAAGGTTGT. Inner Left Sequence: TACGCGGATGCTCAACATAA. Inner Right Sequence: GAAAGGCACCGGTGATTAAA. Inner Primer PCR Length: 3227. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1113 |
H25P06.4(ok1099) I. |
C. elegans |
H25P06.4 Homozygous. Outer Left Sequence: gcgatccaatattagccgaa. Outer Right Sequence: aggttatgctttgtggtcgg. Inner Left Sequence: aatctctcagggctcaacga. Inner Right Sequence: gattatgagcgtggccattt. Inner Primer PCR Length: 2971. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1114 |
F35C5.12(ok1103) II. |
C. elegans |
F35C5.12 Homozygous. Outer Left Sequence: aagctccacgtgcattctct. Outer Right Sequence: gacagccacgtgctttgata. Inner Left Sequence: aaagtcgatggacaagtcgg. Inner Right Sequence: tgaaagcctaccagagcgtt. Inner Primer PCR Length: 2307. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1115 |
mec-10(ok1104) X. |
C. elegans |
F16F9.5 Homozygous. Outer Left Sequence: tcatttgcagcattttctcg. Outer Right Sequence: atttatcaatcaggcggtcg. Inner Left Sequence: gtccaaggtgtcctccaaaa. Inner Right Sequence: tgaagtttgacacaggcgag. Inner Primer PCR Length: 3339. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1116 |
egl-4(ok1105) IV. |
C. elegans |
F55A8.2b Homozygous. Outer Left Sequence: AAAGTTGGTTGTGGACGGAG. Outer Right Sequence: ACTGCACAAAAATTCGAGGC. Inner Left Sequence: AGAACCGCATCAGTTCAAGC. Inner Right Sequence: TTTTGGACGAATTTTGGAGG. Inner Primer PCR Length: 2432. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1117 |
Y47G6A.14(ok1106) I. |
C. elegans |
Y47G6A.14 Homozygous. Outer Left Sequence: aggtgtcaagaagagccgaa. Outer Right Sequence: cctccttgagacttgaagcg. Inner Left Sequence: cttgagcgaggtgtaggctt. Inner Right Sequence: gccaggaagaatttggtgaa. Inner Primer PCR Length: 3237. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1118 |
ZK370.4(ok1107) III. |
C. elegans |
ZK370.4 Homozygous. Outer Left Sequence: ATCAGATCTTCGATCCGGTG. Outer Right Sequence: GTTTGATCCGTCGTGGAAGT. Inner Left Sequence: ATCACTTCAGCTCGGCTCAT. Inner Right Sequence: CGAGTGGAAGCTTGATCCTC. Inner Primer PCR Length: 3173. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1119 |
ubr-5(ok1108) I. |
C. elegans |
F36A2.13 Homozygous. Outer Left Sequence: ctgcctgataccacccactt. Outer Right Sequence: tcttgcaatggttccacatc. Inner Left Sequence: tggaagctcacaagctcaga. Inner Right Sequence: ggaagctcttggagcagatg. Inner Primer PCR Length: 3184. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1120 |
amt-3(ok1113) II. |
C. elegans |
M195.3 Homozygous. Outer Left Sequence: tctggcggctcttcttttta. Outer Right Sequence: tgcactcgggtaacattcag. Inner Left Sequence: cagccaaaccatgttcaatg. Inner Right Sequence: attatggcacaagggagacg. Inner Primer PCR Length: 3116. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1121 |
vkmt-1(ok1114) IV. |
C. elegans |
C42C1.13; might also remove part of C42C1.11. Homozygous. Outer Left Sequence: aaacacgaaacactcgcctt. Outer Right Sequence: ccgatcctttttcgtatgga. Inner Left Sequence: ccttaaaagagtctcggccc. Inner Right Sequence: atgaaaaagcgtcatctggg. Inner Primer PCR Length: 2226. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1122 |
T12B5.3(ok1129) III. |
C. elegans |
T12B5.3 Homozygous. Outer Left Sequence: acattccacactttcctggc. Outer Right Sequence: gttgcgatgaagagcacaaa. Inner Left Sequence: ctccactcgcatttttccat. Inner Right Sequence: ggatgcagattgctccaaat. Inner Primer PCR Length: 2203. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1123 |
Y105E8A.10(ok1130) I. |
C. elegans |
Y105E8A.10 Homozygous. Outer Left Sequence: gcgtgacgacggtcttttat. Outer Right Sequence: tttcgagttcaaaattcggg. Inner Left Sequence: tagtcgttgttgttggcagc. Inner Right Sequence: acaacacatttaacgcgcaa. Inner Primer PCR Length: 2600. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1124 |
exp-1(ok1131) II. |
C. elegans |
H35N03.1 Homozygous. Outer Left Sequence: AGATCCAATGAAATCGGTGC. Outer Right Sequence: ACATCGTTTTTATGGCCACC. Inner Left Sequence: TTGCCTTGCAAGACTCAAAA. Inner Right Sequence: CACAGCATCGACCAGAAATG. Inner Primer PCR Length: 2329. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1125 |
vang-1(ok1142) X. |
C. elegans |
B0410.2a Homozygous. Outer Left Sequence: gtcataaacgccgagtcgat. Outer Right Sequence: caaatcaaactgccgactca. Inner Left Sequence: ctggaatgacgacggattct. Inner Right Sequence: ttttcatttccaggtttggc. Inner Primer PCR Length: 3370. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1126 |
H06H21.9(ok1143) IV. |
C. elegans |
H06H21.9 Homozygous. Outer Left Sequence: cccatcattggctttttagc. Outer Right Sequence: ttgtaggcaccggttttagg. Inner Left Sequence: tgtctcgcttttagcgcttt. Inner Right Sequence: cacgcgattttgcagtttta. Inner Primer PCR Length: 2109. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1127 |
Y54G2A.2(ok1144) IV. |
C. elegans |
Y54G2A.2. Homozygous. Outer Left Sequence: TTGTGGTGGAGATACCCCAT. Outer Right Sequence: CGCGGGAATTCAAACATAAT. Inner Left Sequence: GCGAGTTTAGAAATGCTCGG. Inner Right Sequence: CTTTTCATATTCAGGCCCCA. Inner Primer PCR Length: 2962 bp. Deletion Size: 483 bp. Deletion left flank: TTTCGTCCCGTAAATCTACACAGTAATCCC. Deletion right flank: CAAAAAATTATAATTTGTCTTCTTCTTTCA. Insertion Sequence: GGAAAAGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1128 |
fcd-2(ok1145) IV. |
C. elegans |
Y41E3.9 Homozygous. Outer Left Sequence: ttataaatccctgcgccaag. Outer Right Sequence: cgaatttagccagaaatcgc. Inner Left Sequence: gggtcaaagttccccatttt. Inner Right Sequence: caaaacacagaagcgagcaa. Inner Primer PCR Length: 3228. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1129 |
amt-3(ok1146) II. |
C. elegans |
M195.3 Homozygous. Outer Left Sequence: tctggcggctcttcttttta. Outer Right Sequence: tgcactcgggtaacattcag. Inner Left Sequence: cagccaaaccatgttcaatg. Inner Right Sequence: attatggcacaagggagacg. Inner Primer PCR Length: 3116. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1130 |
pqn-2(ok1149) V. |
C. elegans |
AC3.4 Homozygous. Outer Left Sequence: cttgccaacgaaccacctat. Outer Right Sequence: tcacgcgtttttgatgtgat. Inner Left Sequence: cagaacactgctccagtcca. Inner Right Sequence: aatttaggggtggccgtatc. Inner Primer PCR Length: 2917. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1131 |
lev-10(ok1154) I. |
C. elegans |
Y105E8A.7 Homozygous. Outer Left Sequence: ctccacgagattcgtcaaca. Outer Right Sequence: cgtttcgacttcttcttccg. Inner Left Sequence: gagcaatcgagagacgttcc. Inner Right Sequence: tgttataccgcagaacaccg. Inner Primer PCR Length: 3231. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1132 |
acr-14(ok1155) II. |
C. elegans |
T05C12.2 Homozygous. Outer Left Sequence: gtcttcgtccagccaacact. Outer Right Sequence: ggctcctgttcaatctctgc. Inner Left Sequence: attccgatcgaagctgaaaa. Inner Right Sequence: ccatttcaatcgtccatgtg. Inner Primer PCR Length: 2213. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1133 |
C48E7.6(ok1156) I. |
C. elegans |
C48E7.6 Homozygous. Outer Left Sequence: aggacaccatggggaatttt. Outer Right Sequence: tgatggatcggaaagtcaca. Inner Left Sequence: ccgagttgaaggaaagatgc. Inner Right Sequence: cgaggtgcatcatcagaaaa. Inner Primer PCR Length: 3266. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1134 |
Y105E8A.10(ok1157) I. |
C. elegans |
Y105E8A.11 Homozygous. Outer Left Sequence: gcgtgacgacggtcttttat. Outer Right Sequence: tttcgagttcaaaattcggg. Inner Left Sequence: tagtcgttgttgttggcagc. Inner Right Sequence: acaacacatttaacgcgcaa. Inner Primer PCR Length: 2600. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1135 |
K02F3.5(ok1158) III. |
C. elegans |
K02F3.5 Homozygous. Outer Left Sequence: ccgttgcgtaacagaaacaa. Outer Right Sequence: gccgtgtaggcaggtatcat. Inner Left Sequence: ggtttaactgggctgcagag. Inner Right Sequence: tcggttggtattgcagtgaa. Inner Primer PCR Length: 3050. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1136 |
R05G6.10(ok1159) IV. |
C. elegans |
R05G6.10 Homozygous. Outer Left Sequence: tcttcgtcttgccatctgaa. Outer Right Sequence: agcagcatgttgttgtgctc. Inner Left Sequence: gggaacaatgatgagatggg. Inner Right Sequence: ccccttcttcttgacacgag. Inner Primer PCR Length: 3193. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1137 |
rig-4(ok1160) IV. |
C. elegans |
Y42H9B.2. Homozygous. Outer Left Sequence: AATTCAACTGGCTGACTGGG. Outer Right Sequence: CTGAGCCATCTCGATCGTTT. Inner Left Sequence: CTCACTTCTCCCTTCCGTTG. Inner Right Sequence: CAAGTCAACGACTTTTCGCA. Inner Primer PCR Length: 2978 bp. Deletion Size: 1347 bp. Deletion left flank: GGATACGGTATCCAATAGCATCACTGTTCC. Deletion right flank: TCGAAGTTTGTAACCGATCACATCTCCATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1138 |
F08G2.7(ok1161) II. |
C. elegans |
F08G2.7 Homozygous. Outer Left Sequence: gaaatccgagagctcagcag. Outer Right Sequence: agtcaaccacccctcttcct. Inner Left Sequence: actcgatttcctcatcacgg. Inner Right Sequence: tgaaataattccaggaccgc. Inner Primer PCR Length: 3269. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1139 |
clh-4(ok1162) X. |
C. elegans |
T06F4.2 Homozygous. Outer Left Sequence: TGTCTCGAGAGTAGTGCCCC. Outer Right Sequence: AAACGGAAGGTGAGCTGATG. Inner Left Sequence: AGGGTGAATGGGAGACACTG. Inner Right Sequence: AGAAACCACATTCCTGGTGC. Inner Primer PCR Length: 3372. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1141 |
R13H7.2(ok1167) IV. |
C. elegans |
R13H7.2 Homozygous. Outer Left Sequence: tgtgcgctagagacaccact. Outer Right Sequence: ttggctcctcctttttctca. Inner Left Sequence: acacaaaccgtcatgctctg. Inner Right Sequence: tgatcgtcgtcattgctctc. Inner Primer PCR Length: 3343. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1143 |
F36D4.2(ok1128) V/nT1 [qIs51] (IV;V). |
C. elegans |
F36D4.2 Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1128 homozygotes. nT1[qIs51] homozygotes inviable. Outer Left Sequence: agtcatgaacagatccccca. Outer Right Sequence: attgcttggacgagaggaga. Inner Left Sequence: tgcttttattcgcacccagt. Inner Right Sequence: tggatctgcaagtccatctg. Inner Primer PCR Length: 2151. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1144 |
Y73B6BL.19(ok1168) IV. |
C. elegans |
Y73B6BL.19 Homozygous. Outer Left Sequence: tcacttttcgaatggggttc. Outer Right Sequence: ccactttccatttttcccag. Inner Left Sequence: atcttagccagggttgcaga. Inner Right Sequence: tgttgcatacgacgaagagc. Inner Primer PCR Length: 2905. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1145 |
ags-3(ok1169) X. |
C. elegans |
F32A6.4a Homozygous. Outer Left Sequence: ctccggttttaaatttggca. Outer Right Sequence: acgttgggttttgagcattc. Inner Left Sequence: ttcgcgatgctcaatatcag. Inner Right Sequence: caaagacgttttgcgactca. Inner Primer PCR Length: 3203. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1146 |
dyf-5(ok1170) I. |
C. elegans |
M04C9.5. Homozygous. Outer Left Sequence: GCAGAAAAGTGGTGAGAGGC. Outer Right Sequence: GAGCGGTTTGGAACAATTTC. Inner Left Sequence: AATTATGACGCCACGGATTC. Inner Right Sequence: ACCGTACGCATACTCGAACC. Inner Primer PCR Length: 2997 bp. Deletion Size: 2058 bp. Deletion left flank: TGAAAATAGTACTGTAGGATTACTGGAACT. Deletion right flank: AGGCCAAGTATCCAAAGACACTCATCAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1147 |
F44D12.4(ok1172) IV. |
C. elegans |
F44D12.4 Homozygous. Outer Left Sequence: gaaatctagcacctacggcg. Outer Right Sequence: aatgtgtcgtgtggagacca. Inner Left Sequence: gtacggtgtctatcgcggac. Inner Right Sequence: atcaaaatgcggagaaatgg. Inner Primer PCR Length: 2165. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1148 |
dyf-5(ok1177) I. |
C. elegans |
M04C9.5. Homozygous. Outer Left Sequence: GCAGAAAAGTGGTGAGAGGC. Outer Right Sequence: GAGCGGTTTGGAACAATTTC. Inner Left Sequence: AATTATGACGCCACGGATTC. Inner Right Sequence: ACCGTACGCATACTCGAACC. Inner Primer PCR Length: 2997 bp. Deletion Size: 1719 bp. Deletion left flank: ATGGACAATTGGATGCATTTTCTGTAGTTG. Deletion right flank: GACTTGCTCATACCTTATTTGAATTGTGAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1149 |
scrm-3(ok1178) V. |
C. elegans |
C04E12.7 Homozygous. Outer Left Sequence: atttcaccttcagcaccgtc. Outer Right Sequence: acggcagaaaacaatgttcc. Inner Left Sequence: tgcttttcacaaatcaacgg. Inner Right Sequence: ctgcgctttttccttcattc. Inner Primer PCR Length: 2174. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1150 |
gpr-2(ok1179) III. |
C. elegans |
C38C10.4 Homozygous. Outer Left Sequence: ggaagagcattttcccatca. Outer Right Sequence: atatcagaaagcggcgctaa. Inner Left Sequence: gctggcagtctccatctctc. Inner Right Sequence: gatccgcgtgaaatttttgt. Inner Primer PCR Length: 2139. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1151 |
cft-1(ok1180) V. |
C. elegans |
C18C4.2 Homozygous. Outer Left Sequence: gtgggtctcgaagggaattt. Outer Right Sequence: tgagattttcccgatccaac. Inner Left Sequence: aggtgagggaaaccacactg. Inner Right Sequence: tttcaatttttccgtcgtcc. Inner Primer PCR Length: 3299. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1152 |
K01B6.1(ok1182) III. |
C. elegans |
K01B6.1 Homozygous. Outer Left Sequence: tccgtgaggcttagcagaat. Outer Right Sequence: ggaacaggaattgtgaggga. Inner Left Sequence: ccaaaacccgaaacttctca. Inner Right Sequence: tcaaatcgagttcttcgcct. Inner Primer PCR Length: 3303. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1153 |
Y43B11AR.3(ok1183) IV. |
C. elegans |
Y43B11AR.3 Homozygous. Outer Left Sequence: ctgtgactggtgcagttgct. Outer Right Sequence: actggaggacgtaacgttgg. Inner Left Sequence: cgatgtgagttctgctggaa. Inner Right Sequence: aaagtccggctaaggttggt. Inner Primer PCR Length: 2110. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1154 |
C16C8.16(ok1184) II. |
C. elegans |
C16C8.14 Homozygous. Outer Left Sequence: taatatgagcaatgcgcgtc. Outer Right Sequence: ctacggtaggtggcggagta. Inner Left Sequence: gcgtacttcctcgtctaccg. Inner Right Sequence: gcggaatcaggtcaagtgtt. Inner Primer PCR Length: 3202. Estimated Deletion Size: about 2900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1155 |
scl-1(ok1185) IV. |
C. elegans |
F49E11.9 Homozygous. Outer Left Sequence: atatcccaaccatcggaaca. Outer Right Sequence: gacacccgtttgcgtagttt. Inner Left Sequence: tttttctcggcgtacttcgt. Inner Right Sequence: gccacgtaggtaccttttgc. Inner Primer PCR Length: 2195. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1156 |
C46A5.2(ok1187) IV. |
C. elegans |
C46A5.2 Homozygous. Outer Left Sequence: tgtctccgtctccttttgct. Outer Right Sequence: tggcggttctgatatcttcc. Inner Left Sequence: ggcagaagtacgacgagagg. Inner Right Sequence: tggtaaaggccgatacgaac. Inner Primer PCR Length: 2189. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1157 |
pept-2(ok1192) IV. |
C. elegans |
C06G8.2 Homozygous. Outer Left Sequence: acaccttcacgatgaccctc. Outer Right Sequence: acatttgtacggcctggaag. Inner Left Sequence: acatggggaggcataatcaa. Inner Right Sequence: gtcatggacgtcaagagggt. Inner Primer PCR Length: 2873. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1158 |
C25E10.9a(ok1193) V. |
C. elegans |
C25E10.9a Homozygous. Outer Left Sequence: tcacggcattgtttgtgttt. Outer Right Sequence: caggcaaatgcactcttgaa. Inner Left Sequence: aaaaccactggaacactggc. Inner Right Sequence: tgtggagctgacttgtgagg. Inner Primer PCR Length: 2139. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1159 |
F21C3.2(ok1194) I. |
C. elegans |
F21C3.2 Homozygous. Outer Left Sequence: tctcaccctacactgtcccc. Outer Right Sequence: ggaactgaagctgcatccat. Inner Left Sequence: cacatcggtgaatcacaagg. Inner Right Sequence: gctccaactcctgctattcg. Inner Primer PCR Length: 3007. Estimated Deletion Size: about 2250 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1160 |
ckb-4(ok1195) V. |
C. elegans |
F22F7.5 Homozygous. Outer Left Sequence: gaaggaattcagggaaaggg. Outer Right Sequence: tactttttgggggtttgtcg. Inner Left Sequence: tcactggcgataacatccaa. Inner Right Sequence: tctgcgggaaaaatgatctc. Inner Primer PCR Length: 2746. Estimated Deletion Size: about 1350 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1161 |
tbh-1(ok1196) X. |
C. elegans |
H13N06.6 Homozygous. Outer Left Sequence: aagcaggatcaggagcacat. Outer Right Sequence: atgagaagtgccgttgctct. Inner Left Sequence: catgtcattgatggctggac. Inner Right Sequence: gaacgccagttggttgattt. Inner Primer PCR Length: 2851. Estimated Deletion Size: about 850 bp. 12/2004: From Laura DiCaprio: The deletion is 981 base pairs from X: 15500754 - 15501734. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1162 |
cfz-2(ok1201) V. |
C. elegans |
F27E11.3. Homozygous. Outer Left Sequence: TCAGTTTGGCCACATTTTGA. Outer Right Sequence: TCAGCGTGCTGTTCCTATTG. Inner Left Sequence: ATTCCGAAAGCTCGACAAGA. Inner Right Sequence: AAGAAGCCGGATTGGAAGTT. Inner Primer PCR Length: 3182 bp. Deletion Size: 1174 bp. Deletion left flank: CAAACAGCAAATAGCATTTTTCCACGACGA. Deletion right flank: CCCACCAAACCGAGGCAGCCATTCCGAAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1163 |
amt-4(ok1202) X. |
C. elegans |
C05E11.5 Homozygous. Outer Left Sequence: agccaaatttgaacacctgc. Outer Right Sequence: ttcgattccaaaagaggcat. Inner Left Sequence: agattgacgcccattacctg. Inner Right Sequence: cgaaaacctaaaagcatcgg. Inner Primer PCR Length: 2644. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1164 |
aly-2(ok1203) IV. |
C. elegans |
F23B2.6 Homozygous. Outer Left Sequence: atgcggaataacggagtgtc. Outer Right Sequence: atcagtttgcagcttccgat. Inner Left Sequence: cgcgaattcacacacaaagt. Inner Right Sequence: tggcttctggagggatagtg. Inner Primer PCR Length: 2266. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1165 |
col-99(ok1204) IV. |
C. elegans |
F29C4.8 Homozygous. Outer Left Sequence: actgactgccgctgatctct. Outer Right Sequence: cggatgactttttctctcgc. Inner Left Sequence: cgtagctcggagatgtcctc. Inner Right Sequence: tcattgaattgctgctctcg. Inner Primer PCR Length: 2632. Estimated Deletion Size: about 1250 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1166 |
eor-1(ok1127) IV. |
C. elegans |
R11E3.6 Homozygous. Outer Left Sequence: GGCCCAACCTTTGAATTTTT. Outer Right Sequence: CCGTATCGATGTGAAACGTG. Inner Left Sequence: GAAGTTGCTGGAGTTGAGCC. Inner Right Sequence: CTTTGCCGAAGGAAACACAT. Inner Primer PCR Length: 2638. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1167 |
F52D10.2(ok1205) X. |
C. elegans |
F52D10.2 Homozygous. Outer Left Sequence: tggcgagaaggaaagaaaga. Outer Right Sequence: aaacaaacaattgcgccttc. Inner Left Sequence: acaagcttcagagcgacgtt. Inner Right Sequence: tcttccttccttgccttcag. Inner Primer PCR Length: 2109. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1169 |
oga-1(ok1207) X. |
C. elegans |
T20B5.3 Homozygous. Outer Left Sequence: caatgtcgtcaatggctacg. Outer Right Sequence: gttgttgaaggtaagcccca. Inner Left Sequence: taggaaatatccacgcgacc. Inner Right Sequence: cgaatttcaggcttctacgg. Inner Primer PCR Length: 3268. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1170 |
C04B4.2(ok1212) X. |
C. elegans |
C04B4.2 Homozygous. Outer Left Sequence: tggcccttgtttaaatgctc. Outer Right Sequence: tcttaaccgttcggaaatcg. Inner Left Sequence: gtcgcgtcgcaacaatacta. Inner Right Sequence: ccaaggcaacaaaaggagaa. Inner Primer PCR Length: 2268. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1171 |
cpi-1(ok1213) IV. |
C. elegans |
K08B4.6 Homozygous. Outer Left Sequence: ccggaagatgatgaaaggaa. Outer Right Sequence: acgtctcccagagagcgtaa. Inner Left Sequence: aagaacgtagcgcgagtgat. Inner Right Sequence: atacggtgtctatcgcggac. Inner Primer PCR Length: 2182. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1172 |
acr-15(ok1214) V. |
C. elegans |
F25G6.4 Homozygous. Outer Left Sequence: ctctgcgcttcaagctctct. Outer Right Sequence: cagcagggaggtgtaccaat. Inner Left Sequence: gtgatgctcttgcccatttt. Inner Right Sequence: tgctctttttcaggaaggga. Inner Primer PCR Length: 3055. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1173 |
plc-4(ok1215) IV. |
C. elegans |
R05G6.8 Homozygous. Outer Left Sequence: gctgaaacatgccaaggatt. Outer Right Sequence: tcaaaatgtttctctggccc. Inner Left Sequence: ctatgcgaaagaaagggcag. Inner Right Sequence: tggcgttggtgacaataaaa. Inner Primer PCR Length: 2912. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1174 |
W02H5.7(ok1216) V. |
C. elegans |
W02H5.7 Homozygous. Outer Left Sequence: gggatgggggatcagataat. Outer Right Sequence: aaatttgcatttgcctttgg. Inner Left Sequence: gttgctcactttatggggga. Inner Right Sequence: aatgccatgccatgtagtca. Inner Primer PCR Length: 2981. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1175 |
F55F8.3(ok1115) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F55F8.3 Heterozygotes are WT and GFP+. Segregates very rare homozygous hT2 glowing animals. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: TACCAGTCAGAGTTGCCACG. Outer Right Sequence: GAATTGCGCCAATGAAGATT. Inner Left Sequence: TCAATTGCATTCCGTGATGT. Inner Right Sequence: GCGGAATTCGTGCTTTGTAT. Inner Primer PCR Length: 3397. Estimated Deletion Size: about 1300 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1176 |
oxi-1(ok1217) III. |
C. elegans |
Y39A1C.2 Homozygous. Outer Left Sequence: ttttgaaaccggaaaattcg. Outer Right Sequence: tccaaaatttgttctgcacg. Inner Left Sequence: catcgaaaatccgcttcttt. Inner Right Sequence: agctgcagttccctttctca. Inner Primer PCR Length: 3022. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1177 |
F23B2.3(ok1226) IV. |
C. elegans |
F23B2.3 Homozygous. Outer Left Sequence: tgcttcgattgattgctcac. Outer Right Sequence: ggaggttacgcatccaaaaa. Inner Left Sequence: tcggattttcctttgcattc. Inner Right Sequence: ttcgcctcctatatcccctt. Inner Primer PCR Length: 2845. Estimated Deletion Size: about 2050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1178 |
wwp-1(ok1102) I. |
C. elegans |
Y65B4BR.4a. Homozygous. Outer Left Sequence: AACGAAGAAGCGCAGGAGTA. Outer Right Sequence: CAATCGTCCACATCAACGTC. Inner Left Sequence: AGTTCAGAGGCATCCACGTC. Inner Right Sequence: ATCTCTGTACCGCCCTCCTT. Inner Primer PCR Length: 3219 bp. Deletion Size: 1042 bp. Deletion left flank: GCGGAGACCGGCGACAGCGAAGCGTGACAC. Deletion right flank: ACTCAGCCATTGCCACAGGGATGGGAAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1179 |
C55C2.1(ok1228) I. |
C. elegans |
C55C2.1 Homozygous. Outer Left Sequence: gtcccatatgcttcttccca. Outer Right Sequence: aatccaagattcaaggcacg. Inner Left Sequence: tgtgaattgggtgagagcag. Inner Right Sequence: ttggcgtttttgtgtctctg. Inner Primer PCR Length: 2206. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1180 |
act-2(ok1229) V. |
C. elegans |
T04C12.5 Homozygous. Outer Left Sequence: tggcgagagaagaagagagg. Outer Right Sequence: aaacaatacctgattcggcg. Inner Left Sequence: gcgtgagaaacagtgcaaaa. Inner Right Sequence: aacatgacggtcagcaagtg. Inner Primer PCR Length: 2668. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1181 |
gld-2(ok1117) I. |
C. elegans |
ZC308.1 Homozygous. Outer Left Sequence: TGTTTGAATGGGGTTTCTCC. Outer Right Sequence: ACTTCCTGGTCGTTGTGGTC. Inner Left Sequence: ACAGGTGGTCAACCCATGAT. Inner Right Sequence: ACGAAGACTAGCACACGCAA. Inner Primer PCR Length: 3342. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1182 |
tba-1(ok1123) I. |
C. elegans |
F26E4.8 Homozygous. Outer Left Sequence: gggcacttgaagttgatggt. Outer Right Sequence: cctttcctcgcaccagaata. Inner Left Sequence: tcgggaagttaagcgtcatt. Inner Right Sequence:cagcccgactttcatttctc . Inner Primer PCR Length: 2176. Estimated Deletion Size: about 1100 bp. Received new stock 11/04/04. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1183 |
prom-1(ok1140) I. |
C. elegans |
F26H9.1 Homozygous. Outer Left Sequence: gatcgaagccaaagaacgaa. Outer Right Sequence: tgaggggacattcacacgta. Inner Left Sequence: tgggtactgtagtgggggtg. Inner Right Sequence: aaaggaggaacaaaatgggg. Inner Primer PCR Length: 2240. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1184 |
Y82E9BR.14(ok1230) II. |
C. elegans |
Y82E9BR.14 Homozygous. Outer Left Sequence: ggggttcaggagggtaaaaa. Outer Right Sequence: atttgaagaatttcgcgtgc. Inner Left Sequence: cacgttaagccggaaattgt. Inner Right Sequence: gcgtcacggctagatttttc. Inner Primer PCR Length: 2829. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1185 |
tba-1(ok1135) I. |
C. elegans |
F26E4.8 Homozygous. Outer Left Sequence: gggcacttgaagttgatggt. Outer Right Sequence: cctttcctcgcaccagaata. Inner Left Sequence: tcgggaagttaagcgtcatt. Inner Right Sequence: cagcccgactttcatttctc. Inner Primer PCR Length: 2176. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1186 |
unc-89(ok1116) I. |
C. elegans |
C24G7.5 Homozygous. Outer Left Sequence: GTCCACGTCAAGAGCACTCA. Outer Right Sequence: GACTCGAGCTCTTCGCTGAT. Inner Left Sequence: GAAAACCTGGATTCTTGCCA. Inner Right Sequence: GAACTGGCGACTTTTTGAGC. Inner Primer PCR Length: 3199. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1187 |
tbx-41(ok1231) X. |
C. elegans |
T26C11.1 Homozygous. Outer Left Sequence: ttcaaatgcattgccaaaaa. Outer Right Sequence: ttggcaacaacaaagcagag. Inner Left Sequence: cctccgaattttcccatttt. Inner Right Sequence: aaagctgaaggatctgccaa. Inner Primer PCR Length: 2932. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1188 |
F23B12.6(ok1232) V. |
C. elegans |
F23B12.6 Homozygous. Outer Left Sequence: AGCATTTGGATATTGGCGAG. Outer Right Sequence: AGTGAACGGGAGATTTGTGC. Inner Left Sequence: TTGTGTGAAACCGATGTTGG. Inner Right Sequence: AGCCATCTCATCCTTTCCCT. Inner Primer PCR Length: 2975. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1189 |
chs-1(ok1120) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
T25G3.2 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Segregates very rare homozygous hT2 glowing animals. Outer Left Sequence: tgtggctgtgttgcaaagat. Outer Right Sequence: tggagaagcattccgagagt. Inner Left Sequence: atttgcacttcagctggctt. Inner Right Sequence: ggttcatcggtttcctcgta. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1600 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1190 |
amx-2(ok1235) I. |
C. elegans |
B0019.1 Homozygous. Outer Left Sequence: ttggcggaaatttgaaagtc. Outer Right Sequence: tccaacggacacccaattat. Inner Left Sequence: cagcctcaaccaccttttgt. Inner Right Sequence: tctcagcaaatggacactgc. Inner Primer PCR Length: 2803. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1191 |
C16A11.4(ok1236) II. |
C. elegans |
C16A11.4 Homozygous. Outer Left Sequence: ctaccaagaaaatcgccgaa. Outer Right Sequence: gtggaggcaccgtaacttgt. Inner Left Sequence: catagaaattccgccgaaaa. Inner Right Sequence: tctcgacgcgaaaaggttat. Inner Primer PCR Length: 2747. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1192 |
C24G7.4(ok1237) I. |
C. elegans |
C24G7.4 Homozygous. Outer Left Sequence: ccctttttgacgtgcattct. Outer Right Sequence: ggagcccataaacaccaaaa. Inner Left Sequence: acaagcagtttgccaatcaa. Inner Right Sequence: ttgttttgaagcgaaaaccc. Inner Primer PCR Length: 3185. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1193 |
F44D12.9(ok1238) IV. |
C. elegans |
F44D12.9 Homozygous. Outer Left Sequence: AGCCAAGATTTGGGCCTACT. Outer Right Sequence: TGCACCATATCCGTGTGACT. Inner Left Sequence: ACATGCTTGTTTTTGGGGAA. Inner Right Sequence: AATGGGTGTACTGGCGACTC. Inner Primer PCR Length: 2230. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1194 |
grk-1(ok1239) X. |
C. elegans |
F19C6.1 Homozygous. Outer Left Sequence: AGGAATGAATCGGAGACGTG. Outer Right Sequence: TTGCCACAGCTTCGTAATTG. Inner Left Sequence: CAGGACAAAACGGAGGTGTT. Inner Right Sequence: AACAGTGGAACAAAGGACGG. Inner Primer PCR Length: 2808. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1195 |
acr-8(ok1240) X. |
C. elegans |
ZC504.2 Homozygous. Outer Left Sequence: tcgaccaatcaaaaatgcaa. Outer Right Sequence: cgcttacgtctgtcgtgcta. Inner Left Sequence: actcagccaacatcgtttcc. Inner Right Sequence: caccaggcaagttgagtgaa. Inner Primer PCR Length: 3051. Estimated Deletion Size: about 1050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1196 |
shn-1(ok1241) II. |
C. elegans |
C33B4.3 Homozygous. Outer Left Sequence: AGTGAGAAATGGGGTCGATG. Outer Right Sequence: CCAATTGGACTTACACCGCT. Inner Left Sequence: AGCAAAAATCGGACACAACC. Inner Right Sequence: GCTGTGAACAAGCAAGGACA. Inner Primer PCR Length: 2797. Estimated Deletion Size: about 2300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1197 |
ctl-1(ok1242) II. |
C. elegans |
Y54G11A.6 Homozygous. Outer Left Sequence: cggcgattcttatactccca. Outer Right Sequence: attccccgtataccctgacc. Inner Left Sequence: ggccaattttctgcctgata. Inner Right Sequence: gcctgtccaaaataagcgag. Inner Primer PCR Length: 2994. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1198 |
Y66D12A.16(ok1243) III. |
C. elegans |
Y66D12A.16 Homozygous. Outer Left Sequence: ccattctgcgaggttcttgt. Outer Right Sequence: gtcgttttcgctctttcgtc. Inner Left Sequence: tcatgacgcgttttatccaa. Inner Right Sequence: gtgatcacgtgtacgttggg. Inner Primer PCR Length: 3301. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1199 |
sax-7(ok1244) IV. |
C. elegans |
C18F3.2 Homozygous. Outer Left Sequence: accgggttctgctgtgtatc. Outer Right Sequence: gagaccagacaccgcatttt. Inner Left Sequence: tgggaagctccaatgatttc. Inner Right Sequence: atcaaaatttcgcatctggc. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1200 |
hst-3.1(ok1249) II. |
C. elegans |
F40H3.5 Homozygous. Outer Left Sequence: ATGCACGTGTTCCTCCTTTC. Outer Right Sequence: ACCACCAAACGGTAATGGAA. Inner Left Sequence: TTAAAGCCGATGGGAATCTG. Inner Right Sequence: TAGAGACGAGCAGAGCGTGA. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1201 |
F38H12.3(ok1250) V. |
C. elegans |
F38H12.3 Homozygous. Outer Left Sequence: tacaatcatggttccgggtt. Outer Right Sequence: tttgatgctcggtcattttg. Inner Left Sequence: cccaaccgactactctcgaa. Inner Right Sequence: ttgaacggatcgcttacaca. Inner Primer PCR Length: 2951. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1202 |
ZK265.1(ok1251) I. |
C. elegans |
ZK265.1 Homozygous. Outer Left Sequence: ttgctcaacatcatgcccta. Outer Right Sequence: aatggcggaagtatctgtgg. Inner Left Sequence: tcgaaaatcccaattcaacc. Inner Right Sequence: gagccgatgttttcaagctc. Inner Primer PCR Length: 2972. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1203 |
T10B11.2(ok1252) I. |
C. elegans |
T10B11.2 Homozygous. Outer Left Sequence: GGTTCGGCAAAGCACATAAT. Outer Right Sequence: TAACAACGGCATTGAATGGA. Inner Left Sequence: TCATTCCGACGGTACCATTT. Inner Right Sequence: TGAAGCTTGAAATGCAGTGG. Inner Primer PCR Length: 2465. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1204 |
old-2(ok1253) II. |
C. elegans |
ZK938.5 Homozygous. Outer Left Sequence: GCTGTCCCATACGGTTTGAT. Outer Right Sequence: TATTAGCCACGCCCACTTTC. Inner Left Sequence: AGGGAAGAAAATCAGCAGCA. Inner Right Sequence: TTGCTTTGCTTCATGCTACG. Inner Primer PCR Length: 2110. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1205 |
R09B5.1(ok1254) V. |
C. elegans |
R09B5.1 Homozygous. Outer Left Sequence: ctcattgacttccgggacat. Outer Right Sequence: aatatttttggggaaaggcg. Inner Left Sequence: ctcctcttcctcgtcctcct. Inner Right Sequence: agctttgcagttccggttta. Inner Primer PCR Length: 3218. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1206 |
rsks-1(ok1255) III. |
C. elegans |
Y47D3A.16 Homozygous. Outer Left Sequence: gagatgcggaagctatgctc. Outer Right Sequence: gttgaattcctgctcctcca. Inner Left Sequence: attcaactgtgtgccagtgc. Inner Right Sequence: tggggcttcactatttggtc. Inner Primer PCR Length: 3267. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1207 |
cpi-2(ok1256) V. |
C. elegans |
R01B10.1 Homozygous. Outer Left Sequence: attccgataacattggctgg. Outer Right Sequence: aatctgttgccgacaaaacc. Inner Left Sequence: attttctggccaatttcgtg. Inner Right Sequence: ccacaattccaatcccaatc. Inner Primer PCR Length: 2103. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1208 |
mrt-2(ok1260) III. |
C. elegans |
Y41C4A.14 Homozygous. Outer Left Sequence: tcacgcaatcagtgagcttc. Outer Right Sequence: accgagcattttattcgacg. Inner Left Sequence: gtgcgatggcctacaaaact. Inner Right Sequence: ctcggggatcgaacattaaa. Inner Primer PCR Length: 3107. Estimated Deletion Size: about 2600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1209 |
brc-1(ok1261) III. |
C. elegans |
C36A4.8 Homozygous. Outer Left Sequence: aagccaatgaactggtggtc. Outer Right Sequence: tttgtgtgcaaacaccgatt. Inner Left Sequence: gttgagaccgcagaaatcgt. Inner Right Sequence: caaaccgacacaaaatcacg. Inner Primer PCR Length: 2392. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1210 |
nob-1(ok1266) III. |
C. elegans |
Y75B8A.2 Homozygous. Outer Left Sequence: TGGTGCCAAAATGATAGCAA. Outer Right Sequence: TTTTCTCAGTGGGTCTCGCT. Inner Left Sequence: TTTTCGAGTTCGTTTTGGCT. Inner Right Sequence: CGATATCGAGATTAGCGGGA. Inner Primer PCR Length: 2924. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1211 |
C34G6.5(ok1267) I. |
C. elegans |
C34G6.5 Homozygous. Outer Left Sequence: ccgtatcacacactcatcgg. Outer Right Sequence: attgctaaaacccgcagaaa. Inner Left Sequence: agaaggacaactggctccaa. Inner Right Sequence: caacacagcaagcgagaaaa. Inner Primer PCR Length: 2678. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1212 |
K07D4.5(ok1268) II. |
C. elegans |
K07D4.5 Homozygous. Outer Left Sequence: caggaagaggggaaacatca. Outer Right Sequence: ttttgggaggcatgaatagg. Inner Left Sequence: gggtacatccattgccattc. Inner Right Sequence: gcacccgacattttcagttt. Inner Primer PCR Length: 3286. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1213 |
fkb-4(ok240) V. |
C. elegans |
ZC455.10 Homozygous. Outer Left Sequence: GGATAATCGTTGCAGCTGGT. Outer Right Sequence: AACACAAGGCATTTTCGGTC. Inner Left Sequence: TCGAAGAAAAGACGAGCACC. Inner Right Sequence: CAGGAATCACAGCGTCGATA. Inner Primer PCR Length: 3198. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1214 |
xpo-3(ok1271) IV. |
C. elegans |
C49H3.10 Homozygous. Outer Left Sequence: ATTTAGTTGGAGTGGGTGCG. Outer Right Sequence: GGCGATAGCACGAACTCTTC. Inner Left Sequence: ATCAGAATCGATTTGCGAGC. Inner Right Sequence: CGCTGATATCTTGCGAACAA. Inner Primer PCR Length: 2251. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1215 |
old-1(ok1273) II. |
C. elegans |
C08H9.5 Homozygous. Outer Left Sequence: AGACCCACAAGTTTTGTCGC. Outer Right Sequence: GAATTCCCTGGTGAACGAGA. Inner Left Sequence: TGTTGTGGACGGAACGTAAA. Inner Right Sequence: ATCAGCGCATTCGATCTTCT. Inner Primer PCR Length: 2643. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1217 |
F25G6.2(ok1233) V/nT1 [qIs51] (IV;V). |
C. elegans |
F25G6.2 Heterozygotes are WT and GFP+ in the pharynx. ok1233 homozygotes arrest at the L1 stage. Outer Left Sequence: TGAACTCACGAAAATGACGG. Outer Right Sequence: ATACAGGTTCCAATGAGCGG. Inner Left Sequence: CTCGGTGCACGAAGTGTAAA. Inner Right Sequence: GCCAAAAAGGAATTGCAAAA. Inner Primer PCR Length: 3056. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1218 |
F56B3.9(ok1275) IV. |
C. elegans |
F56B3.9 Homozygous. Outer Left Sequence: taagagagcggacgcatttt. Outer Right Sequence: gttaacggaatttcggggtt. Inner Left Sequence: cgtggaggacgatctgaaat. Inner Right Sequence: attcgactgccagtgagctt. Inner Primer PCR Length: 2116. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1219 |
ZC449.3a(ok1276) X. |
C. elegans |
ZC449.3a Homozygous. Outer Left Sequence: aagaaatagaggcggtcggt. Outer Right Sequence: ggtgcatgggaatttgtttc. Inner Left Sequence: tttcaaccacacgccaaata. Inner Right Sequence: aagttgagacggacgaggaa. Inner Primer PCR Length: 2725. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1220 |
chp-1(ok1277) I. |
C. elegans |
Y110A7A.13 Y110A7A.12 Homozygous. Outer Left Sequence: gaccgggtagtttttgcgta. Outer Right Sequence: ggtccgtatttccatgatgc. Inner Left Sequence: gaaacacacaggaacgggat. Inner Right Sequence: aggatgtacgcgtggaaaac. Inner Primer PCR Length: 3175. Estimated Deletion Size: about 2900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1221 |
his-74(ok1219) V/nT1 [qIs51] (IV;V). |
C. elegans |
W05B10.1 Heterozygotes are WT and GFP+. Outer Left Sequence: ttggcttatcggacagatcc. Outer Right Sequence: gtgagctcgtaatatccggc. Inner Left Sequence: aaaatgagaattgatcgcgg. Inner Right Sequence: accttgtgtgatttgcgatg. Inner Primer PCR Length: 2255. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1222 |
R09B5.1(ok1280) V. |
C. elegans |
R09B5.1 Homozygous. Outer Left Sequence: ctcattgacttccgggacat. Outer Right Sequence: aatatttttggggaaaggcg. Inner Left Sequence: ctcctcttcctcgtcctcct. Inner Right Sequence: agctttgcagttccggttta. Inner Primer PCR Length: 3218. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1223 |
sph-1(ok1199) IV/nT1 [qIs51] (IV;V). |
C. elegans |
F42G8.10 Heterozygotes are WT and GFP+. Outer Left Sequence: aaagtgaacagcaggccaac. Outer Right Sequence: attgtccatcccatcgaaga. Inner Left Sequence: aggaaaccatggctttaggc. Inner Right Sequence: gcttgtgctttcgactttcc. Inner Primer PCR Length: 2101. Estimated Deletion Size: about 1350 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1224 |
C34G6.2(ok1227) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C34G6.2 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: agatgggatgatggagcaag. Outer Right Sequence: caagaggtccggatcaaaag. Inner Left Sequence: gctgaggttgcttaggttgc. Inner Right Sequence: atctccgaaatcgtcacgtc. Inner Primer PCR Length: 3245. Estimated Deletion Size: about 2250 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1225 |
pxf-1(ok1186) IV/nT1 [qIs51] (IV;V). |
C. elegans |
T14G10.2a Heterozygotes are WT and GFP+. Outer Left Sequence: ttgaaatttcgaagatcccg. Outer Right Sequence: catgcccgattatctccact. Inner Left Sequence: acccaccacatttcacgatt. Inner Right Sequence: ttcgattgaccctcatctcc. Inner Primer PCR Length: 3196. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1226 |
acr-18(ok1285) V. |
C. elegans |
F28F8.1 Homozygous. Outer Left Sequence: tcccacatctctcacccttc. Outer Right Sequence: gcactctccgctcatctctc. Inner Left Sequence: gtgctcttcaccgaatccat. Inner Right Sequence: atgtcaaagaaatccgaccg. Inner Primer PCR Length: 3125. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1227 |
Y49E10.20(ok1286) III. |
C. elegans |
Y49E10.20 Homozygous. Outer Left Sequence: cttcttttcgcgtgctctct. Outer Right Sequence: gacaagactagtccgccagc. Inner Left Sequence: gcgggatttcgtcaaaataa. Inner Right Sequence: tcagcaagattttctcggct. Inner Primer PCR Length: 3106. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1228 |
arx-2(ok1269) V/nT1 [qIs51] (IV;V). |
C. elegans |
K07C5.1 Heterozygotes are WT and GFP+. Outer Left Sequence: tccaatttggcttcaacaca. Outer Right Sequence: catcgacttccgcgtatttt. Inner Left Sequence: tttgaatgagagtgggggag. Inner Right Sequence: ttttcaggcgaaatggattc. Inner Primer PCR Length: 2734. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1229 |
cyc-1(ok1258) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C54G4.8 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: ccgaagaattccgaatcaaa. Outer Right Sequence: tatcggcgcaagctactttt. Inner Left Sequence: tttggcgtcgaagaataacc. Inner Right Sequence: atgctgaggatcggattttg. Inner Primer PCR Length: 2598. Estimated Deletion Size: about 1600 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1230 |
F49D11.9(ok1190) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F49D11.9 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: aattgccaactgccgattat. Outer Right Sequence: tcggggagtacacaggctac. Inner Left Sequence: aagaacttcagagttgccgc. Inner Right Sequence: cgagctccataaaatcgcat. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 900 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1231 |
pde-4(ok1290) II. |
C. elegans |
R153.1a Homozygous. Outer Left Sequence: acagcaccggcaaatatagc. Outer Right Sequence: tcgacacgctaatcgaagtg. Inner Left Sequence: agcagaacgtgcattgactg. Inner Right Sequence: ttgagcttccagacgatgtg. Inner Primer PCR Length: 3136. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1232 |
K04F10.1(ok1291) I. |
C. elegans |
K04F10.1 Homozygous. Outer Left Sequence: TGGTGAAATTCCATCAAGCA. Outer Right Sequence: GCATTGAGCTGTGCTGAAAA. Inner Left Sequence: AGTGGAAACCGAAGTTGTGC. Inner Right Sequence: CTCGAGCGAGTCGAGTTTTT. Inner Primer PCR Length: 2128. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1233 |
T22H9.4(ok1294) V. |
C. elegans |
T22H9.4 Homozygous. Outer Left Sequence: gtggctgaaaattcggaaaa. Outer Right Sequence: tactgatccgcgtaaaaccc. Inner Left Sequence: aaaatcaatcggtttcagcg. Inner Right Sequence: gcggagacgttagacatggt. Inner Primer PCR Length: 2135. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1234 |
clk-1(ok1247) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
ZC395.2 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. ok1247 animals are homozygous viable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: CGGGTTTCGCACTATTTTGT. Outer Right Sequence: CAGCTACCGTACCCGACATT. Inner Left Sequence: GCTGGCCCAGTACATTTGTT. Inner Right Sequence: CAGTGTTCCGGATTTCAGGT. Inner Primer PCR Length: . Estimated Deletion Size: about 1250 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1235 |
T28C6.1(ok1264) IV/nT1 [qIs51] (IV;V). |
C. elegans |
T28C6.1 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms as the balancer may break down. ok1264 animals are homozygous viable. Outer Left Sequence: TCCCTGTTCCATTTTTGAGC. Outer Right Sequence: CATCACCTCTACCACCCCAT. Inner Left Sequence: AAGCCAAGAATTCGCAAAAA. Inner Right Sequence: CAACACCACCATGACCTGAA. Inner Primer PCR Length: 2241. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1236 |
Y110A7A.12(ok1054) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y110A7A.12 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. ok1054 animals are homozygous viable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: GAAACACACAGGAACGGGAT. Outer Right Sequence: AATCGGCGTTTTTCAGAATG. Inner Left Sequence: TGGCAGAAGATGATCCAGTG. Inner Right Sequence: GCGTGGATCTCGATTACGAT. Inner Primer PCR Length: 2442. Estimated Deletion Size: about 1300 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1237 |
B0416.1(ok1302) X. |
C. elegans |
B0416.1 Homozygous. Outer Left Sequence: gcttcaaaaatagggcctcc. Outer Right Sequence: tttatttggatcagcccagc. Inner Left Sequence: cgtcagcacgcttttaatca. Inner Right Sequence: aggtacaaattggcgacctg. Inner Primer PCR Length: 3349. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1238 |
hmg-11(ok1303) II. |
C. elegans |
T05A7.4 Homozygous. Outer Left Sequence: ctcgtggaagccctagacag. Outer Right Sequence: catcgggaaagtacggaaga. Inner Left Sequence: tcagatggtatgatcgccaa. Inner Right Sequence: tcagactgtcacatcgctcc. Inner Primer PCR Length: 2185. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1239 |
F36A2.4(ok1304) I. |
C. elegans |
F36A2.4 Homozygous. Outer Left Sequence: ATGTGGATATCGACCCGAAA. Outer Right Sequence: CAGTCCTGATTTTGGAGGGA. Inner Left Sequence: GTCGAATCGAAGATCAGGGA. Inner Right Sequence: AGTTGGCAAATGATTCGGAG. Inner Primer PCR Length: 2524. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1240 |
C23F12.2(ok1305) X. |
C. elegans |
C23F12.2 Homozygous. Outer Left Sequence: atcagcactatctcgcccat. Outer Right Sequence: acgcaaacattgcaaaaatg. Inner Left Sequence: aaaaacgaaaccacagccac. Inner Right Sequence: cagtaacctagtcacgcgca. Inner Primer PCR Length: 3203. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1241 |
ZK337.2(ok1306) I. |
C. elegans |
ZK337.2 Homozygous. Outer Left Sequence: GGGGAGCCAGAGGTTAAAAG. Outer Right Sequence: TTCTCTCTCACTTCTCCGGC. Inner Left Sequence: ATACGAGCAAGCTCCCTCAA. Inner Right Sequence: GAAGGGTGAAGACACGGAAA. Inner Primer PCR Length: 2572. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1242 |
C56E6.2(ok1307) II. |
C. elegans |
C56E6.2 Homozygous. Outer Left Sequence: ccctttactcttcatccgca. Outer Right Sequence: cgtcgttcaaaacaagagca. Inner Left Sequence: aagagggtgcaagaatcacg. Inner Right Sequence: atcgtcgatgataaggcagg. Inner Primer PCR Length: 2177. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1243 |
T22H2.5a(ok1308) I. |
C. elegans |
T22H2.5a Homozygous. Outer Left Sequence: aactagaagaaatgggcggg. Outer Right Sequence: catttttgtgcaagctcacg. Inner Left Sequence: ttaacaaggaaatgtgggcg. Inner Right Sequence: ccagaactttcctcctgctg. Inner Primer PCR Length: 2122. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1244 |
W04B5.5(ok1309) III. |
C. elegans |
W04B5.5 Homozygous. Outer Left Sequence: gaagcgaggtctacagtccg. Outer Right Sequence: cgtcgaaaagaacccaaaaa. Inner Left Sequence: gtggtgggacccatattgag. Inner Right Sequence: tctgcctgaaaaggctgatt. Inner Primer PCR Length: 2929. Estimated Deletion Size: about 330 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1245 |
rga-1(ok204) II. |
C. elegans |
W02B12.6. Homozygous. Outer Left Sequence: TCCGGTTGAATACACGTTGA. Outer Right Sequence: CTTGCGCTGATGTATCCAGA. Inner Left Sequence: TAAACTGGTAATCCCCGTCG. Inner Right Sequence: AAACTTCGGCAGTTGGAAGA. Inner Primer PCR Length: 3083 bp. Deletion Size: 994 bp. Deletion left flank: ATTGAAATGACATTTTTGGCGAGCGCCGCG. Deletion right flank: GCAGGCCAATTGTTGTCGTATATGCTTATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1246 |
nxf-1(ok1281) V/nT1 [qIs51] (IV;V). |
C. elegans |
C15H11.3 Heterozygotes are WT and GFP+. ok1281 animals arrest as larvae. Outer Left Sequence: gagcttctgcaggacacaca. Outer Right Sequence: ctgcgaagatgggaaaagag. Inner Left Sequence: tgaaaagctcagtgacggtg. Inner Right Sequence: ctcgtctgcatttttgcgta. Inner Primer PCR Length: 3153. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1247 |
ZK669.1a(ok1311) II. |
C. elegans |
ZK669.1a Homozygous. Outer Left Sequence: atgaactgtgcacgcttttg. Outer Right Sequence: attggattctggattgcgag. Inner Left Sequence: tcgttcgactacgctttcct. Inner Right Sequence: aaagccagttttcgtcatgc. Inner Primer PCR Length: 3252. Estimated Deletion Size: about 2600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1248 |
B0285.8(ok1312) III. |
C. elegans |
B0285.8 Homozygous. Outer Left Sequence: aaatcgccaacttccaagaa. Outer Right Sequence: tcgcgaaacattcacttgac. Inner Left Sequence: ttccaaaactctttggctcc. Inner Right Sequence: gaatccggggatttttcagt. Inner Primer PCR Length: 2183. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1249 |
scrm-2(ok1313) I. |
C. elegans |
ZK1053.5 Homozygous. Outer Left Sequence: ttgcagatcaaaccatccaa. Outer Right Sequence: ttggaaaatcttgggctcac. Inner Left Sequence: cttccctcttcgtctatgcg. Inner Right Sequence: tttgaaagaattgggttcgg. Inner Primer PCR Length: 2112. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1250 |
acr-21(ok1314) III. |
C. elegans |
F27B3.2 Homozygous. Outer Left Sequence: caaaagagggtgtcgggtaa. Outer Right Sequence: aaacaccacaagcaggaagc. Inner Left Sequence: aaactgcagacggagctcat. Inner Right Sequence: tgaaattttgggaggattcg. Inner Primer PCR Length: 2667. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1251 |
T09B9.4(ok1315) X. |
C. elegans |
T09B9.4 Homozygous. Outer Left Sequence: tcgagtaaatgtgcatggga. Outer Right Sequence: tccctctctctctcgtctgc. Inner Left Sequence: tcatcgggggatatggtcta. Inner Right Sequence: cagtcgttcgtgtgctcatt. Inner Primer PCR Length: 2287. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1252 |
C01F4.2(ok1316) I. |
C. elegans |
C01F4.2 Homozygous. Outer Left Sequence: actgattttgaggtggtggc. Outer Right Sequence: taaaaccgggaatggagttg. Inner Left Sequence: gtctcgccacgacgaattat. Inner Right Sequence: aaatttcagttcgcattccg. Inner Primer PCR Length: 3272. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1253 |
ifb-1(ok1317) II. |
C. elegans |
F10C1.2b Homozygous. Outer Left Sequence: aaaaatgggcgtgttcagtc. Outer Right Sequence: aaccgtcgaccaattctgac. Inner Left Sequence: ccgaaggatgcagaaacatt. Inner Right Sequence: gtgggcggagtcaactaaag. Inner Primer PCR Length: 3015. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1254 |
C52B11.3(ok1321) X. |
C. elegans |
C52B11.3 Homozygous. Outer Left Sequence: attttagcctgtgtgcgctt. Outer Right Sequence: atgagaaaaatttgcgagcg. Inner Left Sequence: cggaattcgcaatgtctttt. Inner Right Sequence: tactgaaaaaggcaggcagg. Inner Primer PCR Length: 3300. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1255 |
arf-1.2(ok1322) III. |
C. elegans |
B0336.11 Homozygous. Outer Left Sequence: cttgcaaacagttcaacgga. Outer Right Sequence: gagatgacggcttcgaaaag. Inner Left Sequence: tgttgacgataactcctgcg. Inner Right Sequence: tcaggtaatcggatcttggc. Inner Primer PCR Length: 2704. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1256 |
cdh-4(ok1323) III. |
C. elegans |
F25F2.2 Homozygous. Outer Left Sequence: tgagaattcacctgcaaacg. Outer Right Sequence: gcatgagtggtgattccaga. Inner Left Sequence: gttgaagccactgatgcaga. Inner Right Sequence: tcaatcgaacttctccggtc. Inner Primer PCR Length: 3381. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1257 |
T18D3(ok1324) X. |
C. elegans |
T18D3. Homozygous. Outer Left Sequence: TTCCCGATATCTCAAAACGC. Outer Right Sequence: TGAATTCCCAAAATTCTCGC. Inner Left Sequence: TGACAAACAAAATGGCCAAA. Inner Right Sequence: CTCAAAGCGGATTAACCCAA. Inner Primer PCR Length: 3055 bp. Deletion Size: 1026 bp. Deletion left flank: AGTCACACAGACAAAAATTGGCATTTACAC. Deletion right flank: AAATAAACAGTCAGAGACTATTTGCGGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1258 |
C33H5.11(ok1326) IV. |
C. elegans |
C33H5.14 Homozygous. Outer Left Sequence: tcccaagcctggttaagatg. Outer Right Sequence: tgccatcccaaacatcacta. Inner Left Sequence: ctgggtccatcatcactcct. Inner Right Sequence: ccactcctctccgtcttctg. Inner Primer PCR Length: 2936. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1259 |
dmd-3(ok1327) V. |
C. elegans |
Y43F8C.10 Homozygous. Outer Left Sequence: ggctcctcgaacagattttg. Outer Right Sequence: catgacctccttgtttccgt. Inner Left Sequence: ataaggcagttttcgagcca. Inner Right Sequence: gctgttcttcaaggccaaag. Inner Primer PCR Length: 3320. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1260 |
csn-2(ok1288) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
B0025.2 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. ok1288 is homozygous viable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: ttttatcgattttcccaccg. Outer Right Sequence: cctcgcccatttactggtta. Inner Left Sequence: agacccaggaaaagttcggt. Inner Right Sequence: accatcatccaaaattgcgt. Inner Primer PCR Length: 3177. Estimated Deletion Size: about 1800 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1261 |
C50B6.1(ok1343) V. |
C. elegans |
C50B6.1 Homozygous. Outer Left Sequence: cctctcgtcgggtaacacat. Outer Right Sequence: gtggagtcgactgaagagcc. Inner Left Sequence: ggtgcttcagaatactcggc. Inner Right Sequence: accagccaaccattcacttt. Inner Primer PCR Length: 2105. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1262 |
cpr-1(ok1344) V. |
C. elegans |
C52E4.1 Homozygous. Outer Left Sequence: agtagcaggagcagcaggag. Outer Right Sequence: ttcaacggtacaactgtcgc. Inner Left Sequence: gagtagctccagttggggtg. Inner Right Sequence: tgcatttagaccttggcctt. Inner Primer PCR Length: 2562. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1263 |
acr-11(ok1345) I. |
C. elegans |
D2092.3 Homozygous. Outer Left Sequence: tctccaatccgtttgaatcc. Outer Right Sequence: aagtgtgtcgcagcccttat. Inner Left Sequence: ttttcggcattttgtcagtg. Inner Right Sequence: cgcagagtaatcaaccagca. Inner Primer PCR Length: 2967. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1264 |
elo-4(ok1346) III. |
C. elegans |
C40H1.4 Homozygous. Outer Left Sequence: caatcacgtacccagtcacg. Outer Right Sequence: tgtgtcgatttgagtttggc. Inner Left Sequence: atttcaagcctctttgggct. Inner Right Sequence: tctacggaccgaatcacaca. Inner Primer PCR Length: 2156. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1265 |
F45H7.6(ok1347) III. |
C. elegans |
F45H7.6 Homozygous. Outer Left Sequence: cgcctttttctgacacatca. Outer Right Sequence: ccgtctcatccaactccatt. Inner Left Sequence: tctccaccgggtacaagttc. Inner Right Sequence: tttctcgcatagtcacgtcg. Inner Primer PCR Length: 3251. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1266 |
pct-1(ok1348) IV. |
C. elegans |
C07G1.3 Homozygous. Outer Left Sequence: tgtatgtggatgtgcgtgtg. Outer Right Sequence: aaaagcaagctgaaacggaa. Inner Left Sequence: aaatccgtttggagctgttg. Inner Right Sequence: gttttggttgagggagcttg. Inner Primer PCR Length: 2758. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1267 |
D1009.3(ok1349) X. |
C. elegans |
D1009.3 Homozygous. Outer Left Sequence: tgaggaatttccattctgcc. Outer Right Sequence: tggcctctccacaactctct. Inner Left Sequence: tgctcttgtagagccccagt. Inner Right Sequence: ggtctgtgatgaggggagaa. Inner Primer PCR Length: 2454. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1268 |
osm-12(ok1351) III. |
C. elegans |
Y75B8A.12 Homozygous. Outer Left Sequence: gcagaaaagaaaccaggcag. Outer Right Sequence: gcacccccacagtttttcta. Inner Left Sequence: ttccacgtcaccagatacca. Inner Right Sequence: ccccacagtgctcctacaat. Inner Primer PCR Length: 2849. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1269 |
mrp-8(ok1360) III. |
C. elegans |
Y75B8A.26 Homozygous. Outer Left Sequence: tggttttgccctttttgttc. Outer Right Sequence: gcttcggctgcaataaactc. Inner Left Sequence: acgtcaatttccgtccactc. Inner Right Sequence: ttctgactcgtgaggtgtcg. Inner Primer PCR Length: 2994. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1270 |
C03G6.13(ok1361) V. |
C. elegans |
C03G6.13 Homozygous. Outer Left Sequence: tgcaaaacgtcacgctctta. Outer Right Sequence: atttccgggtcctcaatacc. Inner Left Sequence: tgtcgtcacccgtagtgtgt. Inner Right Sequence: aacaaaacagatcggccaac. Inner Primer PCR Length: 2599. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1271 |
ceh-33(ok1362) V. |
C. elegans |
C10G8.7 Homozygous. Outer Left Sequence: ggaaaacaaaaccagggtca. Outer Right Sequence: cacgatcaagaagaatgcca. Inner Left Sequence: gaacggttgttcccagaaaa. Inner Right Sequence: cccgtgcagaggaatctaaa. Inner Primer PCR Length: 2241. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1272 |
K08E3.1(ok1363) III. |
C. elegans |
K08E3.1 Homozygous. Outer Left Sequence: atgggtccacaatccatcat. Outer Right Sequence: gacaggggaatagggcaaat. Inner Left Sequence: agcgatgaaaagcgactgat. Inner Right Sequence: ggttttgggaaactgggatt. Inner Primer PCR Length: 3154. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1273 |
T05F1.4(ok1364) I. |
C. elegans |
T05F1.4 Homozygous. Outer Left Sequence: tgctgatgtagtcgacggag. Outer Right Sequence: acaataacccagacgcgaac. Inner Left Sequence: attcttggcaaagctcctga. Inner Right Sequence: gcaaaacttcgtgtttgggt. Inner Primer PCR Length: 2312. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1274 |
F31C3.6(ok1365) I. |
C. elegans |
F31C3.6 Homozygous. Outer Left Sequence: ttcagctgattgaagcatcg. Outer Right Sequence: taaggcgcaggaaaacaatc. Inner Left Sequence: gggagctgtcgtccgtaata. Inner Right Sequence: tttacgttccgtccacaaca. Inner Primer PCR Length: 2843. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1275 |
cwp-3(ok1366) V. |
C. elegans |
C37H5.4 Homozygous. Outer Left Sequence: tggcttcctgaatttctgct. Outer Right Sequence: ttgatgccaagtgctgaaag. Inner Left Sequence: ttgggtaggtgaagacctcg. Inner Right Sequence: tttctgagcaagtcctcggt. Inner Primer PCR Length: 2173. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1276 |
sun-1(ok1282) V/nT1 [qIs51] (IV;V). |
C. elegans |
F57B1.2 Heterozygotes are WT and GFP+. Outer Left Sequence: tgattcccaggaaccaaaaa. Outer Right Sequence: tctgtgcctgccaaatcata. Inner Left Sequence: aaaacgaaaacggcactttg. Inner Right Sequence: aattacaattccgcacaggc. Inner Primer PCR Length: 2136. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1277 |
gcy-6(ok1293) V/nT1 [qIs51] (IV;V). |
C. elegans |
B0024.6 Heterozygotes are WT and GFP+. ok1293 animals arrest in the larval stage. Outer Left Sequence: agggagagggataaggggtt. Outer Right Sequence: tgcaatgccagttttcattc. Inner Left Sequence: gtccgccaaggatttaacaa. Inner Right Sequence: gggggataacttcatcagca. Inner Primer PCR Length: 3239. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1278 |
let-502(ok1283) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C10H11.9 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: tcaatgaagcgtcgaagttg. Outer Right Sequence: gatcgagataatgcgggaga. Inner Left Sequence: cgagttcacgagagagaccc. Inner Right Sequence: gccgaagacatttaacggaa. Inner Primer PCR Length: 3323. Estimated Deletion Size: about 1800 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1279 |
rfs-1(ok1372) III. |
C. elegans |
C30A5.2 Homozygous. Outer Left Sequence: cttccaaatcagcagcaaca. Outer Right Sequence: tctggttgtcgaatgagcag. Inner Left Sequence: ttgcacaaatcgctaatcca. Inner Right Sequence: tgggagtcttgtagtgggct. Inner Primer PCR Length: 2227. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1280 |
F15B9.4(ok1296) V/nT1 [qIs51] (IV;V). |
C. elegans |
F15B9.4 Heterozygotes are WT and GFP+. Outer Left Sequence: gactcaaggcgattgctgat. Outer Right Sequence: tgacgcggtaataaatgcaa. Inner Left Sequence: cgatcgttcccctcaaagta. Inner Right Sequence: ttcttgttgcgatgaagtcg. Inner Primer PCR Length: 3243. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1282 |
C25E10.11(ok1380) V. |
C. elegans |
C25E10.11 Homozygous. Outer Left Sequence: cttggtgagaccggagagag. Outer Right Sequence: tggcatgcaatgtcattttt. Inner Left Sequence: agccgaccggaatatttctt. Inner Right Sequence: actaattttcgaatgccccc. Inner Primer PCR Length: 2466. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1284 |
C30F12.6(ok1381) I. |
C. elegans |
C30F12.6 Homozygous. Outer Left Sequence: gtataacacaagcctccgcc. Outer Right Sequence: ggagttccagccattgatgt. Inner Left Sequence: ttttcggtctctaaccacgg. Inner Right Sequence: ttggttcaaagctgttgctg. Inner Primer PCR Length: 3260. Estimated Deletion Size: about 2200 bp. Breakpoint data provided by Neline Kriek 10/2004: TTCTTTGTAAATAACTTTTTACTTTACGTTTTTGAAAACATTCTCGATCTCCAAATCTT CbreakpointATTGGTAATTAAAATCAATAATTTCGATTCAGTGTGATCCCACTTAAA TTTTATACATTG. [NOTE: (March 2019) The Moerman lab confirms that diagnostic PCR with one primer internal to the deletion and one external yields the expected product from N2 and no product from RB1284. Primer sequences (5'->3') were ttttcggtctctaaccacgg and gaaacaagcccactcactac.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1285 |
lys-7(ok1384) V. |
C. elegans |
C02A12.4 Homozygous. Outer Left Sequence: ggtttccaaaaagccaacaa. Outer Right Sequence: gtattcagaacgtggcggtt. Inner Left Sequence: tccatcaaaattggcaacaa. Inner Right Sequence: cggcgaaataaattttggaa. Inner Primer PCR Length: 2354. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1286 |
lys-7(ok1385) V. |
C. elegans |
C02A12.4 Homozygous. Outer Left Sequence: ggtttccaaaaagccaacaa. Outer Right Sequence: gtattcagaacgtggcggtt. Inner Left Sequence: tccatcaaaattggcaacaa. Inner Right Sequence: cggcgaaataaattttggaa. Inner Primer PCR Length: 2354. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1287 |
VZC374L.1(ok1386) X. |
C. elegans |
VZC374L.1 Homozygous. Outer Left Sequence: tttgcttttcgaggcatttt. Outer Right Sequence: tgaatcagcaagattgacgg. Inner Left Sequence: gcgtaaatttccggttacga. Inner Right Sequence: tcaagctctctgctcgactg. Inner Primer PCR Length: 2166. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1288 |
C48C5.1(ok1387) X. |
C. elegans |
C48C5.1 Homozygous. Outer Left Sequence: ttgccttgcattcaattgtc. Outer Right Sequence: tgctgaatgagcttcttgga. Inner Left Sequence: agtcattcggaaagcgaaaa. Inner Right Sequence: agcagatgaagaaagccgaa. Inner Primer PCR Length: 2844. Estimated Deletion Size: about 1200 bp. Breakpoint data provided by Neline Kriek 10/2004: GATACAGGTTTTAAGAAAACACCACTTGAAAAACGCAGACAACGTAAGATTTAAAACAT GACTCGTTbreakpointAGTCTAGTGGTCTAGTGAACCAGTTTGCAATTTATGGTTTG AATATTTTAATTACTTTTAATAGTTTGTACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1289 |
C43C3.2(ok1388) X. |
C. elegans |
C43C3.2 Homozygous. Outer Left Sequence: catacccaagtacgcgtgaa. Outer Right Sequence: tgaaagtcaactggtggcag. Inner Left Sequence: ccacgtcgcctgttaagttt. Inner Right Sequence: acagttgcagaagcgagaca. Inner Primer PCR Length: 2850. Estimated Deletion Size: about 900 bp. Breakpoint data provided by Neline Kriek 10/2004: AAGTCANCACTGGAATGCATCTGTATAAGTGTGTCGATGATCTTGGTCGCGAGTTGTTT GTTGTATTTACTTTGTACTbreakpointACGACGAACACCCGACCTGAATATAGCGAG CTAATCGCAATACGTAAGTTGTTATCATTCAAGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1290 |
npp-14(ok1389) I. |
C. elegans |
C03D6.4 Homozygous. Outer Left Sequence: ccaccaaaaagccatgaact. Outer Right Sequence: aatcggaaaatttggtgctg. Inner Left Sequence: cttcggtgcaaacggattat. Inner Right Sequence: attcgctgggaaaaattgtg. Inner Primer PCR Length: 3334. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1291 |
C05D10.1(ok1390) |
C. elegans |
C05D10.1 Homozygous. Outer Left Sequence: gcctccctcattcattttca. Outer Right Sequence: atcgggtggtctgttttgag. Inner Left Sequence: aataaaatttgccgctgtgg. Inner Right Sequence: gtcccgagttgttgtcgttt. Inner Primer PCR Length: 3047. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1292 |
aex-3(ok1391). |
C. elegans |
C02H7.3 Homozygous. Outer Left Sequence: gtcaacgcgtgaaaaactga. Outer Right Sequence: cagcgtgacagatgcagatt. Inner Left Sequence: gctggagagtaaagttgccg. Inner Right Sequence: ccggtttcttgtagacccaa. Inner Primer PCR Length: 2891. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1293 |
C35E7.1(ok1392) I. |
C. elegans |
C35E7.1 Homozygous. Outer Left Sequence: gctcaagaaagccaatggag. Outer Right Sequence: catggagtttgctcgtctga. Inner Left Sequence: atgagcaagttgccgagagt. Inner Right Sequence: gtgggagtactgtaggggca. Inner Primer PCR Length: 2849. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1294 |
C49G7.8(ok1393) V. |
C. elegans |
C49G7.8 Homozygous. Outer Left Sequence: gccaaactttgctaacgctc. Outer Right Sequence: ttagccgaagtagccgaaaa. Inner Left Sequence: aagccttcagacacgctttc. Inner Right Sequence: gaccgattgattttagccga. Inner Primer PCR Length: 2372. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1295 |
F10C1.5(ok1394) II. |
C. elegans |
F10C1.5 Homozygous. Outer Left Sequence: acacacccagaagaccatcc. Outer Right Sequence: tgagcattccttttgggaac. Inner Left Sequence: tgcttttcccgttcaaactt. Inner Right Sequence: cagaatgcctgtttctccgt. Inner Primer PCR Length: 2208. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1296 |
C17H12.9(ok1395) IV. |
C. elegans |
C17H12.9 Homozygous. Outer Left Sequence: agttcctctgccgcttgtaa. Outer Right Sequence: aagttcggggaatttcgtct. Inner Left Sequence: gcaaccacgtagcttcacaa. Inner Right Sequence: ttggaaatggaatcacccat. Inner Primer PCR Length: 3028. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1297 |
rhy-1(ok1402) II. |
C. elegans |
W07A12.7 Homozygous. Outer Left Sequence: cgtcagcatacccagtgttg. Outer Right Sequence: tcaatggcattagcaactcg. Inner Left Sequence: ctccccgttacattttgcat. Inner Right Sequence: tgggtggcaaaagaaaacat. Inner Primer PCR Length: 2148. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1298 |
C25E10.11(ok1405) V. |
C. elegans |
C25E10.11 Homozygous. Outer Left Sequence: cttggtgagaccggagagag. Outer Right Sequence: tggcatgcaatgtcattttt. Inner Left Sequence: agccgaccggaatatttctt. Inner Right Sequence: actaattttcgaatgccccc. Inner Primer PCR Length: 2466. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1299 |
C24H12.9(ok1406) II. |
C. elegans |
C24H12.9 Homozygous. Outer Left Sequence: tcaattccttgtttttgggc. Outer Right Sequence: gtcttgctcgcctctttctg. Inner Left Sequence: gtgcctccaaattacgcact. Inner Right Sequence: atcatccgagatccatttgc. Inner Primer PCR Length: 2113. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1300 |
cdc-14(ok1407) II. |
C. elegans |
C17G10.4 Homozygous. Outer Left Sequence: cagtcgtggatgaacactcg. Outer Right Sequence: caccacaaatgactgttccg. Inner Left Sequence: gagacacttttctcggacgg. Inner Right Sequence: tgaatcgaaatcgtgaacca. Inner Primer PCR Length: 3306. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1301 |
unc-23(ok1408) V. |
C. elegans |
H14N18.1 Homozygous. Outer Left Sequence: tgaaagcaaacgagacatcg. Outer Right Sequence: accaccacctgatctcttgc. Inner Left Sequence: ttttctgtctcacggagcct. Inner Right Sequence: ccagaaaagggacaaccgta. Inner Primer PCR Length: 2756. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1302 |
Y2C2A.1(ok1409) IV. |
C. elegans |
Y2C2A.1 Homozygous. Outer Left Sequence: tcccatcattctccgaaaag. Outer Right Sequence: gaagaggtggtcgatcagga. Inner Left Sequence: ttgaatgcgtatcggatgaa. Inner Right Sequence: agctcgaggggttttctctc. Inner Primer PCR Length: 3007. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1303 |
D2096.12(ok1410) IV. |
C. elegans |
D2096.12 Homozygous. Outer Left Sequence: aaacgaggagggaaacctgt. Outer Right Sequence: ttcatatgcaaaaccggtca. Inner Left Sequence: gatgagaacgcaacaagcaa. Inner Right Sequence: gggcggcaattaaaaacata. Inner Primer PCR Length: 3247. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1304 |
wdr-5.1(ok1417) III. |
C. elegans |
C14B1.4 Homozygous. Outer Left Sequence: acgctgaagacgaggatgat. Outer Right Sequence: aatatcggcaattacgcagg. Inner Left Sequence: attgtgtgttcgctgtgcat. Inner Right Sequence: cgtatttgctctcggtcgat. Inner Primer PCR Length: 2239. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1305 |
egl-1(ok1418) V. |
C. elegans |
F23B12.9 Homozygous. Outer Left Sequence: caagtcaagacaaggcgaca. Outer Right Sequence: cttccgacactgtaagggga. Inner Left Sequence: ttgtgcctactcctgccttt. Inner Right Sequence: tcacagtcgtttcagcgaac. Inner Primer PCR Length: 2163. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1306 |
str-182(ok1419) V. |
C. elegans |
C12D8.1 Homozygous. Outer Left Sequence: aacatggctttttctggcac. Outer Right Sequence: aaagggaaaattgggcaaag. Inner Left Sequence: acggtgcaaacattggtaca. Inner Right Sequence: ttcgaccttgcttcgaaagt. Inner Primer PCR Length: 2264. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1307 |
F52D1.1(ok1423) X. |
C. elegans |
F52D1.1 Homozygous. Outer Left Sequence: tagcggtatgggcgatttac. Outer Right Sequence: ccggcaagtagattgagagc. Inner Left Sequence: cactgcgaccaaagtcttga. Inner Right Sequence: caatatcacgcaggttgtgg. Inner Primer PCR Length: 2819. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1308 |
rnp-3(ok1424) IV. |
C. elegans |
K08D10.3 Homozygous. Outer Left Sequence: cctttttggcgaatttttca. Outer Right Sequence: gacgctccgatattccgata. Inner Left Sequence: ttcaggttaaaatggccgac. Inner Right Sequence: ggtcttggcacgaatttgat. Inner Primer PCR Length: 2346. Estimated Deletion Size: about 1050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1309 |
C02C2.1(ok1425) III. |
C. elegans |
C02C2.1 Homozygous. Outer Left Sequence: cggcacactggcagttatta. Outer Right Sequence: cgtgcttgttccagatctca. Inner Left Sequence: cagacatggtccaaacatgc. Inner Right Sequence: gggaaggaaaacgacacgta. Inner Primer PCR Length: 2920. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1310 |
clc-2(ok1426) X. |
C. elegans |
C01C10.1 Homozygous. Outer Left Sequence: ctccggttgcatcagaaaat. Outer Right Sequence: cctgccaagctggtgttatt. Inner Left Sequence: tgttcaaatttttgctgcca. Inner Right Sequence: tttgtttgtcagcagtccgt. Inner Primer PCR Length: 2117. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1311 |
R05D11.8(ok1427) I. |
C. elegans |
R05D11.8 Homozygous. Outer Left Sequence: gctgcgtgaacatcaagaaa. Outer Right Sequence: attccaacgacttgccaaag. Inner Left Sequence: tttgaccatggcgaatgtta. Inner Right Sequence: tagagggatcgctggagaaa. Inner Primer PCR Length: 2546. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1312 |
C54E4.2(ok1428) IV. |
C. elegans |
C54E4.2 Homozygous. Outer Left Sequence: aaaatgcccacttgcgatac. Outer Right Sequence: gggggaaaactgtttccatt. Inner Left Sequence: aatgcgaatttctttggacg. Inner Right Sequence: aatgcaacaaaccaccaaca. Inner Primer PCR Length: 2878. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1313 |
C05C10.2(ok1429) II. |
C. elegans |
C05C10.2 Homozygous. Outer Left Sequence: gatgtcatgcgagagatgga. Outer Right Sequence: tggtggcagttgatgaatgt. Inner Left Sequence: gccaaattcgcaacaagaat. Inner Right Sequence: ccaaagcttgcattgttgaa. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1314 |
C05C10.2(ok1430) II. |
C. elegans |
C05C10.2 Homozygous. Outer Left Sequence: gatgtcatgcgagagatgga. Outer Right Sequence: tggtggcagttgatgaatgt. Inner Left Sequence: gccaaattcgcaacaagaat. Inner Right Sequence: ccaaagcttgcattgttgaa. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1315 |
C49G7.1(ok1431) V. |
C. elegans |
C49G7.1 Homozygous. Outer Left Sequence: cttatgggtttcaccacgct. Outer Right Sequence: cggctggaaaaagttaccaa. Inner Left Sequence: gcaaactcgaaagcagttcc. Inner Right Sequence: agtagcgggcaaaagactga. Inner Primer PCR Length: 2650. Deletion Size: 1045 bp. Deletion left flank: AAAAATGCAACGACCGACTTCAACGGCCACC. Deletion right flank: TTTGTACTGAACTTTCTTAACCAGGTACTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1316 |
unc-105(ok1432) II. |
C. elegans |
C41C4.5 Homozygous. Outer Left Sequence: gttatgacgaagagcgaggc. Outer Right Sequence: cgaagaccataattcgctcc. Inner Left Sequence: cgtttgagcacaccttcaaa. Inner Right Sequence: catctctccaactgcgaaca. Inner Primer PCR Length: 3052. Estimated Deletion Size: about 950 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1317 |
srp-3(ok1433) V. |
C. elegans |
Y32G9 Homozygous. Outer Left Sequence: ttcacctctttcaattgccc. Outer Right Sequence: gaaaatcgaaattcggcaaa. Inner Left Sequence: ctaagtggtgccactgacga. Inner Right Sequence: tatatcgacccgagccaaac. Inner Primer PCR Length: 2659. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1318 |
Y66D12A.5(ok1436) III. |
C. elegans |
Y66D12A.5 Homozygous. Outer Left Sequence: caagcttctcacaccgatca. Outer Right Sequence: gctacgcttcaagaaatccg. Inner Left Sequence: attgctcgaaaagctggaaa. Inner Right Sequence: cggacctcttcatcgtcatt. Inner Primer PCR Length: 2138. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1319 |
C34D4.14(ok1437) IV. |
C. elegans |
C34D4.14 Homozygous. Outer Left Sequence: ttttgcctcccttcttctga. Outer Right Sequence: atttcttcatcggcaccaac. Inner Left Sequence: attggtggtagcgtctttgg. Inner Right Sequence: ggatggagttcacacggagt. Inner Primer PCR Length: 3257. Estimated Deletion Size: about 1150 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1320 |
Y67D8A.3(ok1438) IV. |
C. elegans |
Y67D8A.3 Homozygous. Outer Left Sequence: aatttgtgcaaacaccgtca. Outer Right Sequence: gacaacctttgcgctttttc. Inner Left Sequence: ttttgtcaacaaattcggca. Inner Right Sequence: gccactctacttttcgccac. Inner Primer PCR Length: 2198. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1321 |
C56G3.1(ok1439) X. |
C. elegans |
C56G3.1 Homozygous. Outer Left Sequence: atagaaaggcaaccgggatt. Outer Right Sequence: cggtaagaaagcggaaatga. Inner Left Sequence: gtttgctctttttggtggga. Inner Right Sequence: catcgtccaatacaatgcga. Inner Primer PCR Length: 2408. Deletion Size: 838 bp deletion with a 1 bp insertion. Sequence across breakpoint from Neline Kriek: tggattggtgataatggctgtagtattgattattaataaccatattccaggaa. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1322 |
F33H2.6(ok1440) I. |
C. elegans |
F33H2.6 Homozygous. Outer Left Sequence: acggtgctagattcggaaaa. Outer Right Sequence: tgttcgaaaaaggttttggc. Inner Left Sequence: agatccggaatttcaccaga. Inner Right Sequence: cgggatttttcaccatctgt. Inner Primer PCR Length: 2165. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1323 |
C06G1.5(ok1441) X. |
C. elegans |
C06G1.5 Homozygous. Outer Left Sequence: gcatagcaccgtgaatgaga. Outer Right Sequence: gcgtaggatggattgaagga. Inner Left Sequence: ttcgtgaacatttggggaat. Inner Right Sequence: ctggcagtgcgaatcaacta. Inner Primer PCR Length: 3306. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1324 |
ssr-2(ok1375) X. |
C. elegans |
C14A11.7 Homozygous. Outer Left Sequence: ttctttcacccccttttcct. Outer Right Sequence: cgccttatttcagcttttgc. Inner Left Sequence: ttttgcaatcactctcgtcg. Inner Right Sequence: gcaaggaaggcattttggta. Inner Primer PCR Length: 2887. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1325 |
C53C7.1(ok1442) X. |
C. elegans |
C53C7.1 Homozygous. Outer Left Sequence: ggatcgtcttgtggtgcttt. Outer Right Sequence: ggggcctcttaacctttttg. Inner Left Sequence: ctggattgccctgaaattgt. Inner Right Sequence: gcagacaaagcatgacctga. Inner Primer PCR Length: 3020. 11/18/04: From Neline Kriek: This has a 788 bp deletion with a 13 bp insertion (TTCTTTTTTTTGA). The sequence across the breakpoint is: actacgacgtggtgtctttTTCTTTTTTTTGAtgacgtgagtttt. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1326 |
unc-129(ok1443) IV. |
C. elegans |
C53D6.2 Homozygous. Outer Left Sequence: agtcgtttctaccgcttcca. Outer Right Sequence: acctttgccggttcctctat. Inner Left Sequence: aacaaaacatcgggacgaag. Inner Right Sequence: tggtcaccgatatgggaact. Inner Primer PCR Length: 2891. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1327 |
K04G11.4(ok1444) X. |
C. elegans |
K04G11.4 Homozygous. Outer Left Sequence: aaccctccacttttgtcacg. Outer Right Sequence: gttaagggcagcaaccaaaa. Inner Left Sequence: tctggcagtgtgcaaatgat. Inner Right Sequence: ggggccttgagaccttatgt. Inner Primer PCR Length: 2137. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1328 |
dsh-1(ok1445) II. |
C. elegans |
C34F11.9. Homozygous. Outer Left Sequence: ATTCTTCCATCCAATGCCAC. Outer Right Sequence: AGTGCATCATGAGCCACAAG. Inner Left Sequence: TGCTCTAGAGGGTTTTCGGA. Inner Right Sequence: GAGAACGACACGATTGCTCA. Inner Primer PCR Length: 3156 bp. Deletion Size: 1132 bp. Deletion left flank: CGGATTCGGAGCCAATTGTTGATTCTTCGA. Deletion right flank: AATGGTGCCTCAGACTCCGGCTCCACACGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1329 |
C56G3.1(ok1446) X. |
C. elegans |
C56G3.1 Homozygous. Outer Left Sequence: atagaaaggcaaccgggatt. Outer Right Sequence: cggtaagaaagcggaaatga. Inner Left Sequence: gtttgctctttttggtggga. Inner Right Sequence: catcgtccaatacaatgcga. Inner Primer PCR Length: 2408. Estimated Deletion Size: about 779 bp. Sequence across the breakpoint: GGTATGTAGAACTTTTTTTTTGAA-breakpoint-AACAAAATGAGCAAAACTCGTGC . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1330 |
npr-1(ok1447) X. |
C. elegans |
C39E6.6 Homozygous. Outer Left Sequence: tcagcaaaattcccgatttc. Outer Right Sequence: gaacctgttagtgggccaag. Inner Left Sequence: gatcaattcttccggctcag. Inner Right Sequence: ggccaaatggaagttgaaaa. Inner Primer PCR Length: 2687. 11/24/04: From Neline Kriek: ok1447 is a 1263 bp deletion with a 1 bp insertion (T). The sequence is: gtatcagcattttcgtatgcacTacgttttgagaagtttcatt. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1331 |
end-3(ok1448) V. |
C. elegans |
F58E10.5 Homozygous. Outer Left Sequence: cgggaatagcggtaatttga. Outer Right Sequence: gtgatgtgcgtggctgtaac. Inner Left Sequence: cactctcgcacgtgaaaaac. Inner Right Sequence: caatgcctgtcttttgagca. Inner Primer PCR Length: 2119. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1332 |
trx-1(ok1449) II. |
C. elegans |
B0228.5 Homozygous. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1333 |
hrpr-1(ok1278) I/ ? hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) ?. |
C. elegans |
F58D5.1 Heterozygous. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP ok1278 homozygotes (larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: (04/2019) RB1333 was originally described as a homozygous strain carrying an unknown GFP transgene in the background. It was recently reported by a user that the strain is heterozygous for ok1278. Their characterization of the strain found that the deletion is balanced by a GFP-marked balancer, most likely hT2[qIs48], though the identity of the balancer has not been molecularly confirmed. Outer Left Sequence: tccaaatcctgaaaatccca. Outer Right Sequence: cagatcccagttttgcgaat. Inner Left Sequence: ttgtgtgtgcgtccaatttt. Inner Right Sequence: acattccaacggacgtcttc. Inner Primer PCR Length: 3310. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1334 |
C34D4.14(ok1450) IV. |
C. elegans |
C34D4.14 Homozygous. Outer Left Sequence: ttttgcctcccttcttctga. Outer Right Sequence: atttcttcatcggcaccaac. Inner Left Sequence: attggtggtagcgtctttgg. Inner Right Sequence: ggatggagttcacacggagt. Inner Primer PCR Length: 3257. Estimated Deletion Size: about 1550 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1335 |
T21C9.1(ok1451) V. |
C. elegans |
T21C9.1 Homozygous. Outer Left Sequence: aatattcccaccactcgcac. Outer Right Sequence: ccacggaatgtcttgaaggt. Inner Left Sequence: ccgagaagctgggagttcta. Inner Right Sequence: gaaaaagaaggttccggctc. Inner Primer PCR Length: 2126. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1336 |
C53A5.4(ok1452) V. |
C. elegans |
C53A5.4 Homozygous. Outer Left Sequence: cttgcactcattctcaccca. Outer Right Sequence: gacaggctcgaggtgaagtc. Inner Left Sequence: tccgtttttggttccagttc. Inner Right Sequence: ctttgaacacacgtagccga. Inner Primer PCR Length: 2366. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1337 |
hlh-26(ok1453) II. |
C. elegans |
C17C3.8 Homozygous. Outer Left Sequence: ccagttccgcctgtaacatt. Outer Right Sequence: ttgccacgactggatattga. Inner Left Sequence: actcacctctgcaactgcct. Inner Right Sequence: agtgtcacacgctgagatgg. Inner Primer PCR Length: 2179. Deletion Size: 983 bp. Additional information from Casonya Johnson 3/2005: the deletion is 983 bases, from base 2254 to 3237 on the cosmid C17C3. The gene C17C3.8 is on the opposite strand, and its coding region is from bases 3237 to 3616. The deletion occurs within the second exon of the gene, so that the first 105 amino acids of the protein are still made. This region contains one of the two HLH domains produced by this protein but eliminates the second one. The first stop codon would allow another 19 amino acids to be added to the peptide. I have pasted the sequence below (the red, underlined sequences are the new nucleotides). MSSSPTSSSS GSPSSHGHRS ETEKQRRDDT NDLLNEFKKI VQKSESEKLS KEEVLFRIVK LLSGIQLHHE SFSTSPGPIR SIKKIKSDRE QVRRNKRVAA YRELR tiknkhlehvfnffelki stop Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1338 |
C13G3.3(ok1467) V. |
C. elegans |
C13G3.3 Homozygous. Outer Left Sequence: gatgtgcaaagagtggggtt. Outer Right Sequence: ttggtttgttacgcctttcc. Inner Left Sequence: aaagtcgcatttggatttgc. Inner Right Sequence: tttccccaacttcacgaaac. Inner Primer PCR Length: 2336. Estimated Deletion Size: about 550 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1339 |
C01G5.6(ok1468) IV. |
C. elegans |
C01G5.6 Homozygous. Outer Left Sequence: caaacattttgcgtcggaat. Outer Right Sequence: tcggaatttcttgtccgttc. Inner Left Sequence: tccttgtcatcgttttgcac. Inner Right Sequence: tcagcttgaacattgctgct. Inner Primer PCR Length: 2131. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1340 |
nlp-1(ok1469) X. |
C. elegans |
C01C4.1 Homozygous. Outer Left Sequence: gaaacattgtgctccaccct. Outer Right Sequence: attcagaagcggaaagagca. Inner Left Sequence: gtgcgtacccagagcatttt. Inner Right Sequence: caattgtgtcctccccctaa. Inner Primer PCR Length: 2212. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1341 |
nlp-1(ok1470) X. |
C. elegans |
C01C4.1 Homozygous. Outer Left Sequence: gaaacattgtgctccaccct. Outer Right Sequence: attcagaagcggaaagagca. Inner Left Sequence: gtgcgtacccagagcatttt. Inner Right Sequence: caattgtgtcctccccctaa. Inner Primer PCR Length: 2212. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1342 |
ogt-1(ok1474) III. |
C. elegans |
K04G7.3 Homozygous. Outer Left Sequence: gccaaagaattgatttcgga. Outer Right Sequence: tgctcttgcaccacaaccta. Inner Left Sequence: acctgtccgagaccattctg. Inner Right Sequence: ccaacgctattgctcctctc. Inner Primer PCR Length: 2730. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1343 |
T06A10.4(ok1475) IV. |
C. elegans |
T06A10.4 Homozygous. Outer Left Sequence: ttctatgggcggagtttagc. Outer Right Sequence: aaaatgcaatttttccgtgc. Inner Left Sequence: gcgggaaatctttggttttt. Inner Right Sequence: ccgaattgtaagggcatgtt. Inner Primer PCR Length: 2193. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1344 |
zig-3(ok1476) X. |
C. elegans |
C14F5.2 Homozygous. Outer Left Sequence: tggttacccatctgcgtgta. Outer Right Sequence: gcatgttccttcatttccgt. Inner Left Sequence: ttcgcgcacattttgagtag. Inner Right Sequence: gacaagatcattggcgaggt. Inner Primer PCR Length: 2296. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1345 |
coq-4(ok1490) I. |
C. elegans |
T03F1.2. Homozygous. Outer Left Sequence: ATGAAGTTGTCAAGGCCACC. Outer Right Sequence: CGTTTCAATGAGCCTGGAGT. Inner Left Sequence: ATTGGAGGAGGTGACACTGC. Inner Right Sequence: AGAGTTGAAGAGAATGCGGC. Inner Primer PCR Length: 2182 bp. Deletion Size: 1210 bp. Deletion left flank: AACACACGACTTCACCCACATCGCATTGGA. Deletion right flank: TTTAGCACGTGTCTCAGCTTCTGCCGCATT. Insertion Sequence: CG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1346 |
EEED8.16(ok1492) II. |
C. elegans |
vEEED8.16 Homozygous. Outer Left Sequence: acgcgaaagaaagcgaataa. Outer Right Sequence: cttgacacacctgccacatc. Inner Left Sequence: caattttctcgacgaggagg. Inner Right Sequence: tttcatgccagtctattgcg. Inner Primer PCR Length: 2911. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1347 |
set-2(ok1493) III. |
C. elegans |
C26E6.11 Homozygous. Outer Left Sequence: tggatgggtcaaatggtagc. Outer Right Sequence: attgtctgtgtggtgcgaag. Inner Left Sequence: tggcgagtttcacaagaatg. Inner Right Sequence: aattcgctggttcgaagttg. Inner Primer PCR Length: 2404 Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1348 |
M195.2(ok1503) II. |
C. elegans |
M195.2 Homozygous. Outer Left Sequence: acgaggtatctgccaacgac. Outer Right Sequence: ctccaagagccttatcaccg. Inner Left Sequence: tagactgatgcgaaatcccc. Inner Right Sequence: gtttctggcttcaatttcgg. Inner Primer PCR Length: 2246. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1349 |
F57H12.4(ok1504) IV. |
C. elegans |
F57H12.4 Homozygous. Outer Left Sequence: atttgccccctttgagactt. Outer Right Sequence: tgctttttccgaaattccat. Inner Left Sequence: tgccccctaagaacattgac. Inner Right Sequence: taacatgctgctggcatttc. Inner Primer PCR Length: 2957. Estimated Deletion Size: about 1300 bp. The breakpoint sequence from Neline Kriek is: atccatcaatgcatca - breakpoint - agcgcaatattcaag. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1350 |
trpl-5(ok1507) II. |
C. elegans |
T16A1.7 Homozygous. Outer Left Sequence: cccattttgtgaattctggg. Outer Right Sequence: ccggtttgccaattttctta. Inner Left Sequence: tcattttggccattttgtga. Inner Right Sequence: aaatgttcaattccggcaac. Inner Primer PCR Length: 3057. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1351 |
F28A12.1(ok1508) V. |
C. elegans |
F28A12.1 Homozygous. Outer Left Sequence: ctgtatgccggacgttcttt. Outer Right Sequence: ttcgcgaagacaacaatcag. Inner Left Sequence: atctgtcaagtttcccgtgg. Inner Right Sequence: ttgcttgggtttctgctttt. Inner Primer PCR Length: 2355. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1352 |
C32B5.7(ok1509) II. |
C. elegans |
C32B5.7 Homozygous. Outer Left Sequence: cggactggacaaaacaacct. Outer Right Sequence: aacttgaacgtcccaacagg. Inner Left Sequence: tgggaatctgcaattgttca. Inner Right Sequence: tctcagaaatacggctggct. Inner Primer PCR Length: 2221. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1353 |
spv-1(ok1498) II. |
C. elegans |
ZK669.1a Homozygous. Outer Left Sequence: atcggtgttggctctacgtc. Outer Right Sequence: aggagctcttccagacacca. Inner Left Sequence: gaaatcctcttctgcggttg. Inner Right Sequence: gagttatgccggtcgaacat. Inner Primer PCR Length: 2929. Estimated Deletion Size: about 1050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1354 |
trpl-5(ok1499) II. |
C. elegans |
T16A1.7 Homozygous. Outer Left Sequence: cccattttgtgaattctggg. Outer Right Sequence: ccggtttgccaattttctta. Inner Left Sequence: tcattttggccattttgtga. Inner Right Sequence: aaatgttcaattccggcaac. Inner Primer PCR Length: 3057. Estimated Deletion Size: about 2050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1355 |
T04C9.1a(ok1510) III. |
C. elegans |
T04C9.1a Homozygous. Outer Left Sequence: tcttcgcttgtccatatccc. Outer Right Sequence: gcgttttgcaaacaaaaaca. Inner Left Sequence: gactctgcgctcatcacaaa. Inner Right Sequence: ggtctccgtgagcatgattt. Inner Primer PCR Length: 3187. Estimated Deletion Size: about 2150 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1356 |
Y69H2.2(ok1522) V. |
C. elegans |
Y69H2.2 Homozygous. Outer Left Sequence: atgccgtgagctcaactttt. Outer Right Sequence: gatggcaaggaagacgttgt. Inner Left Sequence: gttttggcgtcatcgatttt. Inner Right Sequence: agagcacggacgacaagact. Inner Primer PCR Length: 3009. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1358 |
C06A8.3(ok1525) II. |
C. elegans |
C06A8.3 Homozygous. Outer Left Sequence: ctggtcaacttcagcgaaca. Outer Right Sequence: ttggcactcacatcagaagc. Inner Left Sequence: ggacatccctcatcagtcgt. Inner Right Sequence: gtcctttttcaaatccgcaa. Inner Primer PCR Length: 2211. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1359 |
B0024.9(ok1526) V. |
C. elegans |
B0024.9 Homozygous. Outer Left Sequence: tcaattgcaatactcgctgc. Outer Right Sequence: aaaaaggctctcgacgtgaa. Inner Left Sequence: gatatattccaggcggctca. Inner Right Sequence: gcaagaagaagacccagtcg. Inner Primer PCR Length: 2109. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1360 |
SSSD1.1(ok1527) X. |
C. elegans |
SSSD1.1 Homozygous. Outer Left Sequence: cgaatttcccatgtcagctt. Outer Right Sequence: cgtattcctggctcttcgag. Inner Left Sequence: ggcaagcatgaaaataggga. Inner Right Sequence: acacttgcgaagccaagaat. Inner Primer PCR Length: 2954. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1361 |
Y75B7AL.2(ok1528) V. |
C. elegans |
Y75B7AL.2 Homozygous. Outer Left Sequence: tatgccgttatgccgttatg. Outer Right Sequence: aagactcgagagcggatgaa. Inner Left Sequence: cttttaaagcaatttcgccg. Inner Right Sequence: tcacatgtcaagggatcgag. Inner Primer PCR Length: 2173. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1362 |
H22K11.4(ok1529) X. |
C. elegans |
H22K11.4 Homozygous. Outer Left Sequence: ttgggcttctattggaccac. Outer Right Sequence: atcaatcaaccccaccacat. Inner Left Sequence: ttccatcggaattccttcac. Inner Right Sequence: tcgaacgtcgaaatcattca. Inner Primer PCR Length: 2341. Estimated Deletion Size: about 1450 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1363 |
3R5.1(ok1530) III. |
C. elegans |
3R5.1 Homozygous. Outer Left Sequence: gacagcgaaacaattgagca. Outer Right Sequence: attattaaacgcgcgaccag. Inner Left Sequence: cgaaggaggatcgttgaaaa. Inner Right Sequence: attgtggaagatcactcggc. Inner Primer PCR Length: 2475. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1364 |
K09E2.4(ok1540) X. |
C. elegans |
K09E2.4 Homozygous. Outer Left Sequence: cactgaatcaaacagcaccg. Outer Right Sequence: cacacaaaacgggacttcct. Inner Left Sequence: tatccggccaaagaaacaac. Inner Right Sequence: ggaacgctccgatttgataa. Inner Primer PCR Length: 3027. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1365 |
npr-16(ok1541) X. |
C. elegans |
F56B6.5 Homozygous. Outer Left Sequence: acaaatcgcaattttccagc. Outer Right Sequence: acaagtccgcaaggtcacat. Inner Left Sequence: caagggtcttcacaatcggt. Inner Right Sequence: tttgatttctcatcgggagg. Inner Primer PCR Length: 3344. Estimated Deletion Size: about 1450 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1366 |
F14D12.5(ok1551) X. |
C. elegans |
F14D12.5 Homozygous. Outer Left Sequence: tttagttacgcgggtatggg. Outer Right Sequence: tgaaaaagttggcaatgcac. Inner Left Sequence: tcttttctggcggcatactt. Inner Right Sequence: ggacttacgatgggcgttta. Inner Primer PCR Length: 2705. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1367 |
Y73E7A.4(ok1552) I. |
C. elegans |
Y73E7A.4 Homozygous. Outer Left Sequence: ctcaatagagcgcgatttcc. Outer Right Sequence: gaggggcacggttaattttt. Inner Left Sequence: tcgccatagttttcgctttt. Inner Right Sequence: tttttgatgggtgggaatgt. Inner Primer PCR Length: 2695. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1368 |
K07H8.2(ok1553) IV. |
C. elegans |
K07H8.2 Homozygous. Outer Left Sequence: ttctcccctttcaggaggat. Outer Right Sequence: ttttcttggcccatcttgtc. Inner Left Sequence: ttttagatgaaaggtggcgg. Inner Right Sequence: gcggaaaatgcaaaatgtct. Inner Primer PCR Length: 2972. Estimated Deletion Size: about 2100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1369 |
F14D12.5(ok1554) X. |
C. elegans |
F14D12.5 Homozygous. Outer Left Sequence: tttagttacgcgggtatggg. Outer Right Sequence: tgaaaaagttggcaatgcac. Inner Left Sequence: tcttttctggcggcatactt. Inner Right Sequence: ggacttacgatgggcgttta. Inner Primer PCR Length: 2705. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1370 |
F01F1.4(ok1555) III. |
C. elegans |
F01F1.4 Homozygous. Outer Left Sequence: ctactgggcgaaagttcgag. Outer Right Sequence: caacgacgaaactgtgatcg. Inner Left Sequence: tttgggtcctggaaagaaaa. Inner Right Sequence: ttctagcacacggatgatgc. Inner Primer PCR Length: 2295. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1371 |
hil-3(ok1556) X. |
C. elegans |
F22F1.1 Homozygous. Outer Left Sequence: ccaagaaacgatcggactgt. Outer Right Sequence: attgtgtgttgcgttggaaa. Inner Left Sequence: cacgttggagaaacagacga. Inner Right Sequence: ttgggagggtgagaagacac. Inner Primer PCR Length: 2159. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1372 |
nlp-18(ok1557) II. |
C. elegans |
F33A8.2 Homozygous. Outer Left Sequence: agtggaatcggatgatcgac. Outer Right Sequence: cccaacaatccatgatttcc. Inner Left Sequence: gcaaagaaattaggcgaacg. Inner Right Sequence: aaagctcacggagccaagta. Inner Primer PCR Length: 2326. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1373 |
F47G4.3(ok1558) I. |
C. elegans |
F47G4.3 Homozygous. Outer Left Sequence: cccagttgttttggctgaat. Outer Right Sequence: acgttcggttcctgtttcac. Inner Left Sequence: ccctcttcaggattcttccc. Inner Right Sequence: tccgctagatccatttccag. Inner Primer PCR Length: 2578. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1374 |
ocr-3(ok1559) X. |
C. elegans |
T10B10.7 Homozygous. Outer Left Sequence: aaacgaaaggcgaagtagca. Outer Right Sequence: agagttccaccagcgagaaa. Inner Left Sequence: caactcctcagatgtcccgt. Inner Right Sequence: aatttttcactgtggggctg. Inner Primer PCR Length: 2338. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1375 |
C44H4.6(ok1560) X. |
C. elegans |
C44H4.6 Homozygous. Outer Left Sequence: catctgtttgcggactttga. Outer Right Sequence: ctctgtgcatgtttgcgttt. Inner Left Sequence: ctttgtcgccttcctcactc. Inner Right Sequence: caatggctaggatcccaaaa. Inner Primer PCR Length: 2778. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1377 |
acs-17(ok1562) X. |
C. elegans |
C46F4.2 Homozygous. Outer Left Sequence: ggtcgattcttcgatttcca. Outer Right Sequence: tggggagcataggtttttca. Inner Left Sequence: cctaaaacatatggccaccg. Inner Right Sequence: tgaacgcacggtatgtttgt. Inner Primer PCR Length: 3216. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1379 |
F11C7.1(ok1564) X. |
C. elegans |
F11C7.1 Homozygous. Outer Left Sequence: gcaaacgccaataactggat. Outer Right Sequence: atgtgaaagcctacgccaac. Inner Left Sequence: tgcctgatctctcattgtgc. Inner Right Sequence: atccaattcggtggactcag. Inner Primer PCR Length: 3214. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1380 |
C11D2.2(ok1565) IV. |
C. elegans |
C11D2.2 Homozygous. Outer Left Sequence: aggccgattgcattgataag. Outer Right Sequence: ggggcaattttcaacaaaaa. Inner Left Sequence: ggtttgatcgacttgttggg. Inner Right Sequence: cccgatccgtttattcttga. Inner Primer PCR Length:3169. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1381 |
F52B5.1(ok1566) I. |
C. elegans |
F52B5.1 Homozygous. Outer Left Sequence: agtggggaaggctttcaaat. Outer Right Sequence: ctattggccccaattgtcac. Inner Left Sequence: gacaaagaggcggagtgaag. Inner Right Sequence: ccgattctgggttcatgtct. Inner Primer PCR Length: 3124. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1382 |
C08G5.5(ok1567) II. |
C. elegans |
C08G5.5 Homozygous. Outer Left Sequence: attgggggattttccaagac. Outer Right Sequence: actagttttgggcatggtgc. Inner Left Sequence: ccgcgagcaaaatacctaaa. Inner Right Sequence: gctttaagcttcggctgttg. Inner Primer PCR Length: 2200. Estimated Deletion Size: about 750 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1383 |
C47E8.8(ok1568) V. |
C. elegans |
C47E8.8 Homozygous. Outer Left Sequence: cgtctggcaaaacttttcgt. Outer Right Sequence: atcattcgctcgagttctgg. Inner Left Sequence: aaaatcattccgatgatgcc. Inner Right Sequence: tcagcttcttcctggtcgat. Inner Primer PCR Length: 3215. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1389 |
F35D2.5(ok1578) II. |
C. elegans |
F35D2.5 Homozygous. Outer Left Sequence: gacgaagagttcgtggaagg. Outer Right Sequence: tcatttcctttttctgcgct. Inner Left Sequence: aataacgggtctgttggcac. Inner Right Sequence: aagcattcattgctcggact. Inner Primer PCR Length: 3332. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1390 |
Y75B8A.16(ok1579) III. |
C. elegans |
Y75B8A.16 Homozygous. Outer Left Sequence: aaggcaattgtcaatggagc. Outer Right Sequence: acaatagaagagacggcgga. Inner Left Sequence: aatgcaatgaggaaggcaag. Inner Right Sequence: taggacgctcgaaacgaagt. Inner Primer PCR Length: 3408. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1391 |
san-1(ok1580) I. |
C. elegans |
ZC328.4 Homozygous. Outer Left Sequence: cgcaaatttttgctgtcttg. Outer Right Sequence: tggattctgcatggatttca. Inner Left Sequence: ggcgtggagaaagctacaac. Inner Right Sequence: ttcagctgccaattgttttg. Inner Primer PCR Length: 2133. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1392 |
ZK1321.2(ok1581) II. |
C. elegans |
ZK1321.2 Homozygous. Outer Left Sequence: aactgctcccacatccattc. Outer Right Sequence: ccggaattccaaatcagaga. Inner Left Sequence: aaatgttgcctgtctccacc. Inner Right Sequence: ggggagaatcgatgacaaga. Inner Primer PCR Length: 3202. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1393 |
npr-5(ok1583) V. |
C. elegans |
Y58G8A.4 Homozygous. Outer Left Sequence: ccgggtttgctgtaggatta. Outer Right Sequence: atgaccgagagatgtctgcc. Inner Left Sequence: cagtccggaacgtttttgtt. Inner Right Sequence: ccctctcctcccctacactc. Inner Primer PCR Length: 2613. Deletion Size: about 784 bp. Sequence across the breakpoint: AGTTGGAGCCTCACTGCAAT-breakpoint-GTCTTTCGAGCACGTCGATGGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1394 |
ZK563.4(ok1584) X. |
C. elegans |
ZK563.4 Homozygous. Outer Left Sequence: tctgcgtgttctggtggtta. Outer Right Sequence: tgggggatgtcttcttaacg. Inner Left Sequence: aaaagcattttgccctgttg. Inner Right Sequence: tttacccatcccatttttcg. Inner Primer PCR Length: 2129. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1396 |
nlp-20(ok1591) IV. |
C. elegans |
F45E4.8 Homozygous. Outer Left Sequence: caacggggaggaagactgta. Outer Right Sequence: atgtcgtcctccagaaatgg. Inner Left Sequence: tgttgatttacgcgaagctg. Inner Right Sequence: tgtacaattggcagacccaa. Inner Primer PCR Length: 2482. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1397 |
F23B2.7(ok261) IV. |
C. elegans |
F23B2.7 Homozygous. Outer Left Sequence: atcggaagctgcaaactgat. Outer Right Sequence: ccttcgatttttccgattca. Inner Left Sequence: tacatgtcgtgcatggttcc. Inner Right Sequence: cgccagaatatccttttcca. Inner Primer PCR Length: 1915. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1400 |
tre-3(ok394) V. |
C. elegans |
W05E10.4 Homozygous. Outer Left Sequence: ccttatcttgcatttcggga. Outer Right Sequence: cttcttcttttgcggtttcg. Inner Left Sequence: gactccatccatttgggaaa. Inner Right Sequence: cattcctagaacctccctgg. Inner Primer PCR Length: 2813. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1402 |
far-4(ok317) V. |
C. elegans |
F15B9.2 Homozygous. Outer Left Sequence: acggagaagaaccaagcaga. Outer Right Sequence: ttcaaacgtgtgatgaggga. Inner Left Sequence: ggcggttcaattcttccata. Inner Right Sequence: agagtggtggcattacctcg. Inner Primer PCR Length: 3041. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1403 |
Y18D10A.10(ok1596) I. |
C. elegans |
Y18D10A.10 Homozygous. Outer Left Sequence: gtttgatgcgggaagttgtt. Outer Right Sequence: tctcgttaggaattggtggc. Inner Left Sequence: aatcccattagcaatctgcg. Inner Right Sequence: cttgaaaacgggggaaaaat. Inner Primer PCR Length: 2308. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1404 |
lec-1(ok1597) II. |
C. elegans |
W09H1.6a Homozygous. Outer Left Sequence: tttcaggaaccaccgaaaag. Outer Right Sequence: gtagcaaacaaaatgcgggt. Inner Left Sequence: cgaagagccaaagtcctacg. Inner Right Sequence: ggagcatcgttgtttcgttt. Inner Primer PCR Length: 3198. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1405 |
Y59H11AL.1(ok1598) IV. |
C. elegans |
Y59H11AL.1 Homozygous. Outer Left Sequence: tggaacacttccccaaactc. Outer Right Sequence: tgatacgggaaaagctacgc. Inner Left Sequence: ggaagcagtttgctctccag. Inner Right Sequence: aattggcagagttgtttcgg. Inner Primer PCR Length: 3299. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1406 |
npp-11(ok1599) I. |
C. elegans |
F53F10.5 Homozygous. Outer Left Sequence: ttttaggccatcattttcgc. Outer Right Sequence: cgacgagttgttcgttttca. Inner Left Sequence: ctgctaccacaacagcctca. Inner Right Sequence: tgtggtcatccttcagcttg. Inner Primer PCR Length: 3168. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1409 |
R07B1.3(ok1606) X. |
C. elegans |
R07B1.3. Homozygous. Outer Left Sequence: TGCAATTGATCACTGGGAAA. Outer Right Sequence: TACCCCAGCTTAAGGCATTG. Inner Left Sequence: GCTTTTTGGCCAATTTTCAA. Inner Right Sequence: ACTGACACCGTTCCCTTGAC. Inner Primer PCR Length: 3169 bp. Deletion Size: 1278 bp. Deletion left flank: CACTATAGCGAAGTAGATAATGATGCGGGA. Deletion right flank: CTTTCACTAGTTCATTTATTGAAAACTGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1410 |
Y45F10B.8(ok1607) IV. |
C. elegans |
Y45F10B.8 Homozygous. Outer Left Sequence: cgaaaagcttgcattcacaa. Outer Right Sequence: aggagacccaggaaaccact. Inner Left Sequence: aatcacacctggtctggagg. Inner Right Sequence: gtctcgatgcgtcttgatga. Inner Primer PCR Length: 2233. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1412 |
ifp-1(ok1609) X. |
C. elegans |
C43C3.1. Homozygous. Outer Left Sequence: TAATTGAATCGGGGCAAGTG. Outer Right Sequence: AGCCGGCACGAACTACTAAA. Inner Left Sequence: GATGGTCTGCATCTCCGATT. Inner Right Sequence: AGAAGCCGAACAACTTTGGA. Inner Primer PCR Length: 3216 bp. Deletion Size: 1135 bp. Deletion left flank: CAGTTCTGGACGACGAGGAATCTCTCACAG. Deletion right flank: ATGTACCTACTGAATATATTTCAACAATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1413 |
Y51F10.2(ok1610) I. |
C. elegans |
Y51F10.2. Homozygous. Outer Left Sequence: CTTCAGAGCCGTAGGTCAGG. Outer Right Sequence: ACGTTGCACCATGTTCAAAA. Inner Left Sequence: AAAACTGGCGGTATTGATGC. Inner Right Sequence: TTCTGATCCTCCCCCTTCTT. Inner Primer PCR Length: 2508 bp. Deletion Size: 1161 bp. Deletion left flank: CAATTTGCACAAAGTGCAACGCGATTTTCG. Deletion right flank: AATTTTGAGTATAAAATATAATTATCTTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1414 |
twk-9(ok1611) IV. |
C. elegans |
ZK1251.8 Homozygous. Outer Left Sequence: aagtgcagcttccacattcc. Outer Right Sequence: atacaacaggcggtgtaggc. Inner Left Sequence: ctgacggctttgctcttttc. Inner Right Sequence: attgttgagccgattggaac. Inner Primer PCR Length: 3116. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1415 |
C09H5.2(ok1612) V. |
C. elegans |
C09H5.2. Homozygous. Outer Left Sequence: GCGTCGAGAAGTGATGTCAA. Outer Right Sequence: GCCATTCCGTGAACAAAGAT. Inner Left Sequence: TGCACATTGCTCAACTCTCC. Inner Right Sequence: AAGACTTGTTGCTCGGCATT. Inner Primer PCR Length: 3115 bp. Deletion Size: 1027 bp. Deletion left flank: GACGCTCCACTTAAAGATATTTTAAGTGTG. Deletion right flank: TTGCTATGGGTCTTGCCGGAAGTGATGTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1416 |
nhr-83(ok1613) V. |
C. elegans |
F48G7.3. Homozygous. Outer Left Sequence: GCAAATGAGCATCAAGTCCA. Outer Right Sequence: TTTTTCTTTCAGCTCCCGAA. Inner Left Sequence: GGCTTTGTCGATCAGATGGT. Inner Right Sequence: ATCATTTTCGTCAAGCGGTC. Inner Primer PCR Length: 3189 bp. Deletion Size: 773 bp. Deletion left flank: GCAAGCATCCTCGGGCGGCCTGAACTAATT. Deletion right flank: TTTTTAAATTCAGATTTCTCCTTGCCGGGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1417 |
cul-6(ok1614) IV. |
C. elegans |
K08E7.7. Homozygous. Outer Left Sequence: TGTTCGTTTTCTGATCGACG. Outer Right Sequence: TGGAAATCAGGCCTTTCAAC. Inner Left Sequence: AATGAGCAATGTGTGGGTGA. Inner Right Sequence: AAAAACCTTCAACCAGGGGT. Inner Primer PCR Length: 3040 bp. Deletion Size: 1059 bp. Deletion left flank: TGGCCATGCACCAGTTGTTTGAAGAATAAC. Deletion right flank: TCCAAAAGACGTTCAAACTCGCTATGCAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1419 |
srw-140(ok1616) V. |
C. elegans |
C03A7.3. Homozygous. Outer Left Sequence: CTGGCACTGTTGCTGACATT. Outer Right Sequence: GGCAATTTTGCCGAATAAAA. Inner Left Sequence: GTCTGGCATTCGTTTGGAAT. Inner Right Sequence: TCGCATAGAGAATCACGCTG. Inner Primer PCR Length: 2118 bp. Deletion Size: 654 bp. Deletion left flank: TTTATTTCAGAGCTTATTACAACACAGTAT. Deletion right flank: CCTATTTTCACACTTTTTCTTGTGTCAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1421 |
ZC116.3(ok1618) V. |
C. elegans |
ZC116.3. Homozygous. Outer Left Sequence: TCCCAAAATTGGTGTCCATT. Outer Right Sequence: GAGCATGTCTCGGAACACAA. Inner Left Sequence: ACCCTTCGGCATATCTTCCT. Inner Right Sequence: TGCGAAAGGATATGGGAAAC. Inner Primer PCR Length: 3155 bp. Deletion Size: 1502 bp. Deletion left flank: GATTCAATTTTAAATAACGTAAGAGAGTAA. Deletion right flank: TCGATTCTCTGAACTTGTGGAAACACACAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1422 |
cpx-2(ok1619) X. |
C. elegans |
K03A11. Homozygous. Outer Left Sequence: ACAACGCCAAATTCGGTTAG. Outer Right Sequence: TGGTCTAGAGCAAATGCGTG. Inner Left Sequence: TCTATGCTTTGCAAATCCCC. Inner Right Sequence: TCATGTGCTCTACGCGTTTC. Inner Primer PCR Length: 2374 bp. Deletion Size: 773 bp. Deletion left flank: TCTTCTATGCTTGTCCTTGCGACGCTTCTC. Deletion right flank: GTGGACATTGGGAACAAAGCTTCAGTATTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1423 |
C49A9.7(ok1620) IV. |
C. elegans |
C49A9.7. Homozygous. Outer Left Sequence: GACAACGTGTCCCCTACCAC. Outer Right Sequence: CCCCCATGCTTAGAAAGTCA. Inner Left Sequence: GACGAAATGGATCTGCGATT. Inner Right Sequence: AGGTACCGTATTTTTGGGGC. Inner Primer PCR Length: 2963 bp. Deletion Size: 737 bp. Deletion left flank: ACACGGGATTCTCATGGTCTTATAATTATT. Deletion right flank: TTCCAGCATTTCTTGCGTCAAAGGTATGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1424 |
Y37A1C.1a(ok1621) IV. |
C. elegans |
Y37A1C.1a Homozygous. Outer Left Sequence: cgccggatttccactaagta. Outer Right Sequence: gtgacgcttgtgacgagaaa. Inner Left Sequence: aaagtgacgagagccgagaa. Inner Right Sequence: ggcttcacgtgctaaaggag. Inner Primer PCR Length: 3196. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1426 |
brd-1(ok1623) III. |
C. elegans |
K04C2.4. Homozygous. Outer Left Sequence: CGAGCCACTGTGAAACTGAA. Outer Right Sequence: AAAAACCGAGGGGAGACTTG. Inner Left Sequence: GATTCGGATTGCTCGGATAA. Inner Right Sequence: CTCGGATCATCTTGCAAACA. Inner Primer PCR Length: 3161 bp. Deletion Size: 1031 bp. Deletion left flank: AGTTTCAGCGAATTTCTTTCTGATTATCAT. Deletion right flank: TCAAAAAAAAAAGTCAAGCCACCTAGGGGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1427 |
C55B7.6(ok1624) I. |
C. elegans |
C55B7.6 Homozygous. Outer Left Sequence: cacgtggtactggcagaaaa. Outer Right Sequence: cgggtacaccagccaatagt. Inner Left Sequence: aaacacggaacttgccaaac. Inner Right Sequence: caaatgtccgttcacacctg. Inner Primer PCR Length: 2950. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1431 |
mps-2(ok1631) II. |
C. elegans |
K01A2.8. Homozygous. Outer Left Sequence: AAACTCCTCATTGGACACGG. Outer Right Sequence: ACATGAAGGTACCACCGAGC. Inner Left Sequence: TGGATGTTGCACGGAAAATA. Inner Right Sequence: CGCAGGTTCCAAAATTGTTT. Inner Primer PCR Length: 2892 bp. Deletion Size: 1297 bp. Deletion left flank: AATGGTGAAAAGTTTTATTTGGGGTAGCAC. Deletion right flank: TCAGATTCCCAAAAAGAAAAATAACAGATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1432 |
sel-10(ok1632) V. |
C. elegans |
F55B12.3. Homozygous. Outer Left Sequence: CAGTGACCATCGAACACCTG. Outer Right Sequence: TACGAGATCCGACTGCACAC. Inner Left Sequence: ATCAAGTGAACAAACGTGCG. Inner Right Sequence: AATACAGCCACCATTGCCTC. Inner Primer PCR Length: 3118 bp. Deletion Size: 901 bp. Deletion left flank: ATGGATGATGGATCGATGACACCGGAGGAC. Deletion right flank: TTAGTATTATCTTTTCAGAGACCGAGTTAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1433 |
rab-37(ok1633) X. |
C. elegans |
W01H2.3 Homozygous. Outer Left Sequence: ctgcctctcccattcttttg. Outer Right Sequence: actcgattcgctttcctcag. Inner Left Sequence: acaaaaatagcgttcgcgtc. Inner Right Sequence: cgccagtctcttttgctctc. Inner Primer PCR Length: 3317. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1434 |
mmcm-1(ok1637) III. |
C. elegans |
ZK1058.1 Homozygous. Diminished ablility to incorporate C14 labled propionate into protein (data provided by Randy Chandler). Outer Left Sequence: cgcgaaaattaacgagaagc. Outer Right Sequence: cagccaattttctgtgggtt. Inner Left Sequence: cggtcttcccaatttcttga. Inner Right Sequence: ttcccaaaatttcgttgctc. Inner Primer PCR Length: 3097. Deletion size: 990 bp. Left flank: TAGTCTCAAAATCAGATATACACAAAAATC. Right flank: ATGGCAAGTACTGGAACGACAGCTCCGTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1435 |
F13G3.5(ok1638) I. |
C. elegans |
F13G3.5 Homozygous. Outer Left Sequence: ggctcgaaatcgacatgagt. Outer Right Sequence: ttcacaatctggagtgctgg. Inner Left Sequence: cagataaatcgcgtccgagt. Inner Right Sequence: attgaacgaaaaggctggaa. Inner Primer PCR Length: 2192. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1436 |
sulp-1(ok1639) I. |
C. elegans |
C55B7.6. Homozygous. Outer Left Sequence: CACGTGGTACTGGCAGAAAA. Outer Right Sequence: CGGGTACACCAGCCAATAGT. Inner Left Sequence: AAACACGGAACTTGCCAAAC. Inner Right Sequence: CAAATGTCCGTTCACACCTG. Inner Primer PCR Length: 2950 bp. Deletion Size: 1004 bp. Deletion left flank: ATTTTTTATTCCTCTACATGGGATGCGGTT. Deletion right flank: ACCCTTCTTCAGCAAAAATAATATTTTTTT. Insertion Sequence: CCTCTACATGGGAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1438 |
ketn-1(ok1641) V. |
C. elegans |
F54E2.3 Homozygous. Outer Left Sequence: atacgctcccatgaaactgg. Outer Right Sequence: caagatgacggtgtaaggca. Inner Left Sequence: gattgcgtttccgaactcat. Inner Right Sequence: aactgtgggcatactggagg. Inner Primer PCR Length: 3177. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1439 |
F54B3.1(ok1642) II. |
C. elegans |
F54B3.1 Homozygous. Outer Left Sequence: tcctccacccctaacaatca. Outer Right Sequence: tcagcagacgacatttttgc. Inner Left Sequence: ctccacctccaccttcacat. Inner Right Sequence: tcaaatccgcaaaaatgaca. Inner Primer PCR Length: 3119. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1440 |
F54B3.1(ok1643) II. |
C. elegans |
F54B3.1 Homozygous. Outer Left Sequence: tcctccacccctaacaatca. Outer Right Sequence: tcagcagacgacatttttgc. Inner Left Sequence: ctccacctccaccttcacat. Inner Right Sequence: tcaaatccgcaaaaatgaca. Inner Primer PCR Length: 3119. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1442 |
T26C11.3(ok1645) X. |
C. elegans |
T26C11.3 Homozygous. Outer Left Sequence: aaaatcgaaccacggtcttg. Outer Right Sequence: tctctgcgacaaatgtctgg. Inner Left Sequence: agggcacggaaatgtgatag. Inner Right Sequence: tactccctgtgtccctttgc. Inner Primer PCR Length: 2921. Deletion size: 905 bp. Left flank: AGGGGAAAAAGGGAAAAAACGGCTGAAATT. Right flank: TTTTTCCATTTCTAAACTCGCGTAGTTGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1443 |
K02G10.3(ok1646) X. |
C. elegans |
K02G10.3. Homozygous. Outer Left Sequence: TCGTGTGCTTGTTCACATCA. Outer Right Sequence: AGGTTCAACAACAGCGTTCC. Inner Left Sequence: CGCTCTTTCAAAACTGGCTC. Inner Right Sequence: CGTCGTGATTGCGTAAAGAA. Inner Primer PCR Length: 3123 bp. Deletion Size: 1139 bp. Deletion left flank: ACAAAATGTCATTATTATGAATAAATTGCC. Deletion right flank: AGAATTATCCAAATCGGTCAACTTCTCTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1444 |
ifp-1(ok1647) X. |
C. elegans |
C43C3.1 Homozygous. Outer Left Sequence: taattgaatcggggcaagtg. Outer Right Sequence: agccggcacgaactactaaa. Inner Left Sequence: gatggtctgcatctccgatt. Inner Right Sequence: agaagccgaacaactttgga. Inner Primer PCR Length: 3216. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1445 |
Y71G12B.11(ok1648) I. |
C. elegans |
Y71G12B.11 Homozygous. Outer Left Sequence: tgaagtggtggctcttgttg. Outer Right Sequence: aagttccgtttgttggttgc. Inner Left Sequence: tggtttctaaggggttgcag. Inner Right Sequence: gcgcttctctcaatttgtcc. Inner Primer PCR Length: 3151. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1447 |
chd-3(ok1651) X. |
C. elegans |
T14G8.1. Homozygous. Outer Left Sequence: TCTCGGATAGGACGAACCAG. Outer Right Sequence: GGGCTGCACTAGTCGTTGAT. Inner Left Sequence: GTTCATCATCAGGCGACAAA. Inner Right Sequence: TACCGTGTGCTTCTCACTGG. Inner Primer PCR Length: 3222 bp. Deletion Size: 1081 bp. Deletion left flank: AGTACGCCTTGAACACTTTTTCCGATTTGT. Deletion right flank: AACTGATGTGATTCTTTCTTCAACTGATCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1449 |
T22H2.2(ok245) I. |
C. elegans |
T22H2.2 Homozygous. Outer Left Sequence: tgaaccttgtatgcgctcag. Outer Right Sequence: cagatgggttactcgccaat. Inner Left Sequence: gcgagaagcacgctaaaact. Inner Right Sequence: attgcagttctcggtttcca. Inner Primer PCR Length: 3023. Estimated Deletion Size: about 2700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1450 |
csp-3(ok1653) I. |
C. elegans |
Y47H9C.6. Homozygous. Outer Left Sequence: GGAATCGGAATTGGAACTCA. Outer Right Sequence: CTTCATCGCCACTCACTCAA. Inner Left Sequence: TAATTTCAGCCAATTTGCCC. Inner Right Sequence: CAAACGCCACTGGATTCTCT. Inner Primer PCR Length: 2153 bp. Deletion Size: 1249 bp. Deletion left flank: TCTTTTGAGAGAGCCAATAAGTTTTATTTT. Deletion right flank: TCCGCTTGCGACGACGAGGTTTGGTGTGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1452 |
F56G4.5(ok1654) I. |
C. elegans |
F56G4.5 Homozygous. Outer Left Sequence: atcatgcctaggtttggacg. Outer Right Sequence: attaagagcggcaagcagaa. Inner Left Sequence: aaaaatttctgggtcccacc. Inner Right Sequence: gaaacaattggcccattcac. Inner Primer PCR Length: 3230. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1453 |
rbg-1(ok1660) X. |
C. elegans |
F20D1.6 Homozygous. Outer Left Sequence: gcagcaaacacagcttggta. Outer Right Sequence: ttgcatcaagtggaccttca. Inner Left Sequence: gcagtgccaaaccttcattt. Inner Right Sequence: gtccgctgcttttgtttctc. Inner Primer PCR Length: 3087. Deletion ize: 1077 bp. Left flank: ATCAGTAAAAATTTATGTTCAGAATGATGT. Right flank: CATTCAGATTTTGATATCAACTATTCTTCG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1454 |
K04G2.7(ok1661) I. |
C. elegans |
K04G2.7 Homozygous. Outer Left Sequence: ttatggtcgagccgtttacc. Outer Right Sequence: tgcgatagcaatggacagag. Inner Left Sequence: ctccgtcccattccagtaaa. Inner Right Sequence: gaatggatgaggcgtgagat. Inner Primer PCR Length: 2190. Deletion size: 1825 bp. Left flank: ATGTTTAGATTATCCTATTGGTAAATATAT. Right flank: AGAAGATGTAGAAGTCCTCACCGGATTCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1455 |
Y39G10AR.3(ok1662) I. |
C. elegans |
Y39G10AR.3 Homozygous. Outer Left Sequence: aaaaaggtaaccgaggtggc. Outer Right Sequence: tcataggctggaggtggttc. Inner Left Sequence: agtcgtcgatttctcggttg. Inner Right Sequence: atttgattgcggtgaccttc. Inner Primer PCR Length: 3341. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1456 |
T26C11.4(ok1663) X. |
C. elegans |
T26C11.4. Homozygous. Outer Left Sequence: CCAGACATTTGTCGCAGAGA. Outer Right Sequence: AATTCAAAGTTCCGCCAAGA. Inner Left Sequence: AGTATTGGCACGGACGAATC. Inner Right Sequence: CAGATGGACATCAGCCATTG. Inner Primer PCR Length: 3154 bp. Deletion Size: 870 bp. Deletion left flank: CATCGATGTTTGAGTGTTCTGAAAATGTGA. Deletion right flank: TCCTCCATTATAGCCGTCTGAATCCACATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1457 |
R06F6.2(ok1664) II. |
C. elegans |
R06F6.2 Homozygous. Outer Left Sequence: gtcatgggcctcgttaggta. Outer Right Sequence: ccacaaattccatttttgcc. Inner Left Sequence: caaatttacgactttgccgc. Inner Right Sequence: gattcaaattcccgcaaaaa. Inner Primer PCR Length: 3189. Deletion size: 1927 bp. Left flank: CGTCCTCATTCTTTTTATTAATAAATCGAT. Right flank: TGTCCAGTACTTTCATCAAAAGTCCAACAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1458 |
rsr-1(ok1665) I. |
C. elegans |
F28D9.1 Homozygous. Outer Left Sequence: aaaaagcagggaattgcaga. Outer Right Sequence: cgctgcgtttttattggttt. Inner Left Sequence: cttcttatgcttcttggcgg. Inner Right Sequence: atgaagtttgagccgcagtt. Inner Primer PCR Length: 2889. Deletion size: 698 bp. Left flank: ACTGCCAATTTGCTGCAAAAAATTCAAAAA. Right flank: TTCAAATTCTTATCATCAATCTGTGATAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1459 |
F49E10.2(ok1666) X. |
C. elegans |
F49E10.2. Homozygous. Outer Left Sequence: AAGCATGGGATGGAGACAAG. Outer Right Sequence: AGAGCGCGAACGTACAAGAT. Inner Left Sequence: GACGGTTATTTCCTCTGCCA. Inner Right Sequence: CCAGCACAACTCATTCGAGA. Inner Primer PCR Length: 3209 bp. Deletion Size: 783 bp. Deletion left flank: AAAACCCAACACGAGGTGTGAATCTTCAAA. Deletion right flank: TTTAGAATTCCGCGCAGAGCCAACATTAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1460 |
F45E1.7(ok1667) X. |
C. elegans |
F45E1.7 Homozygous. Outer Left Sequence: tacaccatcccaacgaatca. Outer Right Sequence: ttatgcacttcgatgcctca. Inner Left Sequence: ttttgccgagtctggagttt. Inner Right Sequence: caggattctgggaagttgga. Inner Primer PCR Length: 3331. Estimated Deletion Size: about 2600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1461 |
smvt-1(ok1674) X. |
C. elegans |
F52H2.4 Homozygous. Outer Left Sequence: tctgcatgacgattgaaagc. Outer Right Sequence: ccgaaaattgcttcccatta. Inner Left Sequence: agcactgaccaagctccaat. Inner Right Sequence: gccgcaattgctcattttat. Inner Primer PCR Length: 3170. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1462 |
F37C4.6(ok1675) IV. |
C. elegans |
F37C4.6 Homozygous. Outer Left Sequence: ttcgtacttgctgtgttggc. Outer Right Sequence: tttgctcttgccgacttttt. Inner Left Sequence: ggtcaccgcaactaaatcgt. Inner Right Sequence: ggcggacacaatggtcttac. Inner Primer PCR Length: 2946. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1463 |
C18E3.6(ok1676) I. |
C. elegans |
C18E3.6 Homozygous. Outer Left Sequence: acagtcaacgtggagcaatg. Outer Right Sequence: cgtcataaactgctctggca. Inner Left Sequence: tcgcttcttggacaattcct. Inner Right Sequence: ccgtgtactcatcgtctcca. Inner Primer PCR Length: 3031. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1466 |
rbg-1(ok1694) X. |
C. elegans |
F20D1.6 Homozygous. Outer Left Sequence: gcagcaaacacagcttggta. Outer Right Sequence: ttgcatcaagtggaccttca. Inner Left Sequence: gcagtgccaaaccttcattt. Inner Right Sequence: gtccgctgcttttgtttctc. Inner Primer PCR Length: 3087. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1467 |
chtl-1(ok1695) X. |
C. elegans |
F35C8.7 Homozygous. Outer Left Sequence: atatgcacagggatgggtgt. Outer Right Sequence: ttcggagttcagacgatgtg. Inner Left Sequence: gggggatgtcatttttgttg. Inner Right Sequence: attttagcaagcgcccctat. Inner Primer PCR Length: 3191. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1468 |
T25E12.4(ok1704) V. |
C. elegans |
T25E12.4 Homozygous. Outer Left Sequence: gcggaaagatcgttcatgtt. Outer Right Sequence: tcaggagcagcagggttaat. Inner Left Sequence: cttcaggttccccacacatt. Inner Right Sequence: cggctccattgttatgcttt. Inner Primer PCR Length: 3330. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1470 |
cul-5(ok1706) V. |
C. elegans |
ZK856.1 Homozygous. Outer Left Sequence: gacgaagaatggagcaaagc. Outer Right Sequence: atggtggttagaggccaatg. Inner Left Sequence: gtagatgacgggcctttgaa. Inner Right Sequence: ttcgaccaactccattgtga. Inner Primer PCR Length: 2993. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1471 |
pct-1(ok1707) IV. |
C. elegans |
C07G1.3 Homozygous. Outer Left Sequence: tgcttgcttccaatgacttg. Outer Right Sequence: ggccattgtcagtacgtgtg. Inner Left Sequence: gaaagtcggaaccattgtgg. Inner Right Sequence: gtagtcggtgggcagaaatg. Inner Primer PCR Length: 3332. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1473 |
tli-1(ok1724) I. |
C. elegans |
F25H2.1 Homozygous. Outer Left Sequence: tccagcaagaccttcgaaac. Outer Right Sequence: tgctgaacgtcgtagacagg. Inner Left Sequence: gagccaacaccaagcagaat. Inner Right Sequence: ttacaggtgctcgttggaga. Inner Primer PCR Length: 2848. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1474 |
F19G12.3(ok1725) X. |
C. elegans |
F19G12.3 Homozygous. Outer Left Sequence: ccgagctccttcaaagtcac. Outer Right Sequence: gcctgcaactgcactaatca. Inner Left Sequence: gctcattttcataacgggga. Inner Right Sequence: agtgtaccctgcattttggc. Inner Primer PCR Length: 2138. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1475 |
cln-3.1(ok1726) V. |
C. elegans |
F07B10.1 Homozygous. Outer Left Sequence: catgtcaacgagctccagaa. Outer Right Sequence: ccatgtgctgctgctgtatt. Inner Left Sequence: cataggcaggagcccataaa. Inner Right Sequence: gataagccggtttgtcgtgt. Inner Primer PCR Length: 2662. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1476 |
T02C5.1(ok1727) X. |
C. elegans |
T02C5.1 [NOTE (06/12/2013): This strain has been reported not to carry the described mutation and is being examined by the originating laboratory.] Homozygous. Outer Left Sequence: tccctcgcaactcagaaaat. Outer Right Sequence: tggtgttttaccccgacatt. Inner Left Sequence: tcgctgagataagagcgtca. Inner Right Sequence: aaatgaaatggaaaatgcgg. Inner Primer PCR Length: 3310. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1477 |
C26E6.3(ok1728) III. |
C. elegans |
C26E6.3 Homozygous. Outer Left Sequence: aacaaactgcggtaccttcg. Outer Right Sequence: ggcgagacccattcaaataa. Inner Left Sequence: ggtaccatgtcggcacttct. Inner Right Sequence: tgtcaggacattcaatggga. Inner Primer PCR Length: 2990. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1478 |
F13B12.3(ok1729) IV. |
C. elegans |
F13B12.3 Homozygous. Outer Left Sequence: tgggctaaatgcgagtatcc. Outer Right Sequence: tcccacgagttagatgctca. Inner Left Sequence: tgaggaaattgttttcggga. Inner Right Sequence: ctcggtgaattggctcctac. Inner Primer PCR Length: 3098. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1479 |
F13B12.3(ok1730) IV. |
C. elegans |
F13B12.3 Homozygous. Outer Left Sequence: tgggctaaatgcgagtatcc. Outer Right Sequence: tcccacgagttagatgctca. Inner Left Sequence: tgaggaaattgttttcggga. Inner Right Sequence: ctcggtgaattggctcctac. Inner Primer PCR Length: 3098. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1480 |
T05F1.1(ok1731) I. |
C. elegans |
T05F1.1 Homozygous. Outer Left Sequence: cttcaagagtggccatttcc. Outer Right Sequence: cttcaagagtggccatttcc. Inner Left Sequence: tttaatgcgggaaagtgacc. Inner Right Sequence: catgcgtgtgcctttaactg. Inner Primer PCR Length: 2592. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1481 |
ubc-25(ok1732) I. |
C. elegans |
F25H2.8 Homozygous. Outer Left Sequence: ggtcgtgaatcgcaatcttt. Outer Right Sequence: ggtcttcgaggtgacagagc. Inner Left Sequence: aatcagaagaggatggcgtg. Inner Right Sequence: agagccgagacagctgagag. Inner Primer PCR Length: 2158. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1482 |
K11H3.1(ok1733) III. |
C. elegans |
K11H3.1 Homozygous. Outer Left Sequence: ttataccgaagacttgccgc. Outer Right Sequence: atcaacaatcgccacaatga. Inner Left Sequence: tttttgccaatccgaaagtc. Inner Right Sequence: gaattttgggcttttgtgga. Inner Primer PCR Length: 3255. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1483 |
ifa-4(ok1734) X. |
C. elegans |
K05B2.3 Homozygous. Outer Left Sequence: atgtttcactttggcggttc. Outer Right Sequence: agagcgaataccgaagctca. Inner Left Sequence: cgagagtaattccgggttca. Inner Right Sequence: tcgcaagatggagaaggact. Inner Primer PCR Length: 2608. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1484 |
ath-1(ok1735) I. |
C. elegans |
K04G2.5 Homozygous. Outer Left Sequence: gaagtacgaatgccggaaaa. Outer Right Sequence: cacccatattcccctttgtg. Inner Left Sequence: atcgaatggaggttggacag. Inner Right Sequence: ctgaatgcattgtttcccct. Inner Primer PCR Length: 2134. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1485 |
csp-2(ok1742) IV. |
C. elegans |
Y73B6BL.7. Homozygous. Outer Left Sequence: GCGACGAAGAATGTTCAGGT. Outer Right Sequence: TTATGTCTTGGTGCGTCTCG. Inner Left Sequence: AGATTGATCGGCTTTGCACT. Inner Right Sequence: AGATGCCGACGTCAATTTTC. Inner Primer PCR Length: 3112 bp. Deletion Size: 1722 bp. Deletion left flank: TTTCCAAATTCATAGGAAAAATACTCTGAA. Deletion right flank: TTGCAAATTCTTGAAAGTAAAGTCAACTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1487 |
asm-3(ok1744) IV. |
C. elegans |
W03G1.7 Homozygous. Outer Left Sequence: aagccagaattccgtgtttg. Outer Right Sequence: tcgtcctttctctcgcattt. Inner Left Sequence: cttgcactcctcctttccac. Inner Right Sequence: ggtgacagaatgcgaggaat. Inner Primer PCR Length: 3344. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1488 |
rcat-1(ok1745) IV. |
C. elegans |
R02D3.7 Homozygous. Outer Left Sequence: acccgttttcaacaaaacca. Outer Right Sequence: cagtggaattgatgacgtgg. Inner Left Sequence: ttcagccatcagcatacagc. Inner Right Sequence: tgacttttccgccatttttc. Inner Primer PCR Length: 2461. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1489 |
D1037.1(ok1746) I. |
C. elegans |
D1037.1. Homozygous. Outer Left Sequence: AAACGGAGCGTCGTTTGTATC. Outer Right Sequence: GACTGGGACTCAGAAATCGC. Inner Left Sequence: TGATGTGAAATCGTCGGAAA. Inner Right Sequence: GTGCTCGATGAGCATCAAAA. Inner Primer PCR Length: 3141 bp. Deletion Size: 1397 bp. Deletion left flank: AGCTTCAAAGACGACAAGAACGAGAGAAAC. Deletion right flank: AACGAACAGAAGCACAACGAAAAGTTTTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1490 |
F47A4.3(ok1747) X. |
C. elegans |
F47A4.3 Homozygous. Outer Left Sequence: gactggctcgagaagattcg. Outer Right Sequence: tgtagatccgcaaaatgcac. Inner Left Sequence: tgtttgtggctggaaattga. Inner Right Sequence: gtatcaacgtgcctttggct. Inner Primer PCR Length: 3357. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1491 |
smf-1(ok1748) X. |
C. elegans |
K11G12.4. Homozygous. Outer Left Sequence: TCGTGGTGTCAAAATAGCCA. Outer Right Sequence: GTGAAGATTGCCGGAAGAAC. Inner Left Sequence: TCAGTTTGGCACCACGTTAG. Inner Right Sequence: CGACAATCACCCACTGTTTG. Inner Primer PCR Length: 3158 bp. Deletion Size: 959 bp. Deletion left flank: ATTTTCAGATTGTAGGCGGATATCATTGTC. Deletion right flank: GACTCAAGTGTGAAATATTTGTTGGCCTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1492 |
hcp-2(ok1757) V. |
C. elegans |
T06E4.1 Homozygous. Outer Left Sequence: aactcgcattgagccagact. Outer Right Sequence: tgctcctcaagttccgctat. Inner Left Sequence: ttcctcagctcatgatgtcg. Inner Right Sequence: gcttcttctagagccgctga. Inner Primer PCR Length: 3382. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1493 |
F55F3.3(ok1758) X. |
C. elegans |
F55F3.3. Homozygous. Outer Left Sequence: GGAAATAAGGCGCTACGACA. Outer Right Sequence: AAGCAACACACAACGTCAGG. Inner Left Sequence: ATTGCAGTTGATGTGTGGGA. Inner Right Sequence: AGTACTCGGCAGGACAGGAA. Inner Primer PCR Length: 2609 bp. Deletion Size: 1366 bp. Deletion left flank: TGTTTCACATATGGCTCCCAGGATTTGGAG. Deletion right flank: ACAAAACTTACACCAAGAGGTTCCTGTCCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1494 |
R09B5.11(ok1759) V. |
C. elegans |
R09B5.11 Homozygous. Outer Left Sequence: ctgtcgcaagtcctgattga. Outer Right Sequence: gtttccggaacaaacttcca. Inner Left Sequence: gaacgagtgtttctgggacg. Inner Right Sequence: atgaggaaggcgtactggtg. Inner Primer PCR Length: 3113. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1496 |
plc-2(ok1761) V. |
C. elegans |
Y75B12B.6 Homozygous. Outer Left Sequence: cttaatgcgggctctcaaag. Outer Right Sequence: aagtggcggacatattacgg. Inner Left Sequence: agagcttgccgtgagcttag. Inner Right Sequence: gcaaatattggacgcttcgt. Inner Primer PCR Length: 3106. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1497 |
F44F1.1(ok1765) I. |
C. elegans |
F44F1.1 Homozygous. Outer Left Sequence: gttgagtcttttaccccgca. Outer Right Sequence: cattgattgcacggatgaag. Inner Left Sequence: caaaattgtctactgcgcca. Inner Right Sequence: cttcgcgacaatcctaggtc. Inner Primer PCR Length: 3063. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1498 |
hyl-2(ok1766) X. |
C. elegans |
K02G10.6 Homozygous. Outer Left Sequence: acgcagtttccaagcatttc. Outer Right Sequence: tccttttcctcctcggtttt. Inner Left Sequence: gggggagtgatggaagaaat. Inner Right Sequence: ttgcaaaccaattgcaagaa. Inner Primer PCR Length: 3075. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1499 |
cnt-2(ok1767) III. |
C. elegans |
Y39A1A.15 Homozygous. Outer Left Sequence: acgtggggttgtataccgaa. Outer Right Sequence: cggagaggtgaaatggttgt. Inner Left Sequence: tttttcgggttagggaaaca. Inner Right Sequence: gtaacccattccccgttttt. Inner Primer PCR Length: 2823. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1500 |
ulp-1(ok1768) III. |
C. elegans |
T10F2.3 Homozygous. Outer Left Sequence: ccacagtcactgccattttg. Outer Right Sequence: caaaaatgatctgcagccaa. Inner Left Sequence: tccaatgattcagcttccaa. Inner Right Sequence: ctccgcttctatcccattca. Inner Primer PCR Length: 3283. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1501 |
frm-8(ok1769) III. |
C. elegans |
H09G03.2 Homozygous. Outer Left Sequence: cgaatcctccgtatcagagc. Outer Right Sequence: gcgcaaggacgagtaggata. Inner Left Sequence: agccaccattttgaatttcg. Inner Right Sequence: aatttggaatcagctcacgg. Inner Primer PCR Length: 3038. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1502 |
Y58G8A.1(ok1770) V. |
C. elegans |
Y58G8A.1 Homozygous. Outer Left Sequence: ggtcccctgcttgaaaactt. Outer Right Sequence: aaaagacgcgacaagatgct. Inner Left Sequence: tgcaaatttgatggcacagt. Inner Right Sequence: cctctgcgatggaatgaaat. Inner Primer PCR Length: 3202. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1503 |
cpb-2(ok1772) II. |
C. elegans |
C30B5.3 Homozygous. Outer Left Sequence: aacagcaaaatgccaaatcc. Outer Right Sequence: aaaacgtctccgaacaccac. Inner Left Sequence: ggaattccagcactccattg. Inner Right Sequence: agatttcggtcgcttcaaga. Inner Primer PCR Length: 2117. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1504 |
R06B10.1(ok1773) III. |
C. elegans |
R06B10.1 Homozygous. Outer Left Sequence: cagtgaacaatgactggcgt. Outer Right Sequence: tcccgcattatcaatggaat. Inner Left Sequence: ctcgattgtgaattccggtt. Inner Right Sequence: tgagagggttggatggaaag. Inner Primer PCR Length: 3204. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1505 |
F53G12.3(ok1775) I. |
C. elegans |
F53G12.3. Homozygous. Outer Left Sequence: GAATGCTGGAAGGAGGTGAA. Outer Right Sequence: ATGGGAATGGTGACCCTGTA. Inner Left Sequence: AAACACCCGTTGGTGATGAT. Inner Right Sequence: GTCCATGGTCCAACTGCTTT. Inner Primer PCR Length: 3310 bp. Deletion Size: 1066 bp. Deletion left flank: AACAAGGTACTCCGAAAGGATCTCGCAGAA. Deletion right flank: TGCCAAAGTTCACTAGAAGAGCATATCACG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1506 |
R07E3.1(ok1776) X. |
C. elegans |
R07E3.1. Homozygous. Outer Left Sequence: AGATGTGGCGTGTAGGAACC. Outer Right Sequence: AAGTCCCCGCTCTTTGATTT. Inner Left Sequence: AGCTGAAACCCCAGTTGAGA. Inner Right Sequence: GCTTCGTCTCTTCATGACCC. Inner Primer PCR Length: 2102 bp. Deletion Size: 927 bp. Deletion left flank: AATTCACTAGCCAGTTAATGATAGAATCCT. Deletion right flank: AAAAGTACCAAGTGTCTTTTCTGTCTGTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1508 |
taf-7.1(ok1778) X. |
C. elegans |
F54F7.1. Homozygous. Outer Left Sequence: GTCAGCCGAATCAAAAGCTC. Outer Right Sequence: TTTCCTTCCTCTCCCGATTT. Inner Left Sequence: CCACTCTGTTGCCAATTTGA. Inner Right Sequence: GGACGAAGAGCGTCCAAATA. Inner Primer PCR Length: 2248 bp. Deletion Size: 1022 bp. Deletion left flank: TGAAACGGTTACAAAAAATTTCCTGCATTT. Deletion right flank: TCTAATTTGAACAGTTCGGTTATCCTCTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1509 |
clp-6(ok1779) IV. |
C. elegans |
Y77E11A.10. Homozygous. Outer Left Sequence: TGCTTTCTAGGCCCACTTGT. Outer Right Sequence: CCTTGTTGGGTCATTTCCAC. Inner Left Sequence: TCGAAATTTGGACCTTCTCG. Inner Right Sequence: ATTTTCCAGCCAACAACTCG. Inner Primer PCR Length: 3274 bp. Deletion Size: 2386 bp. Deletion left flank: TTTTTTTGGGACGAAAAAATTCGCAAAAAA. Deletion right flank: GGATCCTTGTCTAACATCGAATCGGCTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1511 |
F21D9.2(ok1802) V. |
C. elegans |
F21D9.2. Homozygous. Outer Left Sequence: tgcacggctgtttttgatac. Outer Right Sequence: gatcctgccttccaaatgaa. Inner Left Sequence: gcatgtcgcgaatacagaaa. Inner Right Sequence: tttggctgccttagcatttt. Inner Primer PCR Length: 2215. Deletion Size: 1629. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1512 |
Y57A10A.24(ok1803) II. |
C. elegans |
Y57A10A.24. Homozygous. Outer Left Sequence: aaaattccgcaccagtaacg. Outer Right Sequence: ccgtaaatttggcctgaaaa. Inner Left Sequence: gccgagggactgtaacaaga. Inner Right Sequence: aacaatcatccacgtcacca. Inner Primer PCR Length: 3356. Deletion Size: 1984. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1513 |
F28E10.4(ok1804) IV. |
C. elegans |
F28E10.4. Homozygous. Outer Left Sequence: agtggacttctccaggggtt. Outer Right Sequence: ttagcgagttatcggctcgt. Inner Left Sequence: aaaaatgagcattgttcccg. Inner Right Sequence: aatttgttttcggcaactgg. Inner Primer PCR Length: 2105. Deletion Size: 1016. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1514 |
Y71F9B.6(ok1810) I. |
C. elegans |
Y71F9B.6. Homozygous. Outer Left Sequence: gttctgccatttctcgcttc. Outer Right Sequence: ggtactcgacagcttcctgc. Inner Left Sequence: cgcctcgaaatcctcattta. Inner Right Sequence: atggaagccacaatgacaca. Inner Primer PCR Length: 2720. Deletion Size: 980. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1516 |
F45E6.3(ok1812) X. |
C. elegans |
F45E6.3. Homozygous. Outer Left Sequence: acgtcttgcaaaaatcgagg. Outer Right Sequence: cttgcacgtattgaactccg. Inner Left Sequence: acatttttggccgaacagag. Inner Right Sequence: atcaacacagggcacaaaca. Inner Primer PCR Length: 2930. Deletion Size: 2681. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1517 |
W01C8.3(ok1813) X. |
C. elegans |
W01C8.3 Homozygous. Outer Left Sequence: ttactaatgacggcgtgtgg. Outer Right Sequence: aatgatttccgagttgccag. Inner Left Sequence: cacacttggaattgtccgtg. Inner Right Sequence: agcgagtctgcaaaagaagc. Inner Primer PCR Length: 3338. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1518 |
F30H5.3(ok1814) III. |
C. elegans |
F30H5.3. Homozygous. Outer Left Sequence: ccgttgcgaacaaaaagaat. Outer Right Sequence: gttacccgtgcctgtgagat. Inner Left Sequence: tacttgtcacgacagacgcc. Inner Right Sequence: ccagaacacttgcgagaaca. Inner Primer PCR Length: 2995. Deletion Size: 1766. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1519 |
T01H10.8(ok1815) X. |
C. elegans |
T01H10.8. Homozygous. Outer Left Sequence: ggttccgacgcaaataaaaa. Outer Right Sequence: tcacgcaatctcatccaaaa. Inner Left Sequence: aatctccacgttttggttgg. Inner Right Sequence: agcaccgtcgtagctcagtt. Inner Primer PCR Length: 3120. Deletion Size: 884. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1520 |
F15E6.6(ok1816) IV. |
C. elegans |
F15E6.6. Homozygous. Outer Left Sequence: tcctctcacaacatgccaaa. Outer Right Sequence: tcagtagcaacccgtaaccc. Inner Left Sequence: agtgctgcagtcaacaatgg. Inner Right Sequence: aaaatccagaaaccgtggtg. Inner Primer PCR Length: 3224. Deletion Size: 950. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1521 |
Y95B8A.12(ok1820) I. |
C. elegans |
Y95B8A.12. Homozygous. Outer Left Sequence: ggacgatgtagtgctcggat. Outer Right Sequence: cgcgttggagacttctaagg. Inner Left Sequence: gcggaggaactggaattgta. Inner Right Sequence: ggaagttggtgggggataat. Inner Primer PCR Length: 2777. Deletion Size: 2252. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1522 |
F56H1.5(ok1821) I. |
C. elegans |
F56H1.5. Homozygous. Outer Left Sequence: cgcttcgagaccacgtattt. Outer Right Sequence: cggcaccgattaaaagagaa. Inner Left Sequence: aatttttcagctcatcgcgt. Inner Right Sequence: attttgttcctcccaggctt. Inner Primer PCR Length: 2659. Deletion Size: 1770. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1523 |
C24G7.1(ok1822) I. |
C. elegans |
C24G7.1 Homozygous. Outer Left Sequence: gcgtgagagagcatgtgaac. Outer Right Sequence: cttcaaattcccgttccaaa. Inner Left Sequence: cttgtttgccaatgcctttt. Inner Right Sequence: ttttccggtcgaattttcag. Inner Primer PCR Length: 3302. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1524 |
F55A3.7(ok1829) I. |
C. elegans |
F55A3.7. Homozygous. Outer Left Sequence: catccgctggatacggtact. Outer Right Sequence: ggttaaagggacatcggctt. Inner Left Sequence: gaaacttccgatgggtctca. Inner Right Sequence: ttgtggttttgcgttgttgt. Inner Primer PCR Length: 2891. Deletion Size: 1342. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1525 |
klo-2(ok1830) III. |
C. elegans |
E02H9.5. Homozygous. Outer Left Sequence: atattgtcgcttcgcctgtt. Outer Right Sequence: ctgttgttctccccctgtgt. Inner Left Sequence: gaaggtgccaaggatttgaa. Inner Right Sequence: ggcattttagtcccaaagca. Inner Primer PCR Length: 2708. Deletion Size: 1249. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1526 |
srd-44(ok1831) X. |
C. elegans |
F17A2.8. Homozygous. Outer Left Sequence: gtggacgactaccaatggct. Outer Right Sequence: tcagacatgggcgaatacaa. Inner Left Sequence: cttgatcagtcgctctcgtg. Inner Right Sequence: cgcaaccattttggagagac. Inner Primer PCR Length: 2335. Deletion Size: 2064. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1527 |
pnk-4(ok1832) X. |
C. elegans |
C42D8.3. Homozygous. Outer Left Sequence: ggaaggttctggatgtggag. Outer Right Sequence: aatgtagcattcagcggctt. Inner Left Sequence: cttgtcaacggaacctcgtt. Inner Right Sequence: aaggtttattaagggcccga. Inner Primer PCR Length: 3106. Deletion Size: 1034. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1528 |
ceh-28(ok1833) X. |
C. elegans |
K03A11.3. Homozygous. Outer Left Sequence: gattccaacgagccacaagt. Outer Right Sequence: taacacccgggagtctgttc. Inner Left Sequence: aagtgaagtgatccaaccgc. Inner Right Sequence: taggtatcgcctcccacaac. Inner Primer PCR Length: 2366. Deletion Size: 783. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1531 |
T23F11.2(ok1836) III. |
C. elegans |
T23F11.2. Homozygous. Outer Left Sequence: cacctttctgtaggcgcttc. Outer Right Sequence: ccgtgtgtggttctcctttt. Inner Left Sequence: tcaagaaacccgaccaagtc. Inner Right Sequence: tcctagatggatggacggac. Inner Primer PCR Length: 2160. Deletion Size: 1356. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1533 |
amx-3(ok1838) V. |
C. elegans |
F25C8.2. Homozygous. Outer Left Sequence: GCACCAACGGTTGTTTGATA. Outer Right Sequence: TCCAGACGTTTCCAGATTCC. Inner Left Sequence: TCCCCAGCAAAGCAAATAAC. Inner Right Sequence: AAATAATGCAAACGCGCTCT. Inner Primer PCR Length: 3228 bp. Deletion Size: 1581 bp. Deletion left flank: CCTTATTGTAATTTTTGCAAAATCCTTAAA. Deletion right flank: TGCAAAAGTTTGTCAGACAGTTTCTTAGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1536 |
dep-1(ok1844) II. |
C. elegans |
F44G4.8 Homozygous. Outer Left Sequence: ctccatgaattgaggggttg. Outer Right Sequence: aatttcgacaatgacgctcc. Inner Left Sequence: ggagtcacggaagagatgga. Inner Right Sequence: tcgaacaaagaaagcgaggt. Inner Primer PCR Length: 3098. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1538 |
cgp-1(ok1846) V. |
C. elegans |
Y38C9A.2 Homozygous. Outer Left Sequence: gtctgacgaaccgatccaat. Outer Right Sequence: tgaccagtttcgctattccc. Inner Left Sequence: tcgccttgtatcagttgcag. Inner Right Sequence: tttgtgtctgcgtcctcttg. Inner Primer PCR Length: 2721. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1539 |
T07A5.2(ok1847) III. |
C. elegans |
T07A5.2. Homozygous. Outer Left Sequence: CCTGGAAATACTCCACCGAA. Outer Right Sequence: TAGCCAGTTTTCTCACCGGA. Inner Left Sequence: CTTATCTCGGGTGGTGGTTG. Inner Right Sequence: TGCCTGAAAATTGACAAACG. Inner Primer PCR Length: 2220 bp. Deletion Size: 966 bp. Deletion left flank: AAGTTGTCTTCAAAAAAAATATGAAAAATG. Deletion right flank: AAAAGTCGGGAAATTTTGGCTTTGAAAAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1540 |
F14F3.2(ok1848) X. |
C. elegans |
F14F3.2 Homozygous. Outer Left Sequence: agcaaaaggaatgcgatgac. Outer Right Sequence: gttcccctatcatgccaaaa. Inner Left Sequence: ttctccgttgttttcccaag. Inner Right Sequence: acacgttccgaacctttcac. Inner Primer PCR Length: 3329. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1541 |
pab-2(ok1851) X. |
C. elegans |
F18H3.3. Homozygous. Outer Left Sequence: TTTGTTCTGAGCTTGGGCTT. Outer Right Sequence: AATTTTCATGCCCATTCCAA. Inner Left Sequence: GGCCGAACAAATTACCATGT. Inner Right Sequence: AAATGTGGGCGAAAGATGAG. Inner Primer PCR Length: 3336 bp. Deletion Size: 1835 bp. Deletion left flank: AGATTTTTAAATTTTTTTGGGGTTTTTTGT. Deletion right flank: CCTTTGCTGTTTCCTTCATCGTCGGTGGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1542 |
C31H1.6(ok1852) IV. |
C. elegans |
C31H1.6. Homozygous. Outer Left Sequence: CCAAAGTCTCCTGCCCATTA. Outer Right Sequence: ACATACCACCCGCTTTCTTG. Inner Left Sequence: TTCAAACAATGATACCCGCA. Inner Right Sequence: TTTTGAGGGAAATGCGAAAC. Inner Primer PCR Length: 2666 bp. Deletion Size: 1117 bp. Deletion left flank: TATCAAAGTTTTTTTTTAATGAACTCTATA. Deletion right flank: AAAAGTAGTTTGAAGGTTTAAATTTGATTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1543 |
C38D9.2(ok1853) V. |
C. elegans |
C38D9.2. Homozygous. Outer Left Sequence: TCCCAGGTGAGCAAAAATTC. Outer Right Sequence: TGGTTGTACAGTCCGCAAAA. Inner Left Sequence: GTGTTGTCGATTCAGCCCTT. Inner Right Sequence: GCTTCTTTTGGAGCCTCCTT. Inner Primer PCR Length: 3346 bp. Deletion Size: 801 bp. Deletion left flank: TCAGCTCGACCGCACCGTTGAGCATTACTC. Deletion right flank: TATCAAAATTCCTTTTTTTACCTAAAAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1545 |
tba-9(ok1858) X. |
C. elegans |
F40F4.5. Homozygous. Outer Left Sequence: TGTACCACGCGCTATAATGG. Outer Right Sequence: ACAGAAAACTGTGGAACGGG. Inner Left Sequence: CTATTGGAAGCGATTCGAGC. Inner Right Sequence: CCATGAGCGCGACAGTATTA. Inner Primer PCR Length: 3018 bp. Deletion Size: 1341 bp. Deletion left flank: AAAATGCGGGAGGTTAGACGCAGACTTTTC. Deletion right flank: TTTTTATTCCGTTTCAAAATGTGGTCTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1546 |
T13G4.3(ok1859) X. |
C. elegans |
T13G4.3. Homozygous. Outer Left Sequence: TCCGTAAAAAGCACTGACCC. Outer Right Sequence: TTCTTTCCACCAGCCAATTC. Inner Left Sequence: AAAATCCCAAGTGCAAGACG. Inner Right Sequence: CTTCCCGGAGACCTCTTACC. Inner Primer PCR Length: 3029 bp. Deletion Size: 2025 bp. Deletion left flank: AATGGAAAATTATCATCCGAGAACCGCGTT. Deletion right flank: CAGAGACCATTCAAATGTCTGAAGCAGCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1547 |
sta-2(ok1860) V. |
C. elegans |
F58E6.1. Homozygous. [NOTE (N. Pujol - 12/02/13): This strain reportedly contains an unidentified lethal mutation in the background. See IG1241 for a strain that has been outcrossed to remove this background mutation.] Outer Left Sequence: GCAAAACGAGTTTCTCGACC. Outer Right Sequence: TTGTGATTCCTGACCCCTTC. Inner Left Sequence: CTCTTCTGCATTCTCCCCAG. Inner Right Sequence: GCCAAATGATGTCTCCGATT. Inner Primer PCR Length: 3148 bp. Deletion Size: 864 bp. Deletion left flank: ATTGTTAAATGTGGTGAAGCAGAGAATCAT. Deletion right flank: GAAATGAAATTTCAAGCAATCATAGAAACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1548 |
F53C3.13(ok1861) II. |
C. elegans |
F53C3.13. Homozygous. Outer Left Sequence: TTCGGCAATTTCCAGCTAAC. Outer Right Sequence: AAAAGTCACCCGACAGATGC. Inner Left Sequence: CCGTAATCCACGAGGAGAGA. Inner Right Sequence: TACCGAACTATTCCGAACGC. Inner Primer PCR Length: 3292 bp. Deletion Size: 2238 bp. Deletion left flank: TGAAAAAAATTCCGAAAATTTTTTTTTTGA. Deletion right flank: GCCGATTTTTGGGCTTTTTAAGCTGAATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1549 |
klo-2(ok1862) III. |
C. elegans |
E02H9.5 Homozygous. Outer Left Sequence: atattgtcgcttcgcctgtt. Outer Right Sequence: ctgttgttctccccctgtgt. Inner Left Sequence: gaaggtgccaaggatttgaa. Inner Right Sequence: ggcattttagtcccaaagca. Inner Primer PCR Length: 2708. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1550 |
K08D12.2(ok1863) IV. |
C. elegans |
K08D12.2. Homozygous. Outer Left Sequence: AGTGGAATTTGTGGTCTCGC. Outer Right Sequence: AGAAGAGGGCTCGGAAAAAG. Inner Left Sequence: ATTTCGCTGCAAGACCTGTT. Inner Right Sequence: AGGTCGTTCTCGGACATCAC. Inner Primer PCR Length: 2681 bp. Deletion Size: 1137 bp. Deletion left flank: CCAGGACTCAACAATCCTGTACCTCTACCA. Deletion right flank: TCGAACTTCTTCACGCGATCTACAAGTCGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1551 |
F49H6.5(ok1864) V. |
C. elegans |
F49H6.5. Homozygous. Outer Left Sequence: TTGCTCGTTGCCATAAAGTG. Outer Right Sequence: TCGTCGCTGGAGAAGAGATT. Inner Left Sequence: CAGGAGTGTGCCAAGACTCA. Inner Right Sequence: GCAAGTTTTTCAGAGCGTCC. Inner Primer PCR Length: 2165 bp. Deletion Size: 761 bp. Deletion left flank: TATTGAACAGACGTTATCATTATTCGTCAT. Deletion right flank: TCGGAATGATCTTGTGCAGATTGTTGGTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1552 |
T08G5.15&T08G5.16(ok1870) V. |
C. elegans |
T08G5.2. Homozygous. Outer Left Sequence: AACGGATTTCGCATCGTAGT. Outer Right Sequence: GCCTGCGGTAAGAAACAGAG. Inner Left Sequence: ATTTTTGAAAGCAGCAACGC. Inner Right Sequence: TCAAATTCTTTGGAATCGCC. Inner Primer PCR Length: 3004 bp. Deletion Size: 860 bp. Deletion left flank: CATGATGGTTTTCATTGTCGTGTGTGGAGT. Deletion right flank: TTGAAACAAAAATGAGCAAGTATTAGAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1553 |
K02E10.1(ok1871) X. |
C. elegans |
K02E10.1. Homozygous. Outer Left Sequence: AATCATGCATATTGCTGCGA. Outer Right Sequence: TTAAATCAGACAAAGGCGGG. Inner Left Sequence: TGAGAACAGTTTTCGCATGG. Inner Right Sequence: ATACTGCCAGCCGTTATTCG. Inner Primer PCR Length: 3219 bp. Deletion Size: 1668 bp. Deletion left flank: GTACATTCAAATACGCATAGTAGTGTTGTA. Deletion right flank: AACGAGATGAATTGATCTGTGTAAAAATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1554 |
R186.7(ok1872) V. |
C. elegans |
R186.7. Homozygous. Outer Left Sequence: GCAGCGTGTTTGCGTACTTA. Outer Right Sequence: TCGCCATGTTCTATTCCCAT. Inner Left Sequence: CCAAAACATGGCGTTTTCTT. Inner Right Sequence: AGCTTCGCATTGACACACAG. Inner Primer PCR Length: 2124 bp. Deletion Size: 833 bp. Deletion left flank: AGACAAACTGAGGAGTATTGATGACAAAGT. Deletion right flank: CACATATTTTCTGGCAACCGGTCAAGCATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1555 |
T08G5.15(ok1883) V. |
C. elegans |
T08G5.15. Homozygous. Outer Left Sequence: AACGGATTTCGCATCGTAGT. Outer Right Sequence: GCCTGCGGTAAGAAACAGAG. Inner Left Sequence: ATTTTTGAAAGCAGCAACGC. Inner Right Sequence: TCAAATTCTTTGGAATCGCC. Inner Primer PCR Length: 3004 bp. Deletion Size: 1240 bp. Deletion left flank: AGGTTAATTATTTTCCGAAAACTCTGTAAC. Deletion right flank: CTACAAATCATCTTTTTATCGTCAAAAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1556 |
shw-3(ok1884) V. |
C. elegans |
R186.5. Homozygous. Outer Left Sequence: ACCGGAGCATGTTTTACCTG. Outer Right Sequence: AGTACCGAGCCTCCCAATCT. Inner Left Sequence: ACGAATGCCTCCCCTAGAAT. Inner Right Sequence: CCCTTCATTCTCTGCTCTGG. Inner Primer PCR Length: 3307 bp. Deletion Size: 1112 bp. Deletion left flank: AAACTTTAAAATGAAGCTTCAAAATTTCAA. Deletion right flank: TCACTTTGGAGTCGACTACGGTAGGAGGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1557 |
hum-5(ok1885) III. |
C. elegans |
T02C12.1. Homozygous. Outer Left Sequence: AGGGGATGGGAGAGGAAGTA. Outer Right Sequence: TCGAATTGGTGTTGAAGCAG. Inner Left Sequence: GGCATCAAACACACGAATTG. Inner Right Sequence: TGACCTTGTGGAAATCCCTC. Inner Primer PCR Length: 2991 bp. Deletion Size: 1523 bp. Deletion left flank: CGTCACAAGATAAAACTAATCTCCAAGCTA. Deletion right flank: GGCCAAGATATCTGACCTGAAAATAAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1558 |
E01A2.7(ok1886) I. |
C. elegans |
E01A2.7. Homozygous. Outer Left Sequence: CAACGATCCAACTCCATTCC. Outer Right Sequence: GGTTGTAAATGCTCTCGGCT. Inner Left Sequence: ACTCAGTTTGGGTGCGAAAG. Inner Right Sequence: TTGTTGGGTGTTTCCATTCA. Inner Primer PCR Length: 2347 bp. Deletion Size: 1265 bp. Deletion left flank: CATTCATTGTGATATTTTTAAGTGAACCGT. Deletion right flank: ATTGTTCAAAATCCAATGAGACAATCCGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1560 |
R02F2.2(ok1894) III. |
C. elegans |
R02F2.2. Homozygous. Outer Left Sequence: TTTTGCAGAGGAGCAAAGGT. Outer Right Sequence: CTTGTTAGGATGGTCTCGGC. Inner Left Sequence: ATATCATTGGCTCCCCTGTG. Inner Right Sequence: TTCAAATGCGTGCTTCTGTC. Inner Primer PCR Length: 3399 bp. Deletion Size: 1673 bp. Deletion left flank: CAAAAAACATACAATTGATGAAATGTGGCA. Deletion right flank: ATTTTGTTATGGAAGAAGAGGAGTCGGGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1562 |
D1086.4(ok1896) V. |
C. elegans |
D1086.4. Homozygous. Outer Left Sequence: TGACGTCAAACGTTTTCAGC. Outer Right Sequence: GATGACGTTCCGAGACCAAT. Inner Left Sequence: AGCAATCAGGTGCCATTTGT. Inner Right Sequence: AAGGCCCTGAGAGCGTTTAT. Inner Primer PCR Length: 2194 bp. Deletion Size: 518 bp. Deletion left flank: TAATTTTTTTTCAGCTGAAAAGTCTGTTAT. Deletion right flank: GTTTATTTTTGAGGAAAACAACTCTATAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1565 |
ZK1073.1(ok1899) X. |
C. elegans |
ZK1073.1 Homozygous. Outer Left Sequence: accgtgtggagatgagaagc. Outer Right Sequence: cacgcgtgactgtgactttt. Inner Left Sequence: caaaagtgcgtccactctga. Inner Right Sequence: taacttgcaaatggtggtcg. Inner Primer PCR Length: 3260. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1566 |
F09A5.2(ok1900) X. |
C. elegans |
F09A5.2. Homozygous. Outer Left Sequence: TGAATTCGCAGAGATCAACG. Outer Right Sequence: AGCACAAGTTCCTTGCGAGT. Inner Left Sequence: AAACAGCCCACCCCTATCTC. Inner Right Sequence: TCATAATCCCCGTCTTCGTC. Inner Primer PCR Length: 3232 bp. Deletion Size: 1135 bp. Deletion left flank: GCTATGTATACATTTTTGCTGAAGATTGTA. Deletion right flank: CGAGCAGAACCATTTGGATTTTTTCCATGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1567 |
gly-6(ok1912) III. |
C. elegans |
H38K22.5. Homozygous. Outer Left Sequence: CAGTGGTCCAAATTGCTTCC. Outer Right Sequence: TTCAAAAAGGCGCTGAAAAT. Inner Left Sequence: ATCGAAAATGTCCGGTGAAG. Inner Right Sequence: TCGTCGATCCAGAAGATGTG. Inner Primer PCR Length: 2814 bp. Deletion Size: 1281 bp. Deletion left flank: ATTCCAATTGAATCCACCTCGAAACATTTC. Deletion right flank: AACTCTTCTCTTACCATATCACTCAAAAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1568 |
cpg-1(ok1913) III. |
C. elegans |
C07G2.1. Homozygous. Outer Left Sequence: AACCTCGTAAATATCGCGCA. Outer Right Sequence: AGCGTGCTGGATACACCTCT. Inner Left Sequence: GCAGCGACCGTAGCTAATTT. Inner Right Sequence: ATGGCACTGGGATGAGTAGG. Inner Primer PCR Length: 2170 bp. Deletion Size: 766 bp. Deletion left flank: GAGACGACAACTGTTGCAGAGGATGTTCCA. Deletion right flank: CTGCAATCGAGCCATGCTCTCAACACTACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1569 |
cpg-1(ok1914) III. |
C. elegans |
C07G2.1. Homozygous. Outer Left Sequence: AACCTCGTAAATATCGCGCA. Outer Right Sequence: AGCGTGCTGGATACACCTCT. Inner Left Sequence: GCAGCGACCGTAGCTAATTT. Inner Right Sequence: ATGGCACTGGGATGAGTAGG. Inner Primer PCR Length: 2170 bp. Deletion Size: 722 bp. Deletion left flank: TGTGACTACGTTATGAATGTTCCAGAGTGC. Deletion right flank: CAACCACAACTATCGGTTACGCTCCAATTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1570 |
C18H9.8(ok1915) II. |
C. elegans |
C18H9.8. Homozygous. Outer Left Sequence: CTGCTGGTGTAGGACATGGA. Outer Right Sequence: ATCAATCAAAAAGATCGCCG. Inner Left Sequence: AAACACGCATCAACCACAAA. Inner Right Sequence: GGGTAAAACGACGGAAACAA. Inner Primer PCR Length: 3267 bp. Deletion Size: 1372 bp. Deletion left flank: ATTTGAATGGCGATATGTCGGATATTGAGT. Deletion right flank: CAATTGAGGATATGGAATTGGCGTTAAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1571 |
R08E3.4(ok1916) X. |
C. elegans |
R08E3.4. Homozygous. Outer Left Sequence: CTTGGGATGTTTTCTCCGAA. Outer Right Sequence: CGCTTCTATTGCGTTTCACA. Inner Left Sequence: AGTTATCGGAGGTGTCGGTG. Inner Right Sequence: AAACGAGCACAGCAGGTCTT. Inner Primer PCR Length: 3130 bp. Deletion Size: 1005 bp. Deletion left flank: AATTTACAATTTTCTCTGGTTTTCTCCTCG. Deletion right flank: TTTTAAAAATTGCTCACCTTCTGGCTGAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1572 |
mlh-1(ok1917) III. |
C. elegans |
T28A8.7. Homozygous. Outer Left Sequence: TTGGCACTGCTTGTAAAACG. Outer Right Sequence: CCGTAACCCAATACCCAACA. Inner Left Sequence: TATGTTCCACATCGCTCGAA. Inner Right Sequence: CAGTTGCTAGATGGGTGCAA. Inner Primer PCR Length: 3200 bp. Deletion Size: 1100 bp. Deletion left flank: ACGCCGATATTTTCTTATCGAGTGTGATGA. Deletion right flank: TTTTAAATTTTGGGATTCTAGGCCACCAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1573 |
dod-22(ok1918) IV. |
C. elegans |
F55G11.5. Homozygous. Outer Left Sequence: GGTCGAGCTCACACTTCTCC. Outer Right Sequence: AGCTGGTAAAAGCACTCCCA. Inner Left Sequence: GCTTTCCTGCGTCTTTTGAG. Inner Right Sequence: AAGGCAAGGCTGTATTCACG. Inner Primer PCR Length: 2425 bp. Deletion Size: 1426 bp. Deletion left flank: ATGGATCGGGATACATATTTTCAGACAATT. Deletion right flank: TGTGGTCAGTAGTGGAAAAGCTGATTTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1574 |
cut-6(ok1919) III. |
C. elegans |
M142.2. Homozygous. Outer Left Sequence: TAATTGGCAGCCCAAATGAT. Outer Right Sequence: CAAAAAGTATTTTCCCGCCA. Inner Left Sequence: AATCCTTATCTGCTCCGCAA. Inner Right Sequence: TGGGATAACCTGGCTCTACG. Inner Primer PCR Length: 3255 bp. Deletion Size: 1492 bp. Deletion left flank: TACGCATCCTATGAATGTTCCTACATTTAT. Deletion right flank: AAAACGGAAACACTAAAAACTTTGAAACTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1575 |
aly-1(ok1920) IV. |
C. elegans |
C01F6.5. Homozygous. Outer Left Sequence: ATCTGTTGAGTGCGCAGTTG. Outer Right Sequence: GCGGAAACGAAGAAAGAGTG. Inner Left Sequence: TCAAATGTGTACGGGTGTGG. Inner Right Sequence: AACGTTCGCATCCCTAATTG. Inner Primer PCR Length: 2337 bp. Deletion Size: 1447 bp. Deletion left flank: TCGATCTATATGCATTAATTCATTCTATCA. Deletion right flank: ATTTTACTTGTTTGTTCTCATGTTTTCATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1576 |
rgl-1(ok1921) X. |
C. elegans |
F28B4.2. Homozygous. Outer Left Sequence: GCAACGACGATTCTCCACTT. Outer Right Sequence: GTCGAACGGCTTGTGGTAAT. Inner Left Sequence: GTAGGGAAACAGCGAAGACG. Inner Right Sequence: CGCAACTTATCGTTCGTTCA. Inner Primer PCR Length: 2731 bp. Deletion Size: 680 bp. Deletion left flank: CACGCGCAGAACATTCGATCCATCGGGATA. Deletion right flank: CATCCCTGGCACTGGTGTATTAATAATTCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1577 |
ckb-2(ok1922) III. |
C. elegans |
B0285.9. Homozygous. Outer Left Sequence: GGATTCCGAGCAAGTTCTGT. Outer Right Sequence: CGAGCTTCTCGTGTTCTGTG. Inner Left Sequence: TGAATGTTTCGCGAGTTCAG. Inner Right Sequence: CATTCGACCTTCGGCTTAAT. Inner Primer PCR Length: 2161 bp. Deletion Size: 772 bp. Deletion left flank: TTTCGCAAAATAAATGTTTTCTTCTCAAAA. Deletion right flank: ATGATTTGCAACTAACATGTATACTTATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1578 |
nhr-69(ok1926) I. |
C. elegans |
T23H4.2. Homozygous. Outer Left Sequence: TGCTTTAACGGACGAGTTCA. Outer Right Sequence: ACACCCATCATACGCTCTCC. Inner Left Sequence: AAAGCACAAAAGAAATCCGC. Inner Right Sequence: TCTATGTTTTCCACCCTGGC. Inner Primer PCR Length: 2476 bp. Deletion Size: 1329 bp. Deletion left flank: GTCATTTTTTAAAAAAGAAAGTATGAAACA. Deletion right flank: GAATATATCGCATTTTTTGTTTTATTGGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1579 |
sptl-3(ok1927) V. |
C. elegans |
T22G5.5. Homozygous. Outer Left Sequence: TACTTTGCGCTTCTTACCCG. Outer Right Sequence: GCAGAATTGGTGGGAAATGT. Inner Left Sequence: CTTGGTGTCCCTTTCGTGTT. Inner Right Sequence: AGGGCAAGAATTGGGGTAAT. Inner Primer PCR Length: 3244 bp. Deletion Size: 1585 bp. Deletion left flank: GTATTTTGGCTTGTCCAATTGAATATTACA. Deletion right flank: GTTTTGAAAAATTACGAGCTTGTTCCAATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1580 |
T08D2.2(ok1933) X. |
C. elegans |
T08D2.2. Homozygous. Outer Left Sequence: ACTTGGCGCGTTAGATGACT. Outer Right Sequence: GCAAAAACGACGAAAAGAGC. Inner Left Sequence: ACCTTCATGGCTCGTCATTC. Inner Right Sequence: TAGCGTTTTCTGCCGATTTT. Inner Primer PCR Length: 2847 bp. Deletion Size: 2212 bp. Deletion left flank: ACACTTTCCGGCCCGAAAAATCTTAATTTT. Deletion right flank: TTTTGTACCAAAATTTGAGTTTTAATATAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1581 |
ife-5(ok1934) II. |
C. elegans |
Y57A10A.30 Homozygous. Outer Left Sequence: gtggggaccaaaatttgaga. Outer Right Sequence: tttgcgaaatcggaaaaatc. Inner Left Sequence: ccgataggcatccaaaaatg. Inner Right Sequence: tttcgagcgaattttaacgc. Inner Primer PCR Length: 2111. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1583 |
plk-2(ok1936) I. |
C. elegans |
Y71F9B.7 Homozygous. Outer Left Sequence: aacgaggtgaatcggatttg. Outer Right Sequence: ttttgtgtccttttcccgtc. Inner Left Sequence: cccgaatgtttgttcgttct. Inner Right Sequence: atttcttttcgccgtgtgac. Inner Primer PCR Length: 2714. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1584 |
K02B9.2(ok1937) X. |
C. elegans |
K02B9.2 Homozygous. Outer Left Sequence: tttttcccgcttacctctga. Outer Right Sequence: tctgcagttgttgcgaaatc. Inner Left Sequence: ggttcagatcatcttcggga. Inner Right Sequence: tcttcgaccaacatgcgtag. Inner Primer PCR Length: 2826. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1585 |
ser-7(ok1944) X. |
C. elegans |
C09B7.1. Homozygous. Outer Left Sequence: AGCGTTTCGCGTCATTAACT. Outer Right Sequence: GATCCACATGCCGAAAGACT. Inner Left Sequence: CCGAAAAGAAGTTCTCGCAG. Inner Right Sequence: GGCAAGAATGAAGAATGGGA. Inner Primer PCR Length: 3393 bp. Deletion Size: 1313 bp. Deletion left flank: TCAGAGTCATGAGGGTATGTAAGTTGACTT. Deletion right flank: ACAGATTCGGCAGACGGAGAAAAGTGAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1588 |
mxl-3(ok1947) X. |
C. elegans |
F46G10.6. Homozygous. Outer Left Sequence: CAGATTTGGCAAACCCACTT. Outer Right Sequence: TACAGTCCCCTAGGCCACAC. Inner Left Sequence: TTTCTCTTGCTGGGCAATTT. Inner Right Sequence: CTAAGTCAAGGCAGCCAAGG. Inner Primer PCR Length: 2270 bp. Deletion Size: 955 bp. Deletion left flank: CAAATCAGTGAGTAAAAAAAACTGAAATAA. Deletion right flank: CTTACATCGGAAGAATCCGAGTGATGGCGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1591 |
ddr-1(ok1956) X. |
C. elegans |
C25F6.4. Homozygous. Outer Left Sequence: CACAACAACCCCTGTCATCA. Outer Right Sequence: GTTTCTCACCGCATTTGGTT. Inner Left Sequence: AAGAACTGTGTGCATGCGAG. Inner Right Sequence: GTTGAGCATGATGTGATGGC. Inner Primer PCR Length: 3271 bp. Deletion Size: 1681 bp. Deletion left flank: AGATGGTCGCATCACGATATTGTTCGAGTT. Deletion right flank: GGTACACGAGCTCTGGGAGATGAGATAGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1592 |
nhr-64(ok1957) I. |
C. elegans |
C45E1.1. Homozygous. Outer Left Sequence: AAATTCGTGTCGAAAATGCC. Outer Right Sequence: GTGGACGGTGTGATCACTTG. Inner Left Sequence: GGGATAGAATTCGACCAGCA. Inner Right Sequence: ATCGTTGCATTTAAGGTGGC. Inner Primer PCR Length: 2771 bp. Deletion Size: 1348 bp. Deletion left flank: AATCACTACCTTATGAAGGTCGAATGAGCA. Deletion right flank: AAATCAATTTCGAACTCAGTTTTCAAATTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1593 |
klp-15(ok1958) I. |
C. elegans |
M01E11.6. Homozygous. Outer Left Sequence: CGTAACCAAATTCCGCTCAT. Outer Right Sequence: GTAATCCATTCGATTTGGCG. Inner Left Sequence: TGCCATTTTCGAATTCATCA. Inner Right Sequence: AGGGGCTGATTTCCTCATTT. Inner Primer PCR Length: 2341 bp. Deletion Size: 1283 bp. Deletion left flank: ATAACGTTATTTTACATGAAATGTTAGAAT. Deletion right flank: AGTGAAATCAGCTTGCGATCCGCTCCTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1596 |
F36F2.1(ok1961) I. |
C. elegans |
F36F2.1. Homozygous. Outer Left Sequence: CTATGGCGTCGTCGAAAAAT. Outer Right Sequence: TCCCTCTTATGCTCCCAATG. Inner Left Sequence: CATTTCCATCATCACCACCA. Inner Right Sequence: ATTAAGTCCGTTGCCAAGCA. Inner Primer PCR Length: 2175 bp. Deletion Size: 1205 bp. Deletion left flank: TATACTTTTGTTTTTTTTTAACAAAAAGAT. Deletion right flank: GATGATCATGTTATTATCACACTTTTACTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1598 |
F41H10.11(ok1963) IV. |
C. elegans |
F41H10.11 Dpy animals. Homozygous. Outer Left Sequence: ttcccgagattcagatgtcc. Outer Right Sequence: gttggtggacgaggaaaaag. Inner Left Sequence: acctggtggatcagaagctg. Inner Right Sequence: cgggtagaataaaccgacga. Inner Primer PCR Length: 2236. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1599 |
nac-2(ok1971) III. |
C. elegans |
R107.1 Homozygous. Outer Left Sequence: cacccctgtaggcctgatta. Outer Right Sequence: tacgcctggcttttgtaggt. Inner Left Sequence: tattaaggcatgcggtaggc. Inner Right Sequence: ccaaaaggaaatgaaaagcg. Inner Primer PCR Length: 2870. Deletion size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1600 |
tub-1(ok1972) II. |
C. elegans |
F10B5.4. Homozygous. Outer Left Sequence: ATGATGATGGGACGGAACAT. Outer Right Sequence: TTTTGACACACCACACGCTT. Inner Left Sequence: TGGGACAAGGAAAATCGAAC. Inner Right Sequence: CGGCTTGTTTCCAATCATTT. Inner Primer PCR Length: 2809 bp. Deletion Size: 1676 bp. Deletion left flank: AATTGCATTGAAACCTTTAAAAAGAGTTTC. Deletion right flank: ATGCTCACAGAAACCGATGAGTTATCAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1602 |
B0198.3(ok1974) X. |
C. elegans |
B0198.3. Homozygous. Outer Left Sequence: CGAACAACGCTATAGGAGCC. Outer Right Sequence: TTTAGTGAAACCCCCACGAG. Inner Left Sequence: CAGAAGAAGATGCCGAGTCC. Inner Right Sequence: ACAGCATCCCTTACATTGCC. Inner Primer PCR Length: 3350 bp. Deletion Size: 1810 bp. Deletion left flank: CAATATACCTCAAACACTTCATCACTCAAG. Deletion right flank: GGAATTCAAATATCAATAATGCTCTGAATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1603 |
klf-3(ok1975) II. |
C. elegans |
F54H5.4. Homozygous. Outer Left Sequence: CCGAAAGAGAGTGAAGACGG. Outer Right Sequence: TTTGTTGTTCCTCCAGGTCC. Inner Left Sequence: AAAGCAAAAATGACATCGCC. Inner Right Sequence: GCAAAAGAGGATGGGAATCA. Inner Primer PCR Length: 2642 bp. Deletion Size: 1658 bp. Deletion left flank: TAGAAATCCACCATATTATACGGAAGTGAC. Deletion right flank: TACATCAAGCGAGCGATCGCCACTGCAGCG. klf-3 was formerly known as mua-1. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1604 |
F08H9.4&srz-97(ok1976) V. |
C. elegans |
F08H9.4, F08H9.12. Homozygous. Outer Left Sequence: CGAGACTGCCACATAGGTCA. Outer Right Sequence: TCGTGAGAACTAATTCGGGG. Inner Left Sequence: TCTTGATCGCGAAATAACCC. Inner Right Sequence: GTTGAAGGCAAACCCACATT. Inner Primer PCR Length: 2255 bp. Deletion Size: 1342 bp. Deletion left flank: TATCCAAATGCGAAAGTTGGCAATGTTTAC. Deletion right flank: AAACGTACTCATGTAGATAAATGTGTTGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1605 |
cdh-5(ok1977) IV. |
C. elegans |
F08B4.2. Homozygous. Outer Left Sequence: TAGCAGCACGATATTGCCAG. Outer Right Sequence: CAAGAGCAACAGTTACCGCA. Inner Left Sequence: CAAGGCGTTTGGAGTGAAAT. Inner Right Sequence: AGGAATGGGAGATCGAACCT. Inner Primer PCR Length: 3244 bp. Deletion Size: 1695 bp. Deletion left flank: ATTGTATCCGACTGAAATTGCACCTGAAAA. Deletion right flank: CATCTGTGTCTGAAGCAGTCCGTCCTCCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1608 |
mlt-9(ok1980) X. |
C. elegans |
F09B12.1. Homozygous. Outer Left Sequence: ATTTCCATTCTCGGCTCCTT. Outer Right Sequence: CTCTCACACCGTCATCGAAA. Inner Left Sequence: GGCTGCTTCGATTTCTTCAG. Inner Right Sequence: CGAACCTTTTTGCATGTGTG. Inner Primer PCR Length: 2791 bp. Deletion Size: 1289 bp. Deletion left flank: TTCGTGCTCAAATTTCAAAATAAATGTGCA. Deletion right flank: GTGACATTAAACGTCTCTTGACGTGTTCCG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1610 |
ZK1307.8(ok1982) II. |
C. elegans |
ZK1307.8. Homozygous. Outer Left Sequence: ACACAAAGAAATTGGGGCTG. Outer Right Sequence: AAATTCAAAGAGTTCCCGCC. Inner Left Sequence: ATATCGGCATGAGACCCATC. Inner Right Sequence: TCATTCAAGCGAAACAAGGA. Inner Primer PCR Length: 2131 bp. Deletion Size: 1446 bp. Deletion left flank: ACTGACACCTTCCGATGCTTGGACGGATCC. Deletion right flank: TGACAAGGAAGTTGTTCACGAGGAACTTTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1611 |
lin-17(os160) I; pqe-1(ok1983) III. |
C. elegans |
lin-17(os160) identified and reported by Hitoshi Sawa (personal communication). Phenotype is Egl. Bivulva. Psa (Phasmid socket absent). F52C9.8. Homozygous. Outer Left Sequence: GAGCACAGCACAGATGAAGC. Outer Right Sequence: ATGGCATTTTCGCAAGAAAC. Inner Left Sequence: CCTTCTAACGCTTTACCCCC. Inner Right Sequence: GTCCAGTGGATCCGAGTTGT. Inner Primer PCR Length: 3247 bp. Deletion Size: 1330 bp. Deletion left flank: ACATACTGGAGCTGCTCTGCTTCTCGAATG. Deletion right flank: TGGCGCCGAATACGATTTTGATTAGCGCGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1612 |
tat-6(ok1984) V. |
C. elegans |
F02C9.3. Homozygous. Outer Left Sequence: GACGGAACACGAGTGGAGAT. Outer Right Sequence: CAAAGCTAGGCGGTGAAAAC. Inner Left Sequence: TGCAGATGTTGTGTTGCTGA. Inner Right Sequence: TGGTGATGAAGACCCATGAA. Inner Primer PCR Length: 3263 bp. Deletion Size: 1195 bp. Deletion left flank: AATGGACAGAAACCGTCGGTGTAAAACTTG. Deletion right flank: CGACAGCGTCCGACAGCGGGCGACAGCGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1613 |
cyp-35A5(ok1985) V. |
C. elegans |
K07C6.5. Homozygous. Outer Left Sequence: CTCGGCTTGAATAATGGGAA. Outer Right Sequence: AAACTACGCTTTGGCGAGAA. Inner Left Sequence: CCGCCCTTAAAAAGTTACCC. Inner Right Sequence: AAACAAATCCCACCGACAAA. Inner Primer PCR Length: 2497 bp. Deletion Size: 807 bp. Deletion left flank: ACTTGTGGCTGACTGGTCAAGAAACCACGA. Deletion right flank: TTTTAAACATATAGGTTTTTCGCATTTTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1615 |
glt-5(ok1987) II. |
C. elegans |
Y53C12A.2. Homozygous. Outer Left Sequence: TGAGAATTTGGGAACATCGG. Outer Right Sequence: ATCAATCGTTCCATGCATCA. Inner Left Sequence: ATTTGCTCAGAAAACGGGAA. Inner Right Sequence: ATTCAGCCATCATGGGAATC. Inner Primer PCR Length: 2194 bp. Deletion Size: 1158 bp. Deletion left flank: TCTTCTCAGCTTCTGCAACGTCAGCATTCA. Deletion right flank: TAGTTAGTTTGCACTTGAGAAAATGTTGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1618 |
hda-3(ok1991) I. |
C. elegans |
R06C1.1. Homozygous. Outer Left Sequence: CTATTTAAAGGCGCACAGCC. Outer Right Sequence: CCAGATGAGCCTCCAACACT. Inner Left Sequence: AATGGCCCAAAATCACAAAA. Inner Right Sequence: GCATCGTGTTCGAATGACAC. Inner Primer PCR Length: 3336 bp. Deletion Size: 2289 bp. Deletion left flank: GAATTTTTGCCGAAAACTGAGAAAATCTTC. Deletion right flank: AAAAATTCTGAAAATGCAAAATTTCAGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1619 |
ZC8.4(ok1992) X. |
C. elegans |
ZC8.4 Homozygous. Outer Left Sequence: tgagaaaaattcgtggaggc. Outer Right Sequence: attggcagatgattggaagc. Inner Left Sequence: aagaaattgcacgaaatggc. Inner Right Sequence: aagtgtggccaaacgttgtt. Inner Primer PCR Length: 3280. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1620 |
zhp-3(ok1993) I. |
C. elegans |
K02B12.8 Homozygous. Outer Left Sequence: tctttcagcactcttcgggt. Outer Right Sequence: taccaccgtatttcgaaggc. Inner Left Sequence: ttaaaacattaatcggcggg. Inner Right Sequence: acggtgacaatcacacgcta. Inner Primer PCR Length: 2125. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1621 |
K10C8.1(ok1994) V. |
C. elegans |
K10C8.1 Homozygous. Outer Left Sequence: cttcctcgagaagaccaacg. Outer Right Sequence: cttcatcgctcatgcacact. Inner Left Sequence: atcttggtggcttggttttg. Inner Right Sequence: agaaagcaccgcaaagaaaa. Inner Primer PCR Length: 1300. Deletion size: about 2958 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1622 |
ser-3(ok1995) I. |
C. elegans |
K02F2.6. Homozygous. Outer Left Sequence: CTAACTGCTCCGCCTCAAGT. Outer Right Sequence: AATTTGGCAGCCATTTTCAG. Inner Left Sequence: TGCGTGAATCACCATCACTT. Inner Right Sequence: TTAAACGGCCAATTTATCGC. Inner Primer PCR Length: 2855 bp. Deletion Size: 1230 bp. Deletion left flank: CGAACGGAAGAAAGATTATTTAATTGTAAA. Deletion right flank: TCGACTCACTTATACGGCTTGTTTGGCGTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1623 |
cdr-2(ok1996) V. |
C. elegans |
C54D10.1. Homozygous. Outer Left Sequence: GTTGGTGGCGTGAAGAATTT. Outer Right Sequence: ATTCCGCTGCAAAATTAACG. Inner Left Sequence: TGTCACTGGACAGCAACACA. Inner Right Sequence: AGCGTGTTCGCAAAGAGATT. Inner Primer PCR Length: 2727 bp. Deletion Size: 1109 bp. Deletion left flank: ATTTTGGAATACCAATGCTTCTGACAAGAA. Deletion right flank: AAAAAAAATCAAGAAGAGTTTACAAATTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1624 |
Y57G11C.20(ok1997) IV. |
C. elegans |
Y57G11C.20. Homozygous. Outer Left Sequence: ATACTCGAGCAGACTGGCGT. Outer Right Sequence: ATAATGTCACCAAGCCCAGC. Inner Left Sequence: AACCGTTTTACCCTGCACAC. Inner Right Sequence: AATCAACCCGGAAGACACTG. Inner Primer PCR Length: 2825 bp. Deletion Size: 1017 bp. Deletion left flank: TTCAGACTGATAAAGACGAACAGCGTGAGA. Deletion right flank: TTGATTTTTTAGATTCAAACATTTTATTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1626 |
F38B7.1(ok2002) V. |
C. elegans |
F38B7.1. Homozygous. Outer Left Sequence: TTCGGACCCATCTTCACTTC. Outer Right Sequence: ATTTCGATTGCTGCGTCTCT. Inner Left Sequence: CTTTTCAAACAAGCGCACAA. Inner Right Sequence: TCCCCAAAACAGCACTAACC. Inner Primer PCR Length: 2805 bp. Deletion Size: 1981 bp. Deletion left flank: AGTTTTTGATTGGGTTTTCACCTCCACTCA. Deletion right flank: AGATTCAATATTTTTTAAGTTCTGTGAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1627 |
pll-1(ok2003) III. |
C. elegans |
K10F12.3. Homozygous. Outer Left Sequence: AAAACACCAATCAGGTTCGC. Outer Right Sequence: TGACCGGATAGAATTCGGAG. Inner Left Sequence: CACATGGCAAATTTAGGGCT. Inner Right Sequence: TTCAAGCAGACCATCTGCAC. Inner Primer PCR Length: 3277 bp. Deletion Size: 1120 bp. Deletion left flank: CAATCTCATGACAGTCGACGGCTTCACATC. Deletion right flank: TACCAATATATGTAATAAAGGACGATAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1628 |
sulp-4(ok2004) V. |
C. elegans |
K12G11.1. Homozygous. Outer Left Sequence: CGGATAAACCATGCAAGACA. Outer Right Sequence: CATCACGCATTGTTGGGTAG. Inner Left Sequence: CCCCAATTTCTTAAGGCACA. Inner Right Sequence: TACCAGCTTAAAGCGGCAAT. Inner Primer PCR Length: 2943 bp. Deletion Size: 2119 bp. Deletion left flank: AACTTCCAGGCATGCCAGTTTAGGTATGTA. Deletion right flank: AACACTCATTCTCCTGATATTTTATCTCGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1629 |
R07E3.3(ok2005) X. |
C. elegans |
R07E3.3 Homozygous. Outer Left Sequence: agccagttgtctcccatttg. Outer Right Sequence: agaaccggacattgttgagc. Inner Left Sequence: tggcacctatacgaccatga. Inner Right Sequence: gggaaaatgtggagggaact. Inner Primer PCR Length: 2636. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1630 |
exoc-7(ok2006) I. |
C. elegans |
C43E11.8. Homozygous. Outer Left Sequence: AGAAGGCCATCTTGCTCATC. Outer Right Sequence: TCCAATGGCAAGTGATCAAA. Inner Left Sequence: CAGAGCAGAGAGGATACGGG. Inner Right Sequence: GAACGGGAAATTGCAAAAGA. Inner Primer PCR Length: 3229 bp. Deletion Size: 1803 bp. Deletion left flank: CTCGATCACTTCATTCACATATGAAGAACA. Deletion right flank: ATTAAAAAAGTACTTTTTTTTAATCGAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1631 |
ser-3(ok2007) I. |
C. elegans |
K02F2.6. Homozygous. Outer Left Sequence: CTAACTGCTCCGCCTCAAGT. Outer Right Sequence: AATTTGGCAGCCATTTTCAG. Inner Left Sequence: TGCGTGAATCACCATCACTT. Inner Right Sequence: TTAAACGGCCAATTTATCGC. Inner Primer PCR Length: 2855 bp. Deletion Size: 1244 bp. Deletion left flank: GTTACCAGATTTGTGTGGAGTGGCAGAATA. Deletion right flank: ATGTGATGGGTTTCTTGACCATTCGTAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1633 |
mif-1(ok2009) III. |
C. elegans |
Y56A3A.3. Homozygous. Outer Left Sequence: CCATGTCAACAAAGTCCGTG. Outer Right Sequence: GAATGAAAAATCCAAGGCGA. Inner Left Sequence: CGGTAAATTTCCCCGATTTT. Inner Right Sequence: TTCGTTGGATTTTTCCTTCG. Inner Primer PCR Length: 2533 bp. Deletion Size: 1020 bp. Deletion left flank: AGGCCCCACAGAAAGGAGGCCCCACCACGG. Deletion right flank: CTTTAAACCTATGTGCACTACCAGATAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1634 |
F32A5.4(ok2011) II. |
C. elegans |
F32A5.4. Homozygous. Outer Left Sequence: TATCCGTCTCTCGCTCCAGT. Outer Right Sequence: CCGTTGTAACGGAAGAGGAA. Inner Left Sequence: CCGTGTCTGGATGTCAGCTA. Inner Right Sequence: ACCCTTCATATCCAACGCAG. Inner Primer PCR Length: 2115 bp. Deletion Size: 1450 bp. Deletion left flank: ATCCGACTCCGTAATTTGACATCCTCTGAG. Deletion right flank: TATTCGTAAATAACGTGTTCTCAGCATTCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1635 |
F49E2.1(ok2012) X. |
C. elegans |
F49E2.1. Homozygous. Outer Left Sequence: CCTCCACATGTCGTAGTCCA. Outer Right Sequence: GATGCCGGATTGACAAAAGT. Inner Left Sequence: GGCAGTTGAAATGCAATGAA. Inner Right Sequence: TTTGCCAAAATGACAAGACG. Inner Primer PCR Length: 2897 bp. Deletion Size: 991 bp. Deletion left flank: GAAAAAAACAAAAACAAAATGTGTGTCGAT. Deletion right flank: TTTATTAACGCATTATTTCAGGAGGTCTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1637 |
K02H11.6(ok2014) V. |
C. elegans |
K02H11.6. Homozygous. Outer Left Sequence: TTGAAGAGAGAGCGAGAGCC. Outer Right Sequence: TTGACCCGTTTGCCAATTAT. Inner Left Sequence: ACTGGGGGAGCACAATATCA. Inner Right Sequence: CGCTCATTCTTCTTTCAGGG. Inner Primer PCR Length: 2187 bp. Deletion Size: 1215 bp. Deletion left flank: CACACCCCATATGTTCAAAATTACAGTCTC. Deletion right flank: CGGCAAGAGCTTCATTTGCGTCGACCAACG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1638 |
rab-18(ok2020) III. |
C. elegans |
Y92C3B.3. Homozygous. Outer Left Sequence: AATTTTGGGGGAAAATCGAC. Outer Right Sequence: CTTTTACCGCGAGAACTTCG. Inner Left Sequence: ATGGAAAACGGGGATTTTTC. Inner Right Sequence: TATCCTGCATTTTCCCTTCG. Inner Primer PCR Length: 2618 bp. Deletion Size: 1316 bp. Deletion left flank: GGCAATTTTAAGCCAAAATTGGTATTTTTG. Deletion right flank: CCATTGAAGTTACGCGGAAATCCACGCCTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1639 |
uda-1(ok2021) V. |
C. elegans |
K08H10.4. Homozygous. Outer Left Sequence: CGAGCAACCTCATTCCATTT. Outer Right Sequence: TGCGCAATATTAATAGCCCC. Inner Left Sequence: AACGTCATGCTATTCCCTGC. Inner Right Sequence: GCAATGCCGCAAAACTAAAT. Inner Primer PCR Length: 2492 bp. Deletion Size: 866 bp. Deletion left flank: TAGTCAAATATTACATTTCATTAAAATATC. Deletion right flank: AGAAAATAAAAGGAATGGAGGTTTCATGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1640 |
W01C8.4(ok2022) X. |
C. elegans |
W01C8.4. Homozygous. Outer Left Sequence: CATGCAAGACGAGGAGACAA. Outer Right Sequence: GCGCGTTGCATCTAAAATCT. Inner Left Sequence: TTGTTCACAAATGGCGGATA. Inner Right Sequence: CCCGTTGTGACCTTCAGTTT. Inner Primer PCR Length: 3309 bp. Deletion Size: 2544 bp. Deletion left flank: CAAAATGATGCAACCAACTGTAAATTTTTT. Deletion right flank: CTCTTTTTGTTTTTTGTCGCATCCTAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1641 |
dcap-2(ok2023) IV. |
C. elegans |
F52G2.1. Homozygous. Outer Left Sequence: GTGGCTCTGCCTGATTGATT. Outer Right Sequence: CGTTCCCAGATGTCGAAAAT. Inner Left Sequence: CTTTCGGAAATCCCCAATTT. Inner Right Sequence: TGGGAGCCATTTTCCTAGTG. Inner Primer PCR Length: 2796 bp. Deletion Size: 1603 bp. Deletion left flank: CATACATTTTTCCCCCTATTCATGTGTAGA. Deletion right flank: GTTTTTGTACACTTGATGGCGGCTCTTCTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1643 |
cah-1(ok2032) III. |
C. elegans |
F54D8.4. Homozygous. Outer Left Sequence: AGACATGTTTTGCGCAAGTG. Outer Right Sequence: GTTTTGTGTCGCCCATCTCT. Inner Left Sequence: ATCTTTGAGCAAAGTCGGGA. Inner Right Sequence: AATAGGTCGAGGGGGTGTTC. Inner Primer PCR Length: 2585 bp. Deletion Size: 1892 bp. Deletion left flank: GAAGTCGCCAAGGTTCGAAATCAGCAAGTT. Deletion right flank: ATCACCTGAGAAATAATGATTGCTTTCTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1644 |
maa-1(ok2033) III. |
C. elegans |
C18D11.2. Homozygous. Outer Left Sequence: TACTACGGAGAGACCCACGC. Outer Right Sequence: TTCGAAATGTCGGTGTTTGA. Inner Left Sequence: GCATTTTTCTTCCCCCAGTT. Inner Right Sequence: CAGGGTCTCACCACAAGTCA. Inner Primer PCR Length: 2684 bp. Deletion Size: 876 bp. Deletion left flank: GGCTTCATCCATCGTCATGTTGTCCAGCTT. Deletion right flank: TTAGTTTTACAATCGAGCCGCGACGCGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1645 |
C56E6.5(ok2034) II. |
C. elegans |
C56E6.5. Homozygous. Outer Left Sequence: TCTTGACCTTGGGTCGATTC. Outer Right Sequence: AATTTTTCGGGATTGGGTTC. Inner Left Sequence: AGACTCTGCGAAATGGGATG. Inner Right Sequence: AAAGGATTGACGGTCTCGTG. Inner Primer PCR Length: 2957 bp. Deletion Size: 1799 bp. Deletion left flank: CATATGTTTTTTGAGCTGAACAGACGGTTC. Deletion right flank: ATGCTGATAGTGGAGAAAGATATGCCGTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1646 |
try-6(ok2035) I. |
C. elegans |
F48A9.3. Homozygous. Outer Left Sequence: CAGAGGAAAACGAGAAACGC. Outer Right Sequence: TGAGCTCAGTTGTCATGGGA. Inner Left Sequence: GTCGGTTGAGAAGGTTGGAG. Inner Right Sequence: AATGTGGACGCCAGTTTAGG. Inner Primer PCR Length: 2338 bp. Deletion Size: 1548 bp. Deletion left flank: GAATATTATATGGACGCAGAAAAATGACCC. Deletion right flank: GATTTCTGTTAAAAGATATTACATTCCAGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1648 |
F54C4.3(ok2037) III. |
C. elegans |
F54C4.3. Homozygous. Outer Left Sequence: TTTCTGCATTTTTGCGTCAG. Outer Right Sequence: AGCAGCAGGTGCTCTTTTTC. Inner Left Sequence: ACAGAGCCGGGAAAATAGGT. Inner Right Sequence: TTTCAAACCCAAAAACTGGC. Inner Primer PCR Length: 3388 bp. Deletion Size: 2351 bp. Deletion left flank: TTGATTTTGAACATGCTTTTTGCGTTAAAA. Deletion right flank: TTTTTTTTCAAATTTTCATCTGAAAAAATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1649 |
tbck-1(ok2038) II. |
C. elegans |
C33F10.2. Homozygous. Outer Left Sequence: CCAAACTTCGGAGCATTCAT. Outer Right Sequence: AGCCAATCGATGTCAGCTTC. Inner Left Sequence: CAAACAAATGCTCGGAAGGT. Inner Right Sequence: GGCCTGCATAGAATTTGGAA. Inner Primer PCR Length: 3281 bp. Deletion Size: 1334 bp. Deletion left flank: CAATAAATACTACACAGATGATCAGGAGAA. Deletion right flank: TTGTCACGGAATCTCAACATTTTGTCTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1650 |
F56F11.2(ok2039) III. |
C. elegans |
F56F11.2. Homozygous. Outer Left Sequence: CCGCCAAATCCTTATTTTCA. Outer Right Sequence: TTTTTCTGAATTTTTCGGCG. Inner Left Sequence: TGGAATCCAACAAAACACCA. Inner Right Sequence: TGAACGTGTCTGGGATGAAA. Inner Primer PCR Length: 2864 bp. Deletion Size: 1924 bp. Deletion left flank: GCAGCTGAAGAGCTCTACCGTGTATTTGAA. Deletion right flank: TGCTGACAAAGATGAAGATTTGGCTGAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1651 |
D2023.5(ok2040) V. |
C. elegans |
D2023.5. Homozygous. Outer Left Sequence: AACGATGCACCATGAACGTA. Outer Right Sequence: AGCAGCTCTCCCAAATCTCA. Inner Left Sequence: CAACTCAGCCAGCTTCTTCC. Inner Right Sequence: CCGGGCTGAAAATAACTGAA. Inner Primer PCR Length: 2110 bp. Deletion Size: 570 bp. Deletion left flank: TATTGTTCAATCCAACCATTTGAGCATATT. Deletion right flank: TCTGCAATCAATGGAGCGCACTTGCGTCGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1652 |
D1081.4(ok2041) I. |
C. elegans |
D1081.4. Homozygous. Outer Left Sequence: CTTTGAATAAAACGCACGCA. Outer Right Sequence: AAAGTGTGGGTCGTCGAGAT. Inner Left Sequence: CGTGCTCACCTGAAACAAAA. Inner Right Sequence: GCAGTTTTGGGAGCAGAAAG. Inner Primer PCR Length: 3047 bp. Deletion Size: 2555 bp. Deletion left flank: ATCGCCGCAATGTATAACAATGCAATTTCA. Deletion right flank: GATGGGCTCCAGTGCTGTGAAAAATTCGGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1653 |
ctl-3(ok2042) II. |
C. elegans |
Y54G11A.13. Homozygous. Outer Left Sequence: CGGCGATTCTTATACTCCCA. Outer Right Sequence: CTTCCCCACATGGTCAATCT. Inner Left Sequence: GGCCAATTTTCTGCCTGATA. Inner Right Sequence: CAACTGCTTTCGCATGGTTA. Inner Primer PCR Length: 2912 bp. Deletion Size: 1420 bp. Deletion left flank: CATTTCCGAAATCCGGATGAACTTTCGTGAACTCTTTGACCATTCCATTTTGAATTTCC TCCAAACAGCCACCCAAATCACTAGCCAAATTCCCAACGAGCCGATCTCTCTCCTCCTC CTTGAGCACTTTCTCCCAGAACTGACGTGGCTGCTCGTAGTTGTGATCGTCTCCAGT. Deletion right flank:Â ATGGATTGAACTCCCATTTCTCAGCTTGTTCGAATGTCATCACTTGAATGAACATCTTC CATTCCGGGAAATTTCTTGACTCAATGGCATTGAACAGGTCGCGGATCGCATAGTCTGG ATCCGAAGAGGCGAGCTTTCCAGCGTCAGTTGGATCGAGATTCTTGGAACCTTGAGCAG GCTGAAAAATAGAAAATGAAAATTTAATTCTAGTCCCCGTCTCTCTTAGGCTTACCTTG . Insertion Sequence: GGATTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1654 |
F31E3.2(ok2044) III. |
C. elegans |
F31E3.2. Homozygous. Outer Left Sequence: ATTCGAAAGTCCACCGTCTG. Outer Right Sequence: CATTTCTTCCGCAACTCACA. Inner Left Sequence: GATGGACCAGCGAAGAAAAG. Inner Right Sequence: GGGCGTGAAGAACAGTGAAT. Inner Primer PCR Length: 2860 bp. Deletion Size: 1289 bp. Deletion left flank: AAATACATTTGTGACGTCACAAATGTATTT. Deletion right flank: TGTGGTAGGAACTATTTTCATTCACTTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1655 |
mps-3(ok2045) I. |
C. elegans |
T06A4.2. Homozygous. Outer Left Sequence: ACACTTTACGGTTTCCACGC. Outer Right Sequence: TACCTACCTGCCTACCCACG. Inner Left Sequence: CCTGCCTACCTGCCTACAAG. Inner Right Sequence: CTGCCTACCTGCCTATCTGC. Inner Primer PCR Length: 2411 bp. Deletion Size: 1559 bp. Deletion left flank: CAATGCTTTTTCTACAATTTTGTGGTTAAA. Deletion right flank: AGGCAAGTAGGCAGTTAGGCAGGTAGGCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1656 |
F54D5.4(ok2046) II. |
C. elegans |
F54D5.4. Homozygous. Outer Left Sequence: CCGATGAGCAGCTGTTGTTA. Outer Right Sequence: AAAGGGAAAATTGCAACGTG. Inner Left Sequence: ACGGTATGTCGTCCGATTTG. Inner Right Sequence: AGCAATGCGGAGACAGTTTT. Inner Primer PCR Length: 2218 bp. Deletion Size: 1180 bp. Deletion left flank: CCAAACTTCAATTGCCACTTAGATAAGAAT. Deletion right flank: TTTCTCAGAACTCAGAATATTAATCAATTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1657 |
R04F11.1(ok2047) V. |
C. elegans |
R04F11.1. Homozygous. Outer Left Sequence: AAATGGCCGATGTGATTGAT. Outer Right Sequence: TTCTCCGTGGGAATTTCAAG. Inner Left Sequence: GCCCATTGTTTTTCCATCTG. Inner Right Sequence: GCCAAAATTTCGAAACTGGA. Inner Primer PCR Length: 2447 bp. Deletion Size: 1294 bp. Deletion left flank: CATGGAACCAAACATGTGTATGTACGTTGC. Deletion right flank: CCTTAGGGCCTGGAACAGCTGAGAATGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1658 |
Y67D8C.10(ok2048) IV. |
C. elegans |
Y67D8C.10 Homozygous. Outer Left Sequence: ttctacggccattcttccac. Outer Right Sequence: tgacaaaacgggaacactca. Inner Left Sequence: gcttgaagctcgtctcatcc. Inner Right Sequence: gattcgtacttgcccttgga. Inner Primer PCR Length: 3172. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1659 |
acr-3(ok2049) X. |
C. elegans |
K11G12.7. Homozygous. Outer Left Sequence: CGATTTAAGCAAGACGGAGC. Outer Right Sequence: ACAGGCCAAAGTCTCGAAAA. Inner Left Sequence: GGACCCTCCAGTCTGTTTTG. Inner Right Sequence: CGCGGATAAAAGTATTCCGA. Inner Primer PCR Length: 3245 bp. Deletion Size: 2190 bp. Deletion left flank: ACGAAACATTTTTTGGTCCATTTTGTTTAT. Deletion right flank: GTGGTGATTGATCGATTACTTCTCTATCTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1660 |
clec-4(ok2050) II. |
C. elegans |
Y38E10A.5. Homozygous. Outer Left Sequence: AGACACGTAAGCTCGGCAGT. Outer Right Sequence: GCAAAGTCGCAGTTTTCTCC. Inner Left Sequence: TATCAATGGCGAGGCACATA. Inner Right Sequence: TACTGCGGCTGAGAAAACCT. Inner Primer PCR Length: 2826 bp. Deletion Size: 1610 bp. Deletion left flank: CTTCTATTTATGTTATTTGTCTTTTGAACT. Deletion right flank: GCAAGTGCCGAAAATTTCCAAAACCAGAAATTGCCGAAATTGCCGATTGCCGGAAATTT TAAAAACAGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1661 |
nhr-85(ok2051) I. |
C. elegans |
W05B5.3. Homozygous. Outer Left Sequence: AGACATCTGCCGAAGTCGAT. Outer Right Sequence: TTTGTTCGTTCCGAGAATCC. Inner Left Sequence: CGAACATCAGCCAACAGAGA. Inner Right Sequence: ACATTTGGTGAAGGGAGCAG. Inner Primer PCR Length: 3239 bp. Deletion Size: 2433 bp. Deletion left flank: CTTCTAAGTTTTGTTGGCCTAGAAAAAGCT. Deletion right flank: TATGAGCATCCAAATGTAAGTAAGATTTCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1662 |
C03D6.5(ok2060) I. |
C. elegans |
C03D6.5. Homozygous. Outer Left Sequence: ACCCACGAGATGTCTTGTCC. Outer Right Sequence: AGCCGAAAACACTCCTCAAA. Inner Left Sequence: TGCCAATTCCTGTTGCATAA. Inner Right Sequence: TCTGAAATCGCGTTTTGTTG. Inner Primer PCR Length: 2236 bp. Deletion Size: 1222 bp. Deletion left flank: AGCTGGAGTTTTCAACCACTTTTTACGGGA. Deletion right flank: CTGATGAGGATCCAGTCGCCGAGCCGGTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1663 |
clec-69&clec-70(ok2061) IV. |
C. elegans |
F56D6.15, Y46C8AL.3. Homozygous. Outer Left Sequence: GTTCACATTTTGGTTTGCCC. Outer Right Sequence: TCCATGTTTCAGGGTGCATA. Inner Left Sequence: CAGTTTGCCCGGACAGTAAT. Inner Right Sequence: ATCTTTGAACCCAGCACCTG. Inner Primer PCR Length: 2991 bp. Deletion Size: 4238 bp. Deletion left flank: TTTTTGCTTCACTTATTTCAAACCTCAAGT. Deletion right flank: GTAATAATTTCAGTCCATTGATATGATGCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1664 |
T23B12.4(ok2062) V. |
C. elegans |
T23B12.4. Homozygous. Outer Left Sequence: GTGCACGATATGCCTTCTGA. Outer Right Sequence: CCAACCGAGAAAATTCGTGT. Inner Left Sequence: CTCCAAACGAAAGCGAAGAC. Inner Right Sequence: AAAGAAAAACACGGGGGACT. Inner Primer PCR Length: 2929 bp. Deletion Size: 1108 bp. Deletion left flank: CAACGCCTTCAAGTGAAGCAAAATCGGAAA. Deletion right flank: AACTTTGGAACGGAGTCAAGAAATTCAGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1666 |
tbck-1(ok2064) II. |
C. elegans |
C33F10.2. Homozygous. Outer Left Sequence: CCAAACTTCGGAGCATTCAT. Outer Right Sequence: AGCCAATCGATGTCAGCTTC. Inner Left Sequence: CAAACAAATGCTCGGAAGGT. Inner Right Sequence: GGCCTGCATAGAATTTGGAA. Inner Primer PCR Length: 3281 bp. Deletion Size: 1935 bp. Deletion left flank: TGAAAACGGTGGAAGAAATGCGTGCAGCCG. Deletion right flank: GAAATGCATTCCCATTAATGATTGCTCTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1667 |
tax-6(ok2065) IV. |
C. elegans |
C02F4.2. Homozygous. Outer Left Sequence: AGCCGAGCACAAGACAAAAT. Outer Right Sequence: AGTTTGGTTTCCGTTTCACG. Inner Left Sequence: ACCTTCAAAGGTGTCATCGC. Inner Right Sequence: CTATCTCCTTTTGCCCCCTC. Inner Primer PCR Length: 2766 bp. Deletion Size: 1069 bp. Deletion left flank: GTACTTCAGGATGGCAGCTGAAAATTGTTA. Deletion right flank: TAGCAGATTTTGAGTGCCCACAGATACAGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1668 |
npr-19(ok2068) X. |
C. elegans |
C02H7.2. Homozygous. Outer Left Sequence: CAAACTGCAAACTCAAGCCA. Outer Right Sequence: CTCAACACGCAATCGTCACT. Inner Left Sequence: AAACCGCGCAACAGTAAGAT. Inner Right Sequence: TGCAGACTGACGATTCTTGG. Inner Primer PCR Length: 3294 bp. Deletion Size: 1045 bp. Deletion left flank: GATAGACATAAACGTTTAATGCGATCAGAG. Deletion right flank: CGAACTTTTAAAATAATAACCGCATAGGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1669 |
F31F6.2(ok2072) X. |
C. elegans |
F31F6.1. Homozygous. Outer Left Sequence: AAGATTGAGCATCGCTTCGT. Outer Right Sequence: AGACGTTGCCAAAAATCCAG. Inner Left Sequence: CCGAGTGGACCCTGTTTTTA. Inner Right Sequence: TTGCTGATGTTCAAATGCGT. Inner Primer PCR Length: 2417 bp. Deletion Size: 2076 bp. Deletion left flank: TCGTGCAAAATATGTGCGATTGACTTGATCAATCCTGC. Deletion right flank: tcgtgcaaaatatgtgcgattgacttgatc. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1670 |
K08E7.5(ok2074) IV. |
C. elegans |
K08E7.5. Homozygous. Outer Left Sequence: AAGGATGCACCAAACAAAGG. Outer Right Sequence: AGCGATTGAACAAATGACCC. Inner Left Sequence: CTTCAGCTTCACGTGGTTCA. Inner Right Sequence: CTGAGATTTGACGCTCCACA. Inner Primer PCR Length: 3141 bp. Deletion Size: 1298 bp. Deletion left flank: CAGGTACAAAGCCAAGCTCTTCAGCTTCAC. Deletion right flank: CCACGTAGCATTGAGCCCAGCAATTCGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1671 |
lon-3(ok2076) V. |
C. elegans |
ZK836.1. Homozygous. Outer Left Sequence: TAACACCGGAAAATGCACAA. Outer Right Sequence: TATGGACCTCAATGGGTGGT. Inner Left Sequence: AATGCTTTTCGTCGATACGG. Inner Right Sequence: ATGTGTTCTGCTTCTGCGTG. Inner Primer PCR Length: 2770 bp. Deletion Size: 1472 bp. Deletion left flank: GGTCCACGTGGTCCTTCCTCTCTGAAATTT. Deletion right flank: AACGAGTTACTGTAACTCGTGTTGATTTAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1672 |
sel-12(ok2078) X. |
C. elegans |
F35H12.3. Homozygous. Outer Left Sequence: CCTCTTCCTCCTTTTCACCC. Outer Right Sequence: CGACAGTTGTGGTTTCCTCC. Inner Left Sequence: ACGTTTCAGATGCCTTCCAC. Inner Right Sequence: ATGATCCAGCGGGTACAAAA. Inner Primer PCR Length: 2248 bp. Deletion Size: 1525 bp. Deletion left flank: TCTGGTTGTTTTTACGATGAACACGATTAC. Deletion right flank: TCAGCTGAATATATTTTGTTCATTTAAAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1673 |
C06E8.5(ok2080) III. |
C. elegans |
C06E8.5. Homozygous. Outer Left Sequence: CGGGTCAATCATTTCCACTT. Outer Right Sequence: AAATATCGTTTGCAGTCGGC. Inner Left Sequence: TCAAGCAACAAGTGCCTCAG. Inner Right Sequence: CTTCAAGTGGTCTCCCGTGT. Inner Primer PCR Length: 2996 bp. Deletion Size: 1262 bp. Deletion left flank: ATTTCAAAACAAGTTTGCGCGTCAACTGTT. Deletion right flank: ATCTTGAGTTGCCACCTGGCATGATGCCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1674 |
frm-7(ok2081) V. |
C. elegans |
C51F7.1. Homozygous. Outer Left Sequence: TGATAAACGAGCGTGGTCTG. Outer Right Sequence: GAGGGGATCAGTTTCCAACA. Inner Left Sequence: CGTTCGCACTGAACTGTCAT. Inner Right Sequence: GCCCGAATAAATTGGGATCT. Inner Primer PCR Length: 3127 bp. Deletion Size: 1089 bp. Deletion left flank: GACCGACAAGCATCTTTCCCACCAGCAAGT. Deletion right flank: TGCCTCTCTATATTTTTCAAACTTTCCGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1675 |
F08G12.8(ok2082) X. |
C. elegans |
F08G12.8 Homozygous. Outer Left Sequence: gttgaacacacgcacattcc. Outer Right Sequence: ccatctgctcgttgtaagca. Inner Left Sequence: acagtgaagcgtaaccaccc. Inner Right Sequence: gtatcccatcgggaaatgtg. Inner Primer PCR Length: 2607. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1677 |
Y49F6C.7(ok2086) II. |
C. elegans |
Y49F6C.7. Homozygous. Outer Left Sequence: CGGCTGTTGGAGGGATATTA. Outer Right Sequence: AGGTCATTTCCCATCGTTTG. Inner Left Sequence: TCGAAAAGCAAAAGTCCCAT. Inner Right Sequence: TCCATTACCAATGCTCCACA. Inner Primer PCR Length: 2104 bp. Deletion Size: 1471 bp. Deletion left flank: CAAGTTTCTACGTTGGATATGAAGAGTTCT. Deletion right flank: GGGCGACCAACTCGTTGCGCTGAAGGACTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1678 |
C13C4.5(ok2087) V. |
C. elegans |
C13C4.5. Homozygous. Outer Left Sequence: AAAACCGACATGCACACTGA. Outer Right Sequence: TGCGAATGATTGACTGATGG. Inner Left Sequence: CAACTCCAACGGATTCACCT. Inner Right Sequence: AAGAGCAGACCCGCAATAAA. Inner Primer PCR Length: 2307 bp. Deletion Size: 951 bp. Deletion left flank: AAAAGGGAGAAATTGCTGCATCTACAGAAG. Deletion right flank: GCACTGAATCAAAATATTCATTTGCAGTGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1679 |
cav-1(ok2089) IV. |
C. elegans |
T13F2.8 Homozygous. Outer Left Sequence: cacgaagtgaacgaagcaaa. Outer Right Sequence: tccaacaagaccgggactac. Inner Left Sequence: ccatttcccatctgttaccg. Inner Right Sequence: tggatgaaagagcacacagc. Inner Primer PCR Length: 3302. Deletion Size: 2339 bp. Deletion left flank: AGAGTATCGTCCGTGAATCTTTAATCTAAA. Deletion right flank: ATTGTTGGAGTAAAAATCTAAAAATTTCGT. Deletion carries 626-bp insertion at break, corresponding to the reverse complement of T13F2 coordinates 8228-8854. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1680 |
C24A8.1(ok2090) X. |
C. elegans |
C24A8.1. Homozygous. Outer Left Sequence: GATGAACGAATCGGAAATCG. Outer Right Sequence: TGTGAGTTTTGCGGACAAAG. Inner Left Sequence: CAGCCTGAATGGGCATATCT. Inner Right Sequence: AGTGGAGTTGCATGACCAAA. Inner Primer PCR Length: 3261 bp. Deletion Size: 1027 bp. Deletion left flank: TTGCACTGAAAATTTCAATTATAGTACTGT. Deletion right flank: ATTTTTCAGCAAGTTAGAAAGCAAAAGTAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1681 |
C06E8.5(ok2091) III. |
C. elegans |
C06E8.5. Homozygous. Outer Left Sequence: CGGGTCAATCATTTCCACTT. Outer Right Sequence: AAATATCGTTTGCAGTCGGC. Inner Left Sequence: TCAAGCAACAAGTGCCTCAG. Inner Right Sequence: CTTCAAGTGGTCTCCCGTGT. Inner Primer PCR Length: 2996 bp. Deletion Size: 2200 bp. Deletion left flank: TTTTTACCAATTTTTTACCAATTTTAAAAG. Deletion right flank: TACTCCTGATCCTTTCTGAAATACACTTCG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1682 |
K03E6.4(ok2092) X. |
C. elegans |
K03E6.4. Homozygous. Outer Left Sequence: TGAGTGTCAAATCCCCACAA. Outer Right Sequence: TTGTCGTATCCATCTGCTGC. Inner Left Sequence: TCGCGAGATATGTTTGCTTG. Inner Right Sequence: AATTCATGGAAACGTTCGGA. Inner Primer PCR Length: 2664 bp. Deletion Size: 807 bp. Deletion left flank: CGAAGAAGGTTCTGGCAGGAAACAGTGTAC. Deletion right flank: CATTGATTATTTTCCAATCGCCTGTTGCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1683 |
C36F7.5(ok2093) I. |
C. elegans |
C36F7.5. Homozygous. Outer Left Sequence: TGACAAAGCGACCTCTTCCT. Outer Right Sequence: CAGATCCTTCCCTTCCATCA. Inner Left Sequence: CGACGATTGAGCAATGAAGA. Inner Right Sequence: TGCTGCTCAAACTTGATTCG. Inner Primer PCR Length: 2216 bp. Deletion Size: 1115 bp. Deletion left flank: TTGATCTTCTATTTTTTCTTCTTGTCAGCT. Deletion right flank: ATACCTTTCCGCACAAGAACAGAACCTGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1684 |
Y54G9A.4(ok2094) II. |
C. elegans |
Y54G9A.4. Homozygous. Outer Left Sequence: AGGTTTTTCACGACCACGAC. Outer Right Sequence: GCCAATTTCTTGCCAAGTTC. Inner Left Sequence: TCATGTTGACAGCGAGAAGG. Inner Right Sequence: ATTTGAAGGCGCAGATCACT. Inner Primer PCR Length: 3280 bp. Deletion Size: 1561 bp. Deletion left flank: ATCCCAAGAGAAAACATGACGATCGCCTTA. Deletion right flank: ATCCTACTTGCCTGCCTGCCTGCTTTAACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1685 |
ttm-5(ok2095) I. |
C. elegans |
Y54E5A.1 Homozygous. Outer Left Sequence: ttttgaaggcggtagacacc. Outer Right Sequence: gaaaaataaccgcccattga. Inner Left Sequence: ccacactctctcatcaccga. Inner Right Sequence: gccgggatacatctcttcaa. Inner Primer PCR Length: 2720. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1686 |
T28B8.3(ok2096) I. |
C. elegans |
T28B8.3. Homozygous. Outer Left Sequence: TTTCACGTTCATCCACCAAA. Outer Right Sequence: CCGCGACTTTCTTGTTTCTC. Inner Left Sequence: GGAACGATTGAATTGGGAGA. Inner Right Sequence: ACCGATAAATGGGTTCCCTC. Inner Primer PCR Length: 2842 bp. Deletion Size: 1592 bp. Deletion left flank: TCGATTTATTTTCCAGGATTATAAGCTGAT. Deletion right flank: AATATTTTTTATACAAAAACTATGCAAACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1687 |
F13B6.1(ok2097) IV. |
C. elegans |
F13B6.1. Homozygous. Outer Left Sequence: CCAGAATGACCATTCCGTTC. Outer Right Sequence: GGTGAACAGGCAAATCCACT. Inner Left Sequence: TTCACACCTGCTCAAATTGC. Inner Right Sequence: CTGTGGATCCGACAATCCTT. Inner Primer PCR Length: 2315 bp. Deletion Size: 1059 bp. Deletion left flank: ATCAAGTACTTAATGGATTCGTGGGATTAC. Deletion right flank: CATAATTCTCTTGCCACGTATGTAGCAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1688 |
W05G11.6(ok2098) III. |
C. elegans |
W05G11.6. Homozygous. Outer Left Sequence: CCATGAGCAAAAACCCTCAT. Outer Right Sequence: CGTTCTCTGCGTAACATGGA. Inner Left Sequence: TCGTCAACATCTTCAACCCA. Inner Right Sequence: GGAGACTTCGCTTCGTTGTC. Inner Primer PCR Length: 3069 bp. Deletion Size: 1276 bp. Deletion left flank: AATTTTCTAGTAATTTTCAAGTAAAAGCCT. Deletion right flank: AAGGTCTACTGAGGTTTTTCCTTGAAATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1689 |
jtr-1(ok2102) IV. |
C. elegans |
Y77E11A.4. Homozygous. Outer Left Sequence: TGTTCACGGTGAGTGAGGAG. Outer Right Sequence: GTGGCCTGTGGCCTTAAATA. Inner Left Sequence: GTGGATAGGGCTGTGTCGAT. Inner Right Sequence: TGAGCGTCCTCCTCTCCTTA. Inner Primer PCR Length: 2335 bp. Deletion Size: 618 bp. Deletion left flank: TGCCGCAATTCTCATCGTGAGCTTCTTGTC. Deletion right flank: CATATCTGGGGTAGATTCACGGCGCGTCGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1690 |
ser-2(ok2103) X. |
C. elegans |
C02D4.2. Homozygous. Outer Left Sequence: CTCCTTCGCCACACTGATTT. Outer Right Sequence: CCGAATCGCGAAAATTAAAA. Inner Left Sequence: CTTTCACTTTGCACGATCCA. Inner Right Sequence: TCCGCAAATTTCTACGATCC. Inner Primer PCR Length: 3130 bp. Deletion Size: 2043 bp. Deletion left flank: GTTTGTGTCATCAACTAAAAAAATAACTAA. Deletion right flank: GACAATGATCATTAACTTAATGAGCTTTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1692 |
cki-2(ok2105) II. |
C. elegans |
T05A6.2 Homozygous. Outer Left Sequence: gataatctggtttgccgcat. Outer Right Sequence: ggtgtgattggtgcagagaa. Inner Left Sequence: ttgaatcgaaacgccttttt. Inner Right Sequence: aaacaagagcgaaggtcgaa. Inner Primer PCR Length: 2262. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1693 |
ptr-10(ok2106) I. |
C. elegans |
F55F8.1. Homozygous. Outer Left Sequence: CTTTTTCCAGACGGAACGAC. Outer Right Sequence: ATCCGAGAACTCCCAAATCA. Inner Left Sequence: GTACGTGGTCTTTTGCCGAT. Inner Right Sequence: AGCAACCCAGAAAGAGCAAA. Inner Primer PCR Length: 3178 bp. Deletion Size: 1861 bp. Deletion left flank: AATAAAATGGATGAGTATAAGAAGCAAGCG. Deletion right flank: CAAGTTTCAGAGGAAATTCATAAAATTCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1694 |
T24H7.2(ok2107) II. |
C. elegans |
T24H7.2. Homozygous. Outer Left Sequence: AGGAAAGAAGCGATTCCGAT. Outer Right Sequence: TGCCTTGTCGTGTTCTTGTC. Inner Left Sequence: GTAATCTTGCCAACCACCGT. Inner Right Sequence: TTCGTCACATCGTCTTCGAG. Inner Primer PCR Length: 2864 bp. Deletion Size: 1337 bp. Deletion left flank: AAGAAATCGGTGAGAAACCGCAGAGATTAA. Deletion right flank: TCTATTCATATTGTTTTTGTTTCAGCAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1696 |
mec-17(ok2109) IV. |
C. elegans |
F57H12.7. Homozygous. Outer Left Sequence: CACAATCTCCGCTCAAGACA. Outer Right Sequence: CTCGGAGCTTCCTACTGGTG. Inner Left Sequence: CGCAGCCGTTTTAATTTTGT. Inner Right Sequence: TTTTGAGGAATCGGGTGAAG. Inner Primer PCR Length: 2752 bp. Deletion Size: 1977 bp. Deletion left flank: TGGTACCCATCTCTCTCTCTCTCTCCGTCC. Deletion right flank: AATTTATTTTTAAAAAATTATATTCGGACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1697 |
C54G4.4(ok2110) I. |
C. elegans |
C54G4.4. Homozygous. Outer Left Sequence: TAGGGTTGTTTGGGATTTGG. Outer Right Sequence: ATCCGGTAATGTGGCAATGT. Inner Left Sequence: AATTTGAAAGTTGGTTGCGG. Inner Right Sequence: TTTTCAGCCTTCGAGCTTGT. Inner Primer PCR Length: 3269 bp. Deletion Size: 1789 bp. Deletion left flank: TTCGGATCATTTTCATGATTTTTTAGATCC. Deletion right flank: ACTTCAGTTAAAATATTTTTAAAAAGAAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1698 |
lev-10(ok2111) I. |
C. elegans |
Y105E8A.7a. Homozygous. Outer Left Sequence: CCATAATCCAGGCCCTTTTT. Outer Right Sequence: CGTTTCGACTTCTTCTTCCG. Inner Left Sequence: AGACGTTCCACACGATTTCC. Inner Right Sequence: TGTTATACCGCAGAACACCG. Inner Primer PCR Length: 3220 bp. Deletion Size: 1860 bp. Deletion left flank: GGGTTTTTCAACAGTCCCAGGTATCCTGCT. Deletion right flank: GTTCAGCTTTGGCATAGGTTTAGGCTTCGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1699 |
Y38C9A.1(ok2118) V. |
C. elegans |
Y38C9A.1. Homozygous. Outer Left Sequence: AGCTTTCTGGCTGTCGGATA. Outer Right Sequence: GCCGCGAATTTTTCATACAT. Inner Left Sequence: ATTTCGCGGAATTACGTCAC. Inner Right Sequence: GCTCCAATGCGGTCAAGTAT. Inner Primer PCR Length: 3291 bp. Deletion Size: 1439 bp. Deletion left flank: ATCGTTAGCAAGATTCTACCGTACCCTGCC. Deletion right flank: AGTTACAAATTAAAAAAAAGCCCAACTCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1700 |
F59F4.1(ok2119) X. |
C. elegans |
F59F4.1. Homozygous. Outer Left Sequence: GATAACAATCAGGGCTGGGA. Outer Right Sequence: AATTTAACACTTGCACGGGG. Inner Left Sequence: TCGAGCGTCTTTCATCATTG. Inner Right Sequence: TGCGATAGGGTATGTCACCA. Inner Primer PCR Length: 3067 bp. Deletion Size: 1655 bp. Deletion left flank: CGGTGTTTCCATGTGTAAGCTGCTCGGTGA. Deletion right flank: TTTACCCAAGCCTCCCGGCCACCATCTTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1701 |
clec-34(ok2120) V. |
C. elegans |
T25E12.8. Homozygous. Outer Left Sequence: AATCCGCTGATCCAACAAAG. Outer Right Sequence: AATTGGTTTGGGCTCAACTG. Inner Left Sequence: TCTCTCAAGAGGGTCGTCGT. Inner Right Sequence: TCAATTTGGTCTCCCTCCAG. Inner Primer PCR Length: 2159 bp. Deletion Size: 1155 bp. Deletion left flank: TCAAATAGGATTACAGGAAAATAATGCGAT. Deletion right flank: CAGAATTCAATGTTCACTAATCAATAGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1702 |
C39E9.10(ok2121) IV. |
C. elegans |
C39E9.10. Homozygous. Outer Left Sequence: TCGAATCACTCACGCTCAAC. Outer Right Sequence: GTTGCAGGAGCTGAAGGACT. Inner Left Sequence: TGCCAGCTTATCTCTTGGCT. Inner Right Sequence: GTTGATGTTCGAATCGGCTT. Inner Primer PCR Length: 2992 bp. Deletion Size: 2469 bp. Deletion left flank: CGTAGTTCTGTTTTCTGTTTTTGTGATTTT. Deletion right flank: ACTTTGTGTCCTCACTCACGCTGGTCTCGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1703 |
Y7A5A.9(ok2122) X. |
C. elegans |
Y7A5A.9. Homozygous. Outer Left Sequence: TGCGCGCTTTATATAGGCTT. Outer Right Sequence: CCCTTCACCAAAGAACCTGA. Inner Left Sequence: TATTTTCCAGATTCGTCGCC. Inner Right Sequence: CAAAAGAAACGTTCCCCGTA. Inner Primer PCR Length: 2920 bp. Deletion Size: 1335 bp. Deletion left flank: CGTATATTAACTCTGTTAACACTTTTCCTT. Deletion right flank: ACCCATTGTCTATCTATTTCTTTGTTTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1704 |
F14E5.4(ok2129) II. |
C. elegans |
F14E5.4. Homozygous. Outer Left Sequence: CTCGACGAATAGACCGATGC. Outer Right Sequence: TTTGGTCAGTTGGCATTTCA. Inner Left Sequence: CCTTTTTCCATCGAAACCAC. Inner Right Sequence: GCGTGCTTCAGAAAGGTGAT. Inner Primer PCR Length: 2170 bp. Deletion Size: 1766 bp. Deletion left flank: TTTTTCCATCGAAACCACAATTTATACTTG. Deletion right flank: TTTGCAAGATAAGCAGGATCGCTGAGACTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1705 |
nhr-244(ok2130) I. |
C. elegans |
ZK1025.6. Homozygous. Outer Left Sequence: GGAGATCATTTCCGCGATTA. Outer Right Sequence: CAACCCGAAAACTGTCCTGT. Inner Left Sequence: AAAACTAAGCTCACGGCGAA. Inner Right Sequence: AAGATGGTATCGGGTAGGGC. Inner Primer PCR Length: 2176 bp. Deletion Size: 1355 bp. Deletion left flank: AGATATCAATAAGAGAGGTGTTGAAGATGT. Deletion right flank: CACTCTCAATAGTTTTAAAATGGTTTGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1706 |
nhr-244(ok2131) I. |
C. elegans |
ZK1025.6. Homozygous. Outer Left Sequence: GGAGATCATTTCCGCGATTA. Outer Right Sequence: CAACCCGAAAACTGTCCTGT. Inner Left Sequence: AAAACTAAGCTCACGGCGAA. Inner Right Sequence: AAGATGGTATCGGGTAGGGC. Inner Primer PCR Length: 2176 bp. Deletion Size: 1178 bp. Deletion left flank: ATGCTAGACAAGGAAGATGTGGAGGTTCTG. Deletion right flank: AAAAATATATCCAAAACCCCGATGCACCGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1708 |
mec-7(ok2152) X. |
C. elegans |
ZK154.3. Homozygous. Outer Left Sequence: ATTACAGTTGGATCAGGGCG. Outer Right Sequence: CACTTTCCCACCTCATCGTT. Inner Left Sequence: AAGCAAAGCAAAAAGGCTGA. Inner Right Sequence: TGTTCGGGTGTTTCAAGATG. Inner Primer PCR Length: 2164 bp. Deletion Size: 1346 bp. Deletion left flank: TCGTAAAATTTTACCTGTGAACTGCTCTGA. Deletion right flank: ATATGAACGATCTCGCGCATGTTGCTTGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1709 |
F20D1.4(ok2153) X. |
C. elegans |
F20D1.4. Homozygous. Outer Left Sequence: CATCTGCTTCTTGACCCACA. Outer Right Sequence: AATGTTTCGGAGAACAACGG. Inner Left Sequence: GAATCCGCTCAATATCCGAA. Inner Right Sequence: AACAAAAGAAGGGGGAAGGA. Inner Primer PCR Length: 2161 bp. Deletion Size: 1616 bp. Deletion left flank: TTTTGTTGTATAATTCCTCTTGATAATTAC. Deletion right flank: TTTTTAATTTACCGTGATTTTATTTCATAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1710 |
Y39G10AR.18(ok2154) I. |
C. elegans |
Y39G10AR.18. Homozygous. Outer Left Sequence: ATTTTGCATGAAAACTCCGC. Outer Right Sequence: CTCCTTCTGTGCGTGTGTGT. Inner Left Sequence: GAAAATTGAAAATTCCGCCA. Inner Right Sequence: GCATCCACCACCTTTGTTCT. Inner Primer PCR Length: 2518 bp. Deletion Size: 1462 bp. Deletion left flank: GTCGATTTGCCGGAATGTTTCAATTCCGGC. Deletion right flank: TTTTTTTAGTGGGCACAATTGAAAAAACGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1711 |
plp-1(ok2155) IV. |
C. elegans |
F45E4.2. Homozygous. Outer Left Sequence: GAATTTTGCCGCGTATTTGT. Outer Right Sequence: GAATCCGCTCAATATCCGAA. Inner Left Sequence: GAAATTGCGTCTCGGTGTTT. Inner Right Sequence: TTATCCATCTCCATGGCTCC. Inner Primer PCR Length: 2124 bp. Deletion Size: 1107 bp. Deletion left flank: GCTTTTTTTCCTTTCTAAATCTTGTTTTTA. Deletion right flank: AAAAAATATATTAAAAACTTTTTTAATGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1712 |
rig-3(ok2156) X. |
C. elegans |
C53B7.1. Homozygous. Outer Left Sequence: GGGGAAACCCCAGTTTTATG. Outer Right Sequence: ACAAATGCCAGGATTTCAGC. Inner Left Sequence: ACGTCTTAAATTTGCGCGAT. Inner Right Sequence: GCAACAAAACAGTGCGTCAT. Inner Primer PCR Length: 3140 bp. Deletion Size: 1532 bp. Deletion left flank: AAACATCGCAAAACATCGCTACATTTCTCA. Deletion right flank: GCTGGATTTGGTAGGAATAATAATTCTGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1713 |
mrp-2(ok2157) X. |
C. elegans |
F57C12.4. Homozygous. Outer Left Sequence: GGCATCTTTTGCCATTGAGT. Outer Right Sequence: CACCTTCCACAGATCCAACC. Inner Left Sequence: TTGCGAGAAGGTTCTTTGGT. Inner Right Sequence: AACGTCTGGAATCCCATTTG. Inner Primer PCR Length: 3181 bp. Deletion Size: 1357 bp. Deletion left flank: GTTCAGACGATGTGCAATTGTTAGAACAGT. Deletion right flank: GCGCACCAAGGGTGTCGGTTTTTCGATTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1714 |
rcq-5(ok2158) III. |
C. elegans |
E03A3.2 Homozygous. Outer Left Sequence: cgttttcgcatttcacagaa. Outer Right Sequence: ggagcgtacttgccacattt. Inner Left Sequence: cgttttccatctcttccagc. Inner Right Sequence: tttcagagatgagctcgggt. Inner Primer PCR Length: 2930. Deletion size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1715 |
aqp-2(ok2159) II. |
C. elegans |
C01G6.1. Homozygous. Outer Left Sequence: ACAGAGAAAAGGTGCAACCG. Outer Right Sequence: CTGCTCAAGGGTCACAATGA. Inner Left Sequence: CAGGGTGAGAAAGGATTTCG. Inner Right Sequence: CCTCCCAACTTCACCTTTCA. Inner Primer PCR Length: 3110 bp. Deletion Size: 1238 bp. Deletion left flank: AACAATTGGAACCCAGAACCACTTGCTGAA. Deletion right flank: TTTATTACCAGTAAATTGTCCACTCTTCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1716 |
nhr-49(ok2165) I. |
C. elegans |
K10C3.6. Homozygous. Outer Left Sequence: CTCAATTGTGTGCACTTGCC. Outer Right Sequence: AAGGAAGAAGAGTTGGGGGA. Inner Left Sequence: CAACATGCGTTCCACTCCTA. Inner Right Sequence: AGGATGAATTGCCAATGGAG. Inner Primer PCR Length: 3211 bp. Deletion Size: 1437 bp. Deletion left flank: TGAAAACTTGCGTTGCTATCTGTTGTTTGG. Deletion right flank: ACAACTATTTTCTGTCATTCAGGTCCATGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1717 |
lev-9(ok2166) X. |
C. elegans |
T07H6.5. Homozygous. Outer Left Sequence: GCATCCATTCACCATTCACA. Outer Right Sequence: CGGAAAAATGTTGCACAATG. Inner Left Sequence: TCAAATAATTGCCCTTCCCA. Inner Right Sequence: TGCCCAATAAGTCAATGCAA. Inner Primer PCR Length: 3362 bp. Deletion Size: 2796 bp. Deletion left flank: AACCTAAACTTTATTGAAAATAAAAAAAAA. Deletion right flank: CACAGATCATGGAACACTATTCACACAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1718 |
ifc-1(ok2173) V. |
C. elegans |
F37B4.2. Homozygous. Outer Left Sequence: GGCCAACAATCACCAATTTT. Outer Right Sequence: CGCATCCCCTAATTGACTGT. Inner Left Sequence: GTACGGAGGTATTCCGACGA. Inner Right Sequence: GCCATCACGCTTTGAAAGTT. Inner Primer PCR Length: 2286 bp. Deletion Size: 2036 bp. Deletion left flank: TATCGAAAAGGTATGTGCTTTTAAGAGCGT. Deletion right flank: TGCCGTCAAATAGTGTTGTTCCATACAATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1719 |
Y45F10D.13(ok2174) IV. |
C. elegans |
Y45F10D.13. Homozygous. Outer Left Sequence: CCGAAAAATCAGCCCACTAA. Outer Right Sequence: AATTGCCGTTTCACAAGTCC. Inner Left Sequence: AATTTCAGCCCATCATCTGC. Inner Right Sequence: TACATCTCGGATCCTTTCGG. Inner Primer PCR Length: 2960 bp. Deletion Size: 1110 bp. Deletion left flank: TAAAACCCCAAAATCATCATTGAAAATAAA. Deletion right flank: AAATTGATTACTGTTTCAAAAAGTTATTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1720 |
Y106G6A.1(ok2178) I. |
C. elegans |
Y10G6A.1. Homozygous. Outer Left Sequence: GGCATCTTCCCATTCGAGTA. Outer Right Sequence: GAGTCATCGGTTACCGTCGT. Inner Left Sequence: CCTGTGCTCAACTCTGCTTG. Inner Right Sequence: TAAATTCGAATGGCGGTCTC. Inner Primer PCR Length: 2210 bp. Deletion Size: 1007 bp. Deletion left flank: GTTTTAAATATTATTTTTACCGTAAAATTC. Deletion right flank: AAGTTTGTTCAATGTTTTGAAAACCGTAGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1721 |
Y71G12B.4(ok2189) I. |
C. elegans |
Y71G12B.4. Homozygous. Outer Left Sequence: TCCCCGTAGCCATTTAGTTG. Outer Right Sequence: GATGGCGCAGAAATCAAAAT. Inner Left Sequence: GATCTCCAGATTGCTAGCGG. Inner Right Sequence: CTCATTCGGGACACACACAC. Inner Primer PCR Length: 3008 bp. Deletion Size: 976 bp. Deletion left flank: TGGGATTGTGGAGAAATGAATAAGCCGGAT. Deletion right flank: TTGTCCGTGTAGAGTACACGACTTTCCCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1722 |
vps-13(ok2190) I. |
C. elegans |
T08G11.1. Homozygous. Outer Left Sequence: CATGTTCCACAGTGCCAAAC. Outer Right Sequence: CAAAATCTCAATGCCCGAAT. Inner Left Sequence: TGACCCTCTTTTCAGCTCGT. Inner Right Sequence: AATCTCCATTCTTTGCCACG. Inner Primer PCR Length: 3284 bp. Deletion Size: 2292 bp. Deletion left flank: TCTCATTTTCCACAGGCTCAATAATGGGCT. Deletion right flank: TATTCAAAACTTCATAAAGAACATACATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1723 |
C27H2.2(ok2191) IV. |
C. elegans |
C27H2.2. Homozygous. Outer Left Sequence: TTCCGAATTGTTTGGCTTTC. Outer Right Sequence: TTTACAATCGCGTGTTGCTC. Inner Left Sequence: CAATTTCACCCTTCGATGCT. Inner Right Sequence: TTTGCCATTGTGCCAATAAA. Inner Primer PCR Length: 2901 bp. Deletion Size: 703 bp. Deletion left flank: ACTTTTTTCCGAATTTCGAATATTGTAAAA. Deletion right flank: GGCACCCTTCCGGCTCCGTCGAGCAAGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1724 |
F42G4.6(ok2196) II. |
C. elegans |
F42G4.6. Homozygous. Outer Left Sequence: CTGCCTACCTATCTGCCTGC. Outer Right Sequence: AAGAAGGCTCCTCGCATACA. Inner Left Sequence: AACAGGTTCATTTTGCGGTC. Inner Right Sequence: GAAATGGAAGAATTTGCCGA. Inner Primer PCR Length: 2746 bp. Deletion Size: 1759 bp. Deletion left flank: TGTTTCAAGCACAACGGTCAGTGTACCTAC. Deletion right flank: CCAAAAATTTTATTCAGAATTGTAATAATT. Insertion Sequence: CAACGGTCAGTGTACCTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1725 |
ZK1025.7(ok2197) I. |
C. elegans |
ZK1025.7. Homozygous. Outer Left Sequence: AACTCGATTACACCGATGCC. Outer Right Sequence: GGAGATCATTTCCGCGATTA. Inner Left Sequence: TTCTTCGGAGACTTCACGGT. Inner Right Sequence: GCCGATTTGTACAGCCCTAA. Inner Primer PCR Length: 2643 bp. Deletion Size: 1741 bp. Deletion left flank: CATGCGTTAAACCGAATACCTATCTACTAA. Deletion right flank: CACGGTCACAGGAGTGGAAATAGTTTCTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1727 |
F44C8.7(ok2206) V. |
C. elegans |
F44C8.7. Homozygous. Outer Left Sequence: CGGGATCTTGAAAATCTGGA. Outer Right Sequence: CGTCGCATTTGATGTTGAAT. Inner Left Sequence: TGAGCACATTTTGGGCCTAT. Inner Right Sequence: CTATCGCCCGGTAACACAGT. Inner Primer PCR Length: 2869 bp. Deletion Size: 1098 bp. Deletion left flank: TCTGAAAATTTAATTTTCAGTGCAAAATGA. Deletion right flank: TTACATGAGAAAATTCACGAAAAAGTTACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1728 |
tra-3(ok2207) IV. |
C. elegans |
LLC1.1. Homozygous. Outer Left Sequence: TTGAGCACAACCTGAAGCAG. Outer Right Sequence: AAAACTCCTATTTGCCCGCT. Inner Left Sequence: TCACAGTTTTCGGGTTTTCC. Inner Right Sequence: AGATGTTTCCGGTGGAGTTG. Inner Primer PCR Length: 3226 bp. Deletion Size: 1474 bp. Deletion left flank: AAAGAACTGAAGTTATGTTTATTGGTTAAT. Deletion right flank: TCTCATTTTGAACTAGAAACTATTGCTAAC. Insertion Sequence: CTTCAGAAAAATATTACAAATTGTATCTTTTTACACAAGATTTTAAATTTTTAAAAATA AAATCTGAAACAATTTTGTCTAATAAAAACAAAGGCCCTCATGAATTGTTTATGAAAAT TATCACCCAAATAAGTTGATTAACTTGGGCGGGGCTTATTTTACAGGTTTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1729 |
gcy-36(ok2208) X. |
C. elegans |
C46E1.2 Homozygous. Outer Left Sequence: gcttttcgtcgttggaactc. Outer Right Sequence: ggtgtgtacttgaagggcgt. Inner Left Sequence: cggccatagtaatggaatgg. Inner Right Sequence: cccgagttgttcttctctcg. Inner Primer PCR Length: 3041. Deletion size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1730 |
K01H12.2(ok2209) IV. |
C. elegans |
K01H12.2. Homozygous. Outer Left Sequence: TCCGTGATATGTTGTTCCGA. Outer Right Sequence: AGAGCCTGCCTACATGGCTA. Inner Left Sequence: TGTTTGCAAAATGATGCGAT. Inner Right Sequence: CAAGGTTCAGTTGCCTCCTC. Inner Primer PCR Length: 2111 bp. Deletion Size: 892 bp. Deletion left flank: ATCGACGATTCCTTTGTAACGTTTATCGGC. Deletion right flank: ATAATCGCAATCATTTTAAACCAAAAAGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1732 |
E01G4.3(ok2211) II. |
C. elegans |
E01G4.3. Homozygous. Outer Left Sequence: CACAAATACGTTGGCATTCG. Outer Right Sequence: GATTGCCGATTTGCCTTAAA. Inner Left Sequence: CTGATGCTGTTGCTGGTGTT. Inner Right Sequence: GAGAAACGGCAAGCAAACTC. Inner Primer PCR Length: 2562 bp. Deletion Size: 1076 bp. Deletion left flank: CCCGAAATCATTGGCGAGGTGAGGTGGCGG. Deletion right flank: CTTTTTATCAGGTGAAAAAAAAATAATTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1733 |
C10G11.6(ok2212) I. |
C. elegans |
C10G11.6. Homozygous. Outer Left Sequence: GACGAAGACGACGAAGAAGG. Outer Right Sequence: GGGGTACCCGATGAGCTACT. Inner Left Sequence: TTTACCACGGAAAACCTTCG. Inner Right Sequence: TTTTGGTGATTCATCGGGTT. Inner Primer PCR Length: 3386 bp. Deletion Size: 1357 bp. Deletion left flank: TTCCGTCTCCGTTTGTTCGAAAAATTCCCG. Deletion right flank: TTCCTCCGCCAGGACTCGTTGGAATCAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1734 |
F47G4.4(ok2219) I. |
C. elegans |
F47G4.4. Homozygous. Outer Left Sequence: GGGCACTTGAAAAGTTCTGC. Outer Right Sequence: CTCCGACTCAATTGTGAGCA. Inner Left Sequence: GGGTCGAGTTTGAGAATGGA. Inner Right Sequence: GTTGGCACCGACGAAACTAT. Inner Primer PCR Length: 2769 bp. Deletion Size: 986 bp. Deletion left flank: GCAGGGGAGAGGGAACTCCCTAGAGGGTTT. Deletion right flank: TGAGCCAAAAGTGTTGTCAAGTTACTATCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1735 |
F35E12.8(ok2220) V. |
C. elegans |
F35E12.8. Homozygous. Outer Left Sequence: TGAAAAAGCTGTGCAAGTGG. Outer Right Sequence: GGGCAGTTTCCAAATCTCAA. Inner Left Sequence: GCAGCACAATGAATCTGGAA. Inner Right Sequence: AGTTTGATTGGCCAAAGTGC. Inner Primer PCR Length: 3078 bp. Deletion Size: 1014 bp. Deletion left flank: AAATTCAAATCAGTGAGATAAACCATACTA. Deletion right flank: AATTCAAAACATATTTTAGAAAGTTATCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1736 |
F55F8.9(ok2221) I. |
C. elegans |
F55F8.9. Homozygous. Outer Left Sequence: CAGAAATCGAGCGTCTCACA. Outer Right Sequence: GAGTGTCGTTGCGAGATTCA. Inner Left Sequence: AAATGTGGTTCTGTCGAGCC. Inner Right Sequence: CATTCGATAGCCGTTGGTTT. Inner Primer PCR Length: 3096 bp. Deletion Size: 950 bp. Deletion left flank: TCCGTTCAAAGTGCTACCGTATGATGAGAA. Deletion right flank: GTGACCATGTCCATGTCCATGAGCAAATGA. Insertion Sequence: AATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1737 |
pld-1(ok2222) II. |
C. elegans |
C04G6.3. Homozygous. Outer Left Sequence: CCACTTGCCACGTATTCCTT. Outer Right Sequence: GAAGATGAAGAGTCGCGGAG. Inner Left Sequence: GGACAACGACTCCACCAGTT. Inner Right Sequence: GGTCATCTGGAACCGAAAGA. Inner Primer PCR Length: 3066 bp. Deletion Size: 1430 bp. Deletion left flank: TTGAAATCACGATCCATTAGCAATACCATC. Deletion right flank: GAATGATTCCTTAACCAAACACGTTTAATA. Insertion Sequence: GA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1738 |
C36B7.5(ok2223) X. |
C. elegans |
C36B7.5. Homozygous. Outer Left Sequence: GTTGGAGGTTTGAGATTCCG. Outer Right Sequence: CTTGATAAATGCCCACCGTT. Inner Left Sequence: GGAAAAGTTCGCTTACCGTG. Inner Right Sequence: CGAAACTTCACAGAGACGCA. Inner Primer PCR Length: 3111 bp. Deletion Size: 958 bp. Deletion left flank: CATGAGTTGCCACAACCAGTCCATGACATC. Deletion right flank: TGTCCGCGATGGATAATAGTTGGATGGATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1739 |
sma-10(ok2224) IV. |
C. elegans |
T21D12.9. Homozygous. Outer Left Sequence: CGCTTAGCACGAATACCTCG. Outer Right Sequence: GCTGGTCTTGCCTTTTTGAG. Inner Left Sequence: CACACGAGCTTGGTCACTTG. Inner Right Sequence: CCGTTTCCACACCATTCTCT. Inner Primer PCR Length: 2783 bp. Deletion Size: 906 bp. Deletion left flank: AATGGTCAACCTAGAGTTTTGGTACAGGAT. Deletion right flank: CTATCGTTTTAACTTTCAGAATTAATCTAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1741 |
C39F7.2(ok2226) V. |
C. elegans |
C39F7.2. Homozygous. Outer Left Sequence: CTGAGCCTAAACCGAACCAA. Outer Right Sequence: ATAGATTGTGTGGTGGGGGA. Inner Left Sequence: AAGCCTAAGCCAAAGCCTTC. Inner Right Sequence: GATCCAGGTTAGGTGTCGGA. Inner Primer PCR Length: 3282 bp. Deletion Size: 2315 bp. Deletion left flank: TAGCGTCAGTAGCGAGCTCACGCTCGCCAC. Deletion right flank: CTGTTCCCGCTACAAAAAGTTTCTTTTACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1742 |
ifb-1(ok2227) II. |
C. elegans |
F10C1.2. Homozygous. Outer Left Sequence: AATTAGCTTCCCCGCAATTT. Outer Right Sequence: GTTGTTGATGCCTCCTTGGT. Inner Left Sequence: CTTTAGTTGACTCCGCCCAC. Inner Right Sequence: GCAAATGCGAGAAACCCTTA. Inner Primer PCR Length: 2999 bp. Deletion Size: 2379 bp. Deletion left flank: CAATTTCTAAGTAAGTAGTGTCTTGATCTC. Deletion right flank: AGCTTTTTGGTTTTGAAATGTTGAAAATTT. Insertion Sequence: ATTTCTAAGTAAGTAGTGTCTTGATCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1743 |
C33H5(ok2228) IV. |
C. elegans |
C33H5. Homozygous. Outer Left Sequence: AAGGAGAAAGTGGCAGCAAA. Outer Right Sequence: CAGACGGACCACCAGTACCT. Inner Left Sequence: CAATGCAGGCACAAGAAGAA. Inner Right Sequence: TCGCCTGGTCATATCAATCA. Inner Primer PCR Length: 2211 bp. Deletion Size: 1217 bp. Deletion left flank: ACTTGGAGTAAATTTTAAACTGCTATATTA. Deletion right flank: TTATCTGTCCTTGATATCCTTGATATGAGT. Insertion Sequence: TATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1744 |
Y67A10A.8(ok2229) IV. |
C. elegans |
Y67A10A.8. Homozygous. Outer Left Sequence: GTTCCCAACAGCTGGATCTC. Outer Right Sequence: GGCGATGACCAAGAAAATGT. Inner Left Sequence: CTAGAATTCCCCGACTTCCC. Inner Right Sequence: AATTCACGAGCCGATTTTTG. Inner Primer PCR Length: 3333 bp. Deletion Size: 1522 bp. Deletion left flank: AATTGGAATTGACTGAAGAAGAAGAGATTT. Deletion right flank: CACTAAAATGTTTACAATTTTTGTGTTTCT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1745 |
clec-66(ok2230) II. |
C. elegans |
F35C5.9. Homozygous. Outer Left Sequence: GCCTCCAATCGTCATTTGTT. Outer Right Sequence: AAACATTGCCGTTCTGCTTT. Inner Left Sequence: ATAAAAGAGCCTGGCGTGAA. Inner Right Sequence: GAGCCCCTTTTGAAGGCTAT. Inner Primer PCR Length: 2401 bp. Deletion Size: 1187 bp. Deletion left flank: CCTCACCATCCCAAGCAGTCACCGATCGAT. Deletion right flank: TTGCCGATTCGTTTGCCGCGCACCCCTGGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1746 |
C15F1.5(ok2231) II. |
C. elegans |
C15F1.5. Homozygous. Outer Left Sequence: CACTCCGACAACAGGCAGTA. Outer Right Sequence: AGCACCGCAACTACCTCAAG. Inner Left Sequence: CGGAGTGTCGTTAGCCAGAT. Inner Right Sequence: GCCATCGTTCCATTTGTTCT. Inner Primer PCR Length: 3106 bp. Deletion Size: 1194 bp. Deletion left flank: TGTGTAATTAAATGAGCCGAAAAACTATAC. Deletion right flank: AACCAAGACTTGCAACATTTTTCAAGCAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1747 |
R10E11.3(ok2232) III. |
C. elegans |
R10E11.3. Homozygous. Outer Left Sequence: GGCGGCAATTTGAACTTTTA. Outer Right Sequence: CGTTTCAGAAGAGTCTCGGG. Inner Left Sequence: GAGAAGGTGCTAATGCGCTC. Inner Right Sequence: TTGGATCATCAGCAGCGTAG. Inner Primer PCR Length: 2429 bp. Deletion Size: 1440 bp. Deletion left flank: TTGGAAATACATGTTACTGCAACTCAGTGA. Deletion right flank: CGCAGCATAATAATGATCAAATTTTCAGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1750 |
Y75B8A.5(ok2240) III. |
C. elegans |
Y75B8A.5 Homozygous. Outer Left Sequence: tcttgaaagggtgttttgcc. Outer Right Sequence: gtaaggaagggcttccaggt. Inner Left Sequence: tttcatttctgggcgttttc. Inner Right Sequence: ttccgatgtgcaaaaattca. Inner Primer PCR Length: 3181. Deletion size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1751 |
H08M01.2(ok2241) IV. |
C. elegans |
H08M01.2 Homozygous. Outer Left Sequence: tggagcaagattctcagcaa. Outer Right Sequence: ccaactccggctaaatgttc. Inner Left Sequence: tgatggacaggttcaaccaa. Inner Right Sequence: accgtttctcaacttctgcc. Inner Primer PCR Length: 3276. Deletion size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1752 |
E01G4.3(ok2242) II. |
C. elegans |
E01G4.3. Homozygous. Outer Left Sequence: CACAAATACGTTGGCATTCG. Outer Right Sequence: GATTGCCGATTTGCCTTAAA. Inner Left Sequence: CTGATGCTGTTGCTGGTGTT. Inner Right Sequence: GAGAAACGGCAAGCAAACTC. Inner Primer PCR Length: 2562 bp. Deletion Size: 1672 bp. Deletion left flank: AATTCCGAAAAAATCCCGAATACCCTGCGG. Deletion right flank: CAAAGATCTCCGTATCACTGACAAAAAGAT. Insertion Sequence: TCTCCGTATCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1754 |
Y32B12A.3(ok2244) V. |
C. elegans |
Y32B12A.3. Homozygous. Outer Left Sequence: GGTGTGCCATTAGGCATTTT. Outer Right Sequence: GAATCGGATCAGTGGAGGAA. Inner Left Sequence: GGTTTTTGACGCCAATGTTT. Inner Right Sequence: CTCTCCCAGCAGAGAAATCG. Inner Primer PCR Length: 2108 bp. Deletion Size: 1023 bp. Deletion left flank: AATCAAAGGGTGATAATAGTTCGAACAAAT. Deletion right flank: CTGATCGCTGGCTCTCGTGGGAAAAGACGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1755 |
gur-3(ok2245) X. |
C. elegans |
ZC504.5 Homozygous. Outer Left Sequence: gttggctcaatatggggaaa. Outer Right Sequence: gcgtcgaatacgttggagtt. Inner Left Sequence: ggcggtgagagtaagctttg. Inner Right Sequence: aaatggacgtcaccaaggag. Inner Primer PCR Length: 3321. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1756 |
gur-3(ok2246) X. |
C. elegans |
ZC504.5. Homozygous. Outer Left Sequence: GTTGGCTCAATATGGGGAAA. Outer Right Sequence: GCGTCGAATACGTTGGAGTT. Inner Left Sequence: GGCGGTGAGAGTAAGCTTTG. Inner Right Sequence: AAATGGACGTCACCAAGGAG. Inner Primer PCR Length: 3319 bp. Deletion Size: 2376 bp. Deletion left flank: ACTGTCATAAATAAATTGAGTTTACGTATT. Deletion right flank: TTTCTGCAATCTTCATTAGAACTGAACAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1757 |
F28A10(ok2260) II. |
C. elegans |
F28A10. Homozygous. Outer Left Sequence: CGAACGAGAAAGGAAACTCG. Outer Right Sequence: TCCGACGCTTACAGGTCTCT. Inner Left Sequence: ACTCTGGAGAGCGGAAGATG. Inner Right Sequence: AGTCGAGAAGCAGAACACCC. Inner Primer PCR Length: 2073 bp. Deletion Size: 604 bp. Deletion left flank: GATTTTATGAATTAGTTTTTAATAAAGATT. Deletion right flank: TAAACCAGACATAGTTGGGGAAAAAATTAA. Insertion Sequence: TG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1758 |
ZK1025.3(ok2261) I. |
C. elegans |
ZK1025.3 Homozygous. Outer Left Sequence: taaatttttccggcagatcg. Outer Right Sequence: cgggtgctttcttgaatcat. Inner Left Sequence: ggaattgaaattttcggcaa. Inner Right Sequence: cttccgtactcccgatttga. Inner Primer PCR Length: 2408. Deletion size: about 2100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1759 |
acbp-3(ok2262) X. |
C. elegans |
F47B10.7. Homozygous. Outer Left Sequence: ACCAGCGCCAATGATAAAAA. Outer Right Sequence: TTTTGCATGTTGTCTACCGC. Inner Left Sequence: AGCCCGTTTGTCCTTGTAAA. Inner Right Sequence: AATTTCCTTCTCGGGTGCTC. Inner Primer PCR Length: 2288 bp. Deletion Size: 1201 bp. Deletion left flank: AAAGTTTTGAAGAAATGTAGAGTGTCGTTT. Deletion right flank: ATACTAAATAAATATGAATTAATTTTGTAA. Insertion Sequence: ACTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1760 |
dpy-3(ok2263) X. |
C. elegans |
EGAP7.1. Homozygous. Outer Left Sequence: AACAACAAAGTCCAAACGCC. Outer Right Sequence: CAACAAATTCACGTTGGACG. Inner Left Sequence: GTGTGTGTGTGGGGTGAGAG. Inner Right Sequence: CCCCATTTACCTCCCAGATT. Inner Primer PCR Length: 2434 bp. Deletion Size: 951 bp. Deletion left flank: TTCTTTTTCTTTTGGGAAATTCATACATGG. Deletion right flank: ATGCTGTACGTGATTGTAGACAAGTGGAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1761 |
F10F2.7(ok2264) III. |
C. elegans |
F10F2.7. Homozygous. Outer Left Sequence: CACATCCCTCCACCAATTCT. Outer Right Sequence: ATGTACCCGACTGAAGCCTG. Inner Left Sequence: ATTCCACACCCTGCTTTTTG. Inner Right Sequence: GACATGACTTGGCTTGGCTT. Inner Primer PCR Length: 2889 bp. Deletion Size: 912 bp. Deletion left flank: GATTAGATTTTGGGATCCGTTACGGCTAGT. Deletion right flank: CCTCTTGTCACATCAGAATCTGCGTACATG. Insertion Sequence: ATGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1762 |
dsl-6(ok2265) IV. |
C. elegans |
H02I12.4. Homozygous. Outer Left Sequence: AAATAGCCCCAAAGATCGCT. Outer Right Sequence: TTCAAAAATGCCCACATCAA. Inner Left Sequence: GTTCTTGCATGAGCAGTCCA. Inner Right Sequence: GAGGGAGTTAGAGCAGCCAG. Inner Primer PCR Length: 2315 bp. Deletion Size: 1811 bp. Deletion left flank: TCACATTTTTCACCGAACCAGTTTCTGAAA. Deletion right flank: CATAAATGATCAAATTAACATTTTTTACAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1763 |
K11E4.3(ok2266) X. |
C. elegans |
K11E4.3 Homozygous. Outer Left Sequence: ttgacttgcaccttcattcg. Outer Right Sequence: agaaacttcatcacgcccac. Inner Left Sequence: gatgccagttgggaaagaaa. Inner Right Sequence: aaaataatgcagtttgcgcc. Inner Primer PCR Length: 2991. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1764 |
trxr-2(ok2267) III. |
C. elegans |
ZK637.10. Homozygous. Outer Left Sequence: GCGAATATCCGATAGCGATT. Outer Right Sequence: CAAGACCCTTCCAAACCAAA. Inner Left Sequence: CCAATCAGGCGTCTCTTCTC. Inner Right Sequence: GCTCAAAGCCTGTTCAATCC. Inner Primer PCR Length: 3171 bp. Deletion Size: 1649 bp. Deletion left flank: TTGTAATTGGAGCAGGATCTGGAGGACTTT. Deletion right flank: TAAGGATAGCGGTTTTTGTTATGTGAAAGC. Insertion Sequence: TTTGTAGCGGTTTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1765 |
abt-5(ok2268) I. |
C. elegans |
Y53C10A.9. Homozygous. Outer Left Sequence: GTTGTTCTGGGTGCCTTTGT. Outer Right Sequence: TCCCAAAGAAACACGACTCC. Inner Left Sequence: CTTGCACAGTCGTGATGCTT. Inner Right Sequence: AGCGAGACCCTGAAAGTGAA. Inner Primer PCR Length: 2886 bp. Deletion Size: 2067 bp. Deletion left flank: TTGAGTTGACGGACAAACGGAATACATTGG. Deletion right flank: TAGAGCGGCGTTCGCGCCTCGCTCAGCTGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1766 |
C12D8.1(ok2270) V. |
C. elegans |
C12D8.1 Homozygous. Outer Left Sequence: aaagaagttgtggtgccgac. Outer Right Sequence: aatggaaggatttaacccgc. Inner Left Sequence: ccgttagccgaaaaattgaa. Inner Right Sequence: cgaatacttgtttgaacccca. Inner Primer PCR Length: 3085. Deletion size: about 2700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1767 |
clec-39(ok2271) V. |
C. elegans |
T25E12.7. Homozygous. Outer Left Sequence: TGGCTGCCTTGCTAGAAAAT. Outer Right Sequence: GTTATTGCACGGGAGACGTT. Inner Left Sequence: GACATTCACACAATCACCGC. Inner Right Sequence: GGGAAAGTGCTCAACTACCG. Inner Primer PCR Length: 2219 bp. Deletion Size: 1334 bp. Deletion left flank: GGTGCCACTCTTTTTTCCATAAAAAGTGAA. Deletion right flank: AATTTTAGAAATTAAAAAAAAAATCACATA. Insertion Sequence: AAATTTTAGAAATTAAAAAAAATTTTAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1768 |
T07D1.3(ok2272) X. |
C. elegans |
T07D1.3. Homozygous. Outer Left Sequence: AATGACACGTGCGACCATTA. Outer Right Sequence: AAAAATGCGGTTTCGTGTTC. Inner Left Sequence: CTTCGGAATATTTGCCTCCA. Inner Right Sequence: AAAAAGTGCCAACAACTGGC. Inner Primer PCR Length: 2130 bp. Deletion Size: 1260 bp. Deletion left flank: TTGGATTAAATGAAGAAATGCTTTTGTTAA. Deletion right flank: TGCATATTTTGGTGGTTTATCTAGTGTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1769 |
mig-2(ok2273) X. |
C. elegans |
C35C5.4. Homozygous. Outer Left Sequence: CCGAGGTTTTCGTTTTTCAA. Outer Right Sequence: AATGACTGGGAAACGTCCAA. Inner Left Sequence: TTTTGTTCCACGCTTTGTCA. Inner Right Sequence: ATGATCGGGAAGAAGAGCCT. Inner Primer PCR Length: 2116 bp. Deletion Size: 1192 bp. Deletion left flank: ATTTTCGCCAACTTTTCATTCCCTAACTTT. Deletion right flank: TTTTGTTGAAACTCATAAAACTATATCTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1770 |
nac-3(ok2274) III. |
C. elegans |
K08E5.2. Homozygous. Outer Left Sequence: AACAAATGGGTGAGGGATCA. Outer Right Sequence: ATTCCCTCAGAGCCCAATTT. Inner Left Sequence: GGGAACTGTAAAGGGTGATCG. Inner Right Sequence: AAAACTGACGCTTTTCACCG. Inner Primer PCR Length: 3136 bp. Deletion Size: 1560 bp. Deletion left flank: ATTTAAACACTATAGCAGTTTCCAAAACTC. Deletion right flank: GAGAAATCTTTGAATTCTCTGAGAAACTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1771 |
Y52D3.1(ok2275) III. |
C. elegans |
Y52D3.1 Homozygous. Outer Left Sequence: cagtgtgttcgcctaaccct. Outer Right Sequence: aatcgataacgggaacatgc. Inner Left Sequence: atcaatgagaaatcggctgc. Inner Right Sequence: gaggaggacgagtcgttgag. Inner Primer PCR Length: 2513. Deletion size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1772 |
K08B12.2(ok2276) V. |
C. elegans |
K08B12.2. Homozygous. Outer Left Sequence: TCCTTTTTGTCGTTGCATTG. Outer Right Sequence: GGAGTGAACCCGATCTTGAA. Inner Left Sequence: CGTTTGTCGTTGTTGCATCT. Inner Right Sequence: GCAAGAAGAAAATGGGTGGA. Inner Primer PCR Length: 2599 bp. Deletion Size: 914 bp. Deletion left flank: GAGCGGAATGGAATGAAGAGTGTGTGTGTG. Deletion right flank: ATGTCAATGAGAGCTAACGCCATCATCAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1773 |
slc-5A12(ok2281) IV. |
C. elegans |
ZK822.5. Homozygous. Outer Left Sequence: GCGATTTTTGGATTGAGCAT. Outer Right Sequence: TTTCAAATTTCCGGATCACC. Inner Left Sequence: GCTTTTCATTGCGATTTCGT. Inner Right Sequence: CACGCAATTTGTCATGCTTT. Inner Primer PCR Length: 2857 bp. Deletion Size: 1318 bp. Deletion left flank: TCGAGGGGACAGAACAGCAAAAGAGGAATA. Deletion right flank: GGCAATTTATGAAGATTTCTTGAAAAATAG. Insertion Sequence: AAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1774 |
pcca-1(ok2282) X. |
C. elegans |
F27D9.5. Homozygous. Outer Left Sequence: ACGCTTATTTCCGAGCTTCA. Outer Right Sequence: ACGTAAAGATGGCCGATGAG. Inner Left Sequence: AACAACCTTTTTGCAATGCC. Inner Right Sequence: GAAGCTCCAACTGCCAAATC. Inner Primer PCR Length: 3054 bp. Deletion Size: 1754 bp. Deletion left flank: AAATTTGAGAAACTGCGAATGAAATTATCA. Deletion right flank: CGAGCTTGCTTGTCGTTCCAGGCAACTCGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1775 |
strd-1(ok2283) III. |
C. elegans |
Y52D3.1. Homozygous. Outer Left Sequence: CAGTGTGTTCGCCTAACCCT. Outer Right Sequence: AATCGATAACGGGAACATGC. Inner Left Sequence: ATCAATGAGAAATCGGCTGC. Inner Right Sequence: GAGGAGGACGAGTCGTTGAG. Inner Primer PCR Length: 2514 bp. Deletion Size: 1015 bp. Deletion left flank: GGAGCAAAACTGACGAAACTTCGTATCACA. Deletion right flank: TAGGGACTCTCTTTTCTCAAAATTGGATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1776 |
T11F9.1(ok2284) V. |
C. elegans |
T11F9.1. Homozygous. Outer Left Sequence: AAATGTCACGTCATCACCGA. Outer Right Sequence: ACCGTAATCCTCCACCCTCT. Inner Left Sequence: TCTTCCCGTTTCGGAAATAC. Inner Right Sequence: GAAATCGAGGCAAAGGATGA. Inner Primer PCR Length: 3090 bp. Deletion Size: 1665 bp. Deletion left flank: GCTGTGTGCATCATAAATATCCTCGAAAAC. Deletion right flank: CGTGATTCGAAAAAATAGTCTTCATCGAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1777 |
F45E4.3(ok2285) IV. |
C. elegans |
F45E4.3. Homozygous. Outer Left Sequence: AAAAGTTGCGCTTCCAAAAA. Outer Right Sequence: TCAAAACGAATCAACGACCA. Inner Left Sequence: CGCTTTTGTAGAAAAACACGG. Inner Right Sequence: TGCATCGGCATTTGTTGTAT. Inner Primer PCR Length: 3120 bp. Deletion Size: 2410 bp. Deletion left flank: TTTGAGATATCAAACGATCGGAAACTAGTA. Deletion right flank: CCGACAGTATGGAGCCGCACCACCTCCAAC. Insertion Sequence: ATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1778 |
F09A5.1(ok2286) X. |
C. elegans |
F09A5.1. Homozygous. Outer Left Sequence: AGGTGTTCTACCCGATGTGC. Outer Right Sequence: TGCCGTTTGTGTACGACTTC. Inner Left Sequence: AATTTGTGGATATCTCGGCG. Inner Right Sequence: AACAAGTCTTCGTGCATCCC. Inner Primer PCR Length: 3224 bp. Deletion Size: 1465 bp. Deletion left flank: GCTGGTCGGCATCGTCATTTGGCTCATTTG. Deletion right flank: CTTAGTTCGACTTAAATTAGTTTGAAACAA. Insertion Sequence: TTCTTAGTTCGACTTCTTAGTTCTCTTAGTTCTCTTAGTTCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1779 |
fbxb-67(ok2287) I. |
C. elegans |
F49B2.2. Homozygous. Outer Left Sequence: ACAATGCAACACCCTGTCAA. Outer Right Sequence: TCACAGGTGAATGAGAAGCG. Inner Left Sequence: TATCCCAAACAGGTTGCACA. Inner Right Sequence: GGGAAATGAGCTAGAAGGGG. Inner Primer PCR Length: 2132 bp. Deletion Size: 1154 bp. Deletion left flank: CTACTCTTTGCCCCTTATTGCTCTTCTGTA. Deletion right flank: AGGTGAAAGTTTACATAGGACACCCCTTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1780 |
rgs-3(ok2288) II. |
C. elegans |
C29H12.3. Homozygous. Outer Left Sequence: CAGCATCTACCCGGACATCT. Outer Right Sequence: GGACAGTCAATGAAAGGGGA. Inner Left Sequence: AGAAATCGCAGGATTCCCTT. Inner Right Sequence: CTGATCTTCAAGCGGGAAAG. Inner Primer PCR Length: 3116 bp. Deletion Size: 1843 bp. Deletion left flank: TGTTAGATGTAAATTATAATTACTATGTTG. Deletion right flank: GCCAACGCGATGAACAATCTAGGAAAGGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1781 |
his-71(ok2289) X. |
C. elegans |
F45E1.6. Homozygous. Outer Left Sequence: GCAGAAAGAACTGAAACGGC. Outer Right Sequence: CCAAGTCCCACACTCGTTTT. Inner Left Sequence: TGTTCCCGTTCACAATCGTA. Inner Right Sequence: AAACTCAAAACCGGCAAATG. Inner Primer PCR Length: 2285 bp. Deletion Size: 991 bp. Deletion left flank: CCCAACGAGGTAGGCCTCAGAAGCCTCTTG. Deletion right flank: AGATGGCTGTGAGCGAGAGCGAGGCAATGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1782 |
twk-37(ok2298) I. |
C. elegans |
C48E7.9 Homozygous. Outer Left Sequence: ccgtaacgagaaattgcaca. Outer Right Sequence: ttgagctcgccaagtttctt. Inner Left Sequence: cgctgggaggtcaaataaaa. Inner Right Sequence: cgaggtttgcagaatcattg. Inner Primer PCR Length: 2181. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1784 |
dnj-27(ok2302) I. |
C. elegans |
Y47H9C.5 Homozygous. Outer Left Sequence: aaatctccaatggatgctcg. Outer Right Sequence: accatggagcaaagaaatcg. Inner Left Sequence: gccggtgtgtcataaggatt. Inner Right Sequence: atccatggttccgatgagtc. Inner Primer PCR Length: 3121. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1785 |
Y105E8A.11(ok2303) I. |
C. elegans |
Y105E8A.11 Homozygous. Outer Left Sequence: atccgaagcagcaattcaag. Outer Right Sequence: ggatcaaacccaaggatgaa. Inner Left Sequence: tcgattgtgcaatgacgttt. Inner Right Sequence: tttcaagcgaatcaatggag. Inner Primer PCR Length: 3030. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1786 |
Y105E8A.11(ok2304) I. |
C. elegans |
Y105E8A.11 Homozygous. Outer Left Sequence: atccgaagcagcaattcaag. Outer Right Sequence: ggatcaaacccaaggatgaa. Inner Left Sequence: tcgattgtgcaatgacgttt. Inner Right Sequence: tttcaagcgaatcaatggag. Inner Primer PCR Length: 3030. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1787 |
F56F11.5(ok2305) III. |
C. elegans |
F56F11.5. Homozygous. Outer Left Sequence: ACAAGCTGAAAATGCCCAAC. Outer Right Sequence: ATTGCCAAAAGTTCGATTGC. Inner Left Sequence: CAGAAATGTCCATGAAATTAACAAA. Inner Right Sequence: CAGGCTCCAGTTCGAAGTTT. Inner Primer PCR Length: 3054 bp. Deletion Size: 2283 bp. Deletion left flank: TAACTCGGCTATAGCCTATAGCCGAGTTTC. Deletion right flank: TAATAGTGCCACACTGTGCGTAATTATTAT. Insertion Sequence: TGAGATTTTTCAACTTTTCAAAAAATCTTATAAAATCTAGAATTTTTTTGAATTTTTTA AGCATGATATTTTGGTCTTTATGGCCCCATAGGCATGTTTTAAAGCAATTCCCACACAT AGTGTAGTCCATCTTTAAGTTTCTATGTATAAAAGTAATTTTTACCATTGCTTTTGCTT TGTAGGCAATCGCCATGATTTCCAGACTTCGTTGAGACTTTTCAATTATATAATCACGG TAAGACTTCGAACTATCTTTTCTTGATTGCGAAAACGAGGATGTGTAGTCAGCTTGCAA TGCTTCTATTGCTTGACGTGGTCCCTGTTCCCCATTCAATTGAAGGTGAGTTATTACCT TACACGCAAGTTGTTCAAGTTCTCTGCAAATTTACAATTGAAAACTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1788 |
cyp-35A1(ok2306) V. |
C. elegans |
C03G6.14. Homozygous. Outer Left Sequence: AAAGCTTTTGTTGGAGGTGC. Outer Right Sequence: TGATTCCTTTTGGAGTTGGG. Inner Left Sequence: GATGCATAGTAAGGAAATCTGGG. Inner Right Sequence: TCCACTACCGAGCTTATGCC. Inner Primer PCR Length: 3112 bp. Deletion Size: 1494 bp. Deletion left flank: TTGATATCCTCAATTCTAAATCAAGCAATC. Deletion right flank: TCACCAGAATACAATTTAAAAACCTTTAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1789 |
met-2(ok2307) III. |
C. elegans |
R05D3.11. Homozygous. Outer Left Sequence: AGGGTTTCGGTTTTTCGATT. Outer Right Sequence: TATCTTTGGAGTGCCGGTTT. Inner Left Sequence: CGTCCCGTATATTTTTCAACG. Inner Right Sequence: CCGTTTTGAAATTTGTTTCCTT. Inner Primer PCR Length: 3056 bp. Deletion Size: 1320 bp. Deletion left flank: AAAAAGGAGAAAGAAATCATGAAAATTTTG. Deletion right flank: GTTACGGAGGAGACGAGTCAGATTATGATG. Insertion Sequence: AAAAAAAATTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1790 |
D2096.3(ok2317) IV. |
C. elegans |
D2096.3 Homozygous. Outer Left Sequence: aactaccgcttatcggctcc. Outer Right Sequence: cacactctgcgaggaaacaa. Inner Left Sequence: gatttttgctcgtagtcccg. Inner Right Sequence: cggtgcaatcataagagcag. Inner Primer PCR Length: 3134. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1791 |
amt-1(ok2318) X. |
C. elegans |
C05E11.4. Homozygous. Outer Left Sequence: CTGTCCCATCCGATTCTGTT. Outer Right Sequence: GTGTGTGCTTCACATGTCCC. Inner Left Sequence: ATTTCGAAAAATGACGACGC. Inner Right Sequence: CTAATTCGACGGCAAAGAGC. Inner Primer PCR Length: 2473 bp. Deletion Size: 1043 bp. Deletion left flank: TTTTATATATCCCCAATAATTTTCAGTCAT. Deletion right flank: ATGATAAGGTATTTCTTTAAAAGTCAGGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1792 |
inx-7(ok2319) IV. |
C. elegans |
K02B2.4. Homozygous. Outer Left Sequence: AGCTAGTCATGGGGAGCAAA. Outer Right Sequence: ACGTCTGAAGGTTCGTGCTT. Inner Left Sequence: GGCTGTCTTCGGAATTTTTG. Inner Right Sequence: CAAGTGCGTCGTTCATCATC. Inner Primer PCR Length: 3021 bp. Deletion Size: 1610 bp. Deletion left flank: AGTTCTGAAAATTGAAATTATTTTAAATTT. Deletion right flank: TTTTTTGACAAATCTCGGTCGATTTCCACC. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1793 |
Y24D9A.2(ok2320) IV. |
C. elegans |
Y24D9A.2 Homozygous. Outer Left Sequence: aattcgcgaaaacgaaacaa. Outer Right Sequence: attgacggagaaaagagcga. Inner Left Sequence: ctccaatgcctgtagatgcc. Inner Right Sequence: aaaattgggaaaatggtggg. Inner Primer PCR Length: 3188. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1794 |
F53A2.7(ok2322) III. |
C. elegans |
F53A2.7 Homozygous. Outer Left Sequence: gaagaagaccagctcggttg. Outer Right Sequence: accttcgaaatgccaatgtc. Inner Left Sequence: gccattctgcttctttttcg. Inner Right Sequence: ccgatctgaaaattggcatt. Inner Primer PCR Length: 2349. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1795 |
fat-1(ok2323) IV. |
C. elegans |
Y67H2A.8 Homozygous. Outer Left Sequence: cgcaatgagactggcttaca. Outer Right Sequence: taagttcctgcaaaacgcct. Inner Left Sequence: gtcgctcattcctcagaagg. Inner Right Sequence: agttgaaccacaggaaacgg. Inner Primer PCR Length: 2875. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1796 |
set-21(ok2327) IV. |
C. elegans |
Y24D9A.2. Homozygous. Outer Left Sequence: AATTCGCGAAAACGAAACAA. Outer Right Sequence: ATTGACGGAGAAAAGAGCGA. Inner Left Sequence: CTCCAATGCCTGTAGATGCC. Inner Right Sequence: AAAATTGGGAAAATGGTGGG. Inner Primer PCR Length: 3169 bp. Deletion Size: 1604 bp. Deletion left flank: TTTGCTGGCAGAACAGGGCACATCGACGGA. Deletion right flank: CACTCGGTACGATAAATGGAACAAGGATAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1797 |
citk-1(ok2328) II. |
C. elegans |
W02B8.2. Homozygous. Outer Left Sequence: CAAATTTGCCGAACATTTCA. Outer Right Sequence: TGCTTCATGTCTACAAGGCG. Inner Left Sequence: GAAATTTGCCGATTTGCC. Inner Right Sequence: TAAACCGGCCTCGTGTCTAC. Inner Primer PCR Length: 3065 bp. Deletion Size: 1711 bp. Deletion left flank: CTCAAGGTGGAAGAGGAGCTCCAGGAGAAG. Deletion right flank: GGCACAAGGCCTCAAGGTAGACGTAGGTAA. Insertion Sequence: CCTATACTTACCTCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1798 |
zig-7(ok2329) I. |
C. elegans |
F54D7.4. Homozygous. Outer Left Sequence: AGCGAGAGACGCAGAGAAAC. Outer Right Sequence: ATTTTCCCAATGTCAACCCA. Inner Left Sequence: AGAAAGGGGGAAACTCGGT. Inner Right Sequence: TGCTTGGCGAGTCTAGTGAA. Inner Primer PCR Length: 3106 bp. Deletion Size: 1931 bp. Deletion left flank: GAATCGATGAGTTTTATTTTCTCGTTTGCC. Deletion right flank: AGAAATTAATTTTTCAAAAAAAGAAAGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1799 |
Y71F9B.8(ok2333) I. |
C. elegans |
Y71F9B.8. Homozygous. Outer Left Sequence: ACAACCTGATGAGGGGTGAG. Outer Right Sequence: TGCCGGAATTGAAATTCTTC. Inner Left Sequence: TCGTTTGAACAATCGGAACA. Inner Right Sequence: TCCAGACCCTCATCATCTCC. Inner Primer PCR Length: 2841 bp. Deletion Size: 1153 bp. Deletion left flank: TGAAAATCTAGAGTCTTGTAATTGGGACTT. Deletion right flank: ATTTTTTGTAGATCAAACCGTGATGGGACA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1800 |
gpa-17(ok2334) III. |
C. elegans |
Y71H2B.7. Homozygous. Outer Left Sequence: GCCTCCTCAATCCTCAATCA. Outer Right Sequence: TTCCAGTACACAATCGCCTG. Inner Left Sequence: GAAGACGGCAATGATACGGT. Inner Right Sequence: TTGAGCATCAGTTGCCTGAG. Inner Primer PCR Length: 2552 bp. Deletion Size: 1693 bp. Deletion left flank: TTTCCAATTAGTGGTGGTGATTTTTGCCTG. Deletion right flank: AGGGAAAAAAGGGAAAACCGGAGAATTATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1801 |
csb-1(ok2335) X. |
C. elegans |
F53H4.1. Homozygous. Outer Left Sequence: ACAACTGGGAGAAAACCGTG. Outer Right Sequence: AGGAAGGTGTCGAGTGGTTG. Inner Left Sequence: GGCTGGGGGATTCAAATTAT. Inner Right Sequence: GAAGACTGATCATCGGAGCG. Inner Primer PCR Length: 3043 bp. Deletion Size: 1620 bp. Deletion left flank: CATCCGTTTCTTGGCGGCCTTCTTCTCCAC. Deletion right flank: TCGAGCTTTCGGAAACCACTGGTTCAGCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1802 |
F54E4.4(ok2336) X. |
C. elegans |
F54E4.4. Homozygous. Outer Left Sequence: CGATTGGGCCCTATTTAACA. Outer Right Sequence: TACAGCTGCCAGATGGATCA. Inner Left Sequence: TCATGTCTTATGGTGAAATTTTGG. Inner Right Sequence: AAGGAGTGAAGTGTGCAGAATG. Inner Primer PCR Length: 3144 bp. Deletion Size: 1217 bp. Deletion left flank: ACTCACTGTAGTAGTAGTTGTGGGTAAAGT. Deletion right flank: ATAAATGCGGGAAAAGCGGACGATCTTCTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1803 |
clec-65(ok2337) II. |
C. elegans |
F35C5.8. Homozygous. Outer Left Sequence: TTAATGGTGTTCGGGACCTC. Outer Right Sequence: GGCAAATTTTGACATCGCTT. Inner Left Sequence: AGCAGCATCGCCAACTCTAT. Inner Right Sequence: GCAAATTGCCGGAATTAAAA. Inner Primer PCR Length: 2174 bp. Deletion Size: 1580 bp. Deletion left flank: AACTCTATCCGTCAGTGACAGACGATGCGG. Deletion right flank: GTACTCACTTCTGTGTATTTTTTTTGCTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1804 |
T22D1.11(ok2338) IV. |
C. elegans |
T22D1.11 Homozygous. Outer Left Sequence: ttggggatgttcaattggtt. Outer Right Sequence: aacgactcaaaagctcagcc. Inner Left Sequence: atattggcagacacgcgatt. Inner Right Sequence: gccagagagctgctcaaaat. Inner Primer PCR Length: 2803. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1805 |
T05E8.1(ok2339) I. |
C. elegans |
T05E8.1. Homozygous. Outer Left Sequence: TGTTCCGGTTTCAGCTCTCT. Outer Right Sequence: TTTCCACCAAATCGACATGA. Inner Left Sequence: ACAATCCAAGGACCAACAGC. Inner Right Sequence: CCAGCAAAAATGGCAAATCT. Inner Primer PCR Length: 3175 bp. Deletion Size: 1978 bp. Deletion left flank: TCCTTTGTCTGTACTTCATACAAAACAATG. Deletion right flank: TTATTAGTAATTAAGCATCTTAAGAGTATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1806 |
fbxb-8(ok2340) I. |
C. elegans |
F49B2.1. Homozygous. Outer Left Sequence: TCGATTCGAATGGTTGTTCA. Outer Right Sequence: ACGTCATATGTGGCGCATTA. Inner Left Sequence: ACATAGGACACCCCTTGTCG. Inner Right Sequence: CCCGCATTTTTGTAGATCGT. Inner Primer PCR Length: 2880 bp. Deletion Size: 1799 bp. Deletion left flank: AGCTTCGATCACGATTCAGAGCAGTTTTGT. Deletion right flank: TCAATCCCGGCAATTTGCCGATTTACTGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1807 |
F55G11.2(ok2341) IV. |
C. elegans |
F55G11.2. Homozygous. Outer Left Sequence: ATGGCATTTGTTAAGCCCTG. Outer Right Sequence: TAGCTTGTCGTTGTCGTTGC. Inner Left Sequence: TTTGTGTTGTTTGGCTCGTC. Inner Right Sequence: CTTGCGGTCCAAAAGACATT. Inner Primer PCR Length: 2122 bp. Deletion Size: 1155 bp. Deletion left flank: ACTAGCTTCCAAGTTGACTATATTAATATT. Deletion right flank: ACTGTAATTCACAAATTTTAGATAAGTTAA. Insertion Sequence: TTGACTATATTAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1808 |
glr-2(ok2342) III. |
C. elegans |
B0280.12. Homozygous. Outer Left Sequence: AGCATCATGAGCAAATGCAG. Outer Right Sequence: ATATTGGTTTCCCTTTCCCG. Inner Left Sequence: TTTCCTCAAGGGCTCTCAAA. Inner Right Sequence: CTCACCTTCTCGGGCAATTA. Inner Primer PCR Length: 2675 bp. Deletion Size: 1229 bp. Deletion left flank: GATATTTCGGAGATTTCTCGTGCAGATATG. Deletion right flank: CAAGCAGTTATTTATGTGCCTACTTGAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1809 |
ins-30(ok2343) I. |
C. elegans |
ZC334.2. Homozygous. Outer Left Sequence: CCATCTGACGTTGCTCAGAA. Outer Right Sequence: GGAGCATGAGCACAACTCAA. Inner Left Sequence: AGGCTCGTAGATGCCAAAAA. Inner Right Sequence: TGATCTACCTCTGCATCCCC. Inner Primer PCR Length: 2309 bp. Deletion Size: 1078 bp. Deletion left flank: TTTTAGAAGACAATTATCAGTTGAAAAATC. Deletion right flank: TTTATCAACAAACTCCTTCCGCAAGTCTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1810 |
cpr-5(ok2344) V. |
C. elegans |
W07B8.5. Homozygous. Outer Left Sequence: AATCGAGTCTGCGGTTTCAG. Outer Right Sequence: CAACGTTCTCTCGCATCAAA. Inner Left Sequence: GGTTTTTCACCTCGAATGGA. Inner Right Sequence: TTGTGACACCCCGAAATTCT. Inner Primer PCR Length: 3132 bp. Deletion Size: 2015 bp. Deletion left flank: TTGTTTGTTCCGTCCATTCTACACTGAGTC. Deletion right flank: TTATCAGTTAATTTTATCAGTATCTTTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1811 |
C03B1.5(ok2345) X. |
C. elegans |
C03B1.5. Homozygous. Outer Left Sequence: GCGTGTAATCATGCAAATCG. Outer Right Sequence: TTGCATCTTCACAGGCTCAC. Inner Left Sequence: TTGCACGTCCACAATGAAAT. Inner Right Sequence: TGAAAATTGAACACAGGCCA. Inner Primer PCR Length: 2279 bp. Deletion Size: 1310 bp. Deletion left flank: GGCGATACTTCTCTATTCCTTATGAAGGAC. Deletion right flank: TTCTCAAGGGAGAGAATCCGTTCAAAAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1812 |
atn-1(ok84) V. |
C. elegans |
W04D2.1 Homozygous. Outer Left Sequence: agatgccattgacaccttcc. Outer Right Sequence: tattctgtctgtaccggacg. Inner Left Sequence: attcacagcctggtgcaact. Inner Right Sequence: atggaatcgcttcgtgtcgg. Deletion size: about 1136 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1813 |
F39B1.1(ok2346) X. |
C. elegans |
F39B1.1. Homozygous. Outer Left Sequence: ACATGGAACATTTCGGTGGT. Outer Right Sequence: AACGCAACGTCACTCTTGTG. Inner Left Sequence: GCCGATCTCCAATACCAAGA. Inner Right Sequence: CTGCTGCATCGAAAGTCGTA. Inner Primer PCR Length: 3242 bp. Deletion Size: 1597 bp. Deletion left flank: CGCATGTCATCGTCACGCTGGAAAGCATCA. Deletion right flank: TAACACTTACATAAAGGTCCAATGGAATCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1814 |
R151.1&R151.4(ok2347) III. |
C. elegans |
R151.4, R151.1. Homozygous. Outer Left Sequence: GTGCAAAGCCATATCCACCT. Outer Right Sequence: CGTGGGTCTCTATCGGTTGT. Inner Left Sequence: TTTTCCTAATTGTGGTCGCC. Inner Right Sequence: CAGCAGTCTGAACCCTCTCC. Inner Primer PCR Length: 2360 bp. Deletion Size: 1306 bp. Deletion left flank: ATATTCTATATCGACCACCAAATGAAGTAA. Deletion right flank: CAATGTGGCAGATAAGGATATTCTAAATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1815 |
vit-3(ok2348) X. |
C. elegans |
F59D8.1 Homozygous. Outer Left Sequence: atgcggtcgttctcaacttc. Outer Right Sequence: gcacattgctgaccttctca. Inner Left Sequence: cggtggaattcctcaacatc. Inner Right Sequence: ggatttgcttcaaagaccca. Inner Primer PCR Length: 3061. Deletion size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1816 |
gpa-16(ok2349) I. |
C. elegans |
Y95B8A.5 Homozygous. Outer Left Sequence: agcgcaatggggtgtattat. Outer Right Sequence: cgaatcggaccaaacactct. Inner Left Sequence: agcgaaacgaagatccaaga. Inner Right Sequence: attcgtgatcgagtgtggtg. Inner Primer PCR Length: 3358. Deletion size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1817 |
mop-25.3(ok2350) I. |
C. elegans |
T27C10.3. Homozygous. Outer Left Sequence: TTTACGGGGCTCGTATTTTG. Outer Right Sequence: TACAGTAATCCATGCGGCAG. Inner Left Sequence: GAGCCCGTAAATCGAGACAA. Inner Right Sequence: GGAACGGATTTCCGAATTTT. Inner Primer PCR Length: 2264 bp. Deletion Size: 1005 bp. Deletion left flank: GAATGAGCTCTTCACTGCTCAAACAAACTA. Deletion right flank: AGACTTCCGAAAGTGAATCACGTCTACCGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1818 |
C18B2.6(ok2353) X. |
C. elegans |
C18B2.6. Homozygous. Outer Left Sequence: CGTTTAAAACACACCCCACC. Outer Right Sequence: GCTCAAAATGTTGGCGTTCT. Inner Left Sequence: CAGCTCCAGTCCTCATGTCA. Inner Right Sequence: CATTTCCCGTTTCCTTTTCA. Inner Primer PCR Length: 3228 bp. Deletion Size: 2211 bp. Deletion left flank: CCGACTGTGTGACGTACTATTTCTGCGACG. Deletion right flank: AATATTCTCGAAAGGCAGATCCATGGACGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1819 |
Y62H9A.9(ok2354) X. |
C. elegans |
Y62H9A.9 Homozygous. Outer Left Sequence: cctgaactccaaggaccaaa. Outer Right Sequence: ctccaatttccgttcttcca. Inner Left Sequence: ttcctaaattgtccccctcc. Inner Right Sequence: tcaaaaatccatcccatcgt. Inner Primer PCR Length: 3238. Deletion size: about 3000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1820 |
T25F10.6(ok2355) V. |
C. elegans |
T25F10.6. Homozygous. Outer Left Sequence: TGAATAGACGTGTCGTTGCC. Outer Right Sequence: CCTCATTCTGGGACGTGTTT. Inner Left Sequence: ATGTGGGTGGAGATGATGGT. Inner Right Sequence: TGACGTCGAAGACGAGTACG. Inner Primer PCR Length: 2512 bp. Deletion Size: 1021 bp. Deletion left flank: GACTCCCATCTGGTATGGAATCATTCCCTG. Deletion right flank: CTTGAATTGGGATAATTCCCTCGGATCTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1821 |
K10G9.1(ok2356) III. |
C. elegans |
K10G9.1. Homozygous. Outer Left Sequence: AGACCTGTGAGATGTCCGCT. Outer Right Sequence: GGCTCTTCAGGCACAACTTC. Inner Left Sequence: GCAGAACCCTCAAGAAGTCG. Inner Right Sequence: TTGCGTCTCGTTCAGAACAC. Inner Primer PCR Length: 3066 bp. Deletion Size: 1936 bp. Deletion left flank: TAGCTGTGAAGAATATGACGGTGAGTGTCT. Deletion right flank: CGAAATTTTCAGAATGGAGGAAGAAAGAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1822 |
elp-1(ok2357) V. |
C. elegans |
F38A6.2. Homozygous. Outer Left Sequence: CACCATACCATCACTTCCCC. Outer Right Sequence: TGTCTCCACCGTGACACAAT. Inner Left Sequence: AATCAGTGACCGGAATCTGC. Inner Right Sequence: GGAGTAGCGCAAGTAGGGAA. Inner Primer PCR Length: 2857 bp. Deletion Size: 1416 bp. Deletion left flank: CAAAAATAACGAAAATGACGTCACTCAATT. Deletion right flank: ACTAAATTTTTTAACGTTTATGTTTTTAGA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1823 |
gst-4&msp-38(ok2358) IV. |
C. elegans |
K08F4.7, K08F4.8. Homozygous. Outer Left Sequence: ATGCTGGGTGAAACTAACGG. Outer Right Sequence: AAAGATCTGGGGCAGTGATG. Inner Left Sequence: TCCTCGAACATCGAAACACA. Inner Right Sequence: AAGGTGATCAACTCATCGGC. Inner Primer PCR Length: 2170 bp. Deletion Size: 1548 bp. Deletion left flank: CAAACCTTGGGCAAGAATTTCCAGAGATTG. Deletion right flank: GAATTGTTTGGCAGCGCCATCCGGGGTGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1824 |
C18B2.6(ok2360) X. |
C. elegans |
C18B2.6. Homozygous. Outer Left Sequence: CGTTTAAAACACACCCCACC. Outer Right Sequence: GCTCAAAATGTTGGCGTTCT. Inner Left Sequence: CAGCTCCAGTCCTCATGTCA. Inner Right Sequence: CATTTCCCGTTTCCTTTTCA. Inner Primer PCR Length: 3228 bp. Deletion Size: 1608 bp. Deletion left flank: ATAGTATATGTCAAGTATAATTTTTCGTTT. Deletion right flank: ATGTTTCTCGTAATAGATATAAGCTGTCGT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1825 |
C36B1.12(ok2362) I. |
C. elegans |
C36B1.12 Homozygous. Outer Left Sequence: ttccatttggtggttggatt. Outer Right Sequence: gatatcgccaagtcccagaa. Inner Left Sequence: aggctccagatgcgaataga. Inner Right Sequence: catgagcattgggaactgaa. Inner Primer PCR Length: 3358. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1826 |
T26A5.5(ok2364) III. |
C. elegans |
T26A5.5. Homozygous. Outer Left Sequence: GTTCGTCAAATCGACTGGGT. Outer Right Sequence: GTTGGAGGCTTCTGTCCATC. Inner Left Sequence: AGGTGGATCTCATTCAACGG. Inner Right Sequence: TTCCTCACTTCCTCGTTTCG. Inner Primer PCR Length: 3244 bp. Deletion Size: 1461 bp. Deletion left flank: TTCTGCATGCGTCTCTATGGCCTCAAACTG. Deletion right flank: GCATTTGTTGGTGGACTTCCAACTTCATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1827 |
hum-6(ok2365) X. |
C. elegans |
T10H10.1. Homozygous. Outer Left Sequence: GGGGAACGAAACCCATTAGT. Outer Right Sequence: TGGAAAACTGAACTCGAGCA. Inner Left Sequence: TCAAAACCGAAAGAGCACAA. Inner Right Sequence: GCTCTCGATCATCAACCACA. Inner Primer PCR Length: 3314 bp. Deletion Size: 2881 bp. Deletion left flank: TGTACCACACCACAGCTTCGCAGACACCAC. Deletion right flank: TTAGTCTAGTCTGTGTCAATTTTGTTTCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1828 |
dgk-5(ok2366) II. |
C. elegans |
K06A1.6. Homozygous. Outer Left Sequence: CAGATATTCGGCGGGAGTTA. Outer Right Sequence: ACAGATTTTGAGCCACCCAC. Inner Left Sequence: TCTTGCAGCTGATAACGGTG. Inner Right Sequence: CGACGACCCAGTCGAATTAT. Inner Primer PCR Length: 2725 bp. Deletion Size: 1478 bp. Deletion left flank: AATTATCGTAATCAGCTCTTCCAACCACAA. Deletion right flank: CAAGACGAAGAATCCACGTGGGTGGAACAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1829 |
F22G12.5(ok2367) I. |
C. elegans |
F22G12.5. Homozygous. Outer Left Sequence: GAAAAGGGGTTAGGAGCAGG. Outer Right Sequence: CCCCTAGATCTGACACTGCC. Inner Left Sequence: TCAAATCGGCTAATTTTCGG. Inner Right Sequence: TCGTCTGCATCTGTGTGTCA. Inner Primer PCR Length: 3163 bp. Deletion Size: 1478 bp. Deletion left flank: TAGAGATTTGCCACGGAGATTCTTCGAGCT. Deletion right flank: ACAGCATCCTGTCTAGATCTAGGCTTAACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1830 |
C37E2.1(ok2368) X. |
C. elegans |
C37E2.1. Homozygous. Outer Left Sequence: TTGGGTTCGTGATTTGTTGA. Outer Right Sequence: CCAAGACCACCGAAACAACT. Inner Left Sequence: ACAAGTTCTGGTGGGGATTG. Inner Right Sequence: AATTTCACAGCTGGCCATTC. Inner Primer PCR Length: 2507 bp. Deletion Size: 1441 bp. Deletion left flank: TACGGAACTTGTCAATGACGGCATCAGCAA. Deletion right flank: GAGCCTCATGTTCAGACCCTGAAGTTCTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1831 |
set-22(ok2370) V. |
C. elegans |
Y32F6A.1. Homozygous. Outer Left Sequence: CAATCAAAATGAGTTCGGCA. Outer Right Sequence: TCCTCAACTGATAGACGGGC. Inner Left Sequence: AAATTGGCAACAGACTCAAAAA. Inner Right Sequence: TCTCGATTGAAATTCCCGAG. Inner Primer PCR Length: 3158 bp. Deletion Size: 1483 bp. Deletion left flank: CAACAATGTCTCTTGAGAATTCAAAAATCT. Deletion right flank: AAGATATTTAAATACTTTTAAAACTTTTTA. Insertion Sequence: ATATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1832 |
acc-4(ok2371) III. |
C. elegans |
T27E9.9 Homozygous. Outer Left Sequence: cgtcctcgccattctcttag. Outer Right Sequence: tttcgccaaaattatctccg. Inner Left Sequence: atccgaggacacagatttgg. Inner Right Sequence: tggccttcgttgtcttcttt. Inner Primer PCR Length: 3018. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1833 |
K10B3.5(ok2372) X. |
C. elegans |
K10B3.5 Homozygous. Outer Left Sequence: aaagccgttcatgtcaaacc. Outer Right Sequence: acgagagaagacatgggacg. Inner Left Sequence: gagtagtgtgagctgctgcg. Inner Right Sequence: ggtgttccttctcaaatggc. Inner Primer PCR Length: 3221. Deletion size: about 2600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1834 |
che-7(ok2373) V. |
C. elegans |
F26D11.10. Homozygous. Outer Left Sequence: AAAATTCGTCCGAGTCGTTG. Outer Right Sequence: GAGCAGTGGCTCTTTGCTCT. Inner Left Sequence: TGATTCTGGCCATCAGAATTT. Inner Right Sequence: GGGGCACAAAAATGAGAGAA. Inner Primer PCR Length: 3059 bp. Deletion Size: 1496 bp. Deletion left flank: TGCCCACGTACATTATTTTTGTCGCCTGAA. Deletion right flank: GCACTGCCATCATAATAAGAAACGATGATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1835 |
F41D9.1(ok2374) X. |
C. elegans |
F41D9.1 Homozygous. Outer Left Sequence: tcgtgctccactctcatttg. Outer Right Sequence: gttgaaccgatcggaagaga. Inner Left Sequence: aagaaaggtgagcgctgtgt. Inner Right Sequence: gccttgtggcctaatggata. Inner Primer PCR Length: 3251. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1836 |
W05B5.2(ok2375) I. |
C. elegans |
W05B5.2 Homozygous. Outer Left Sequence: acgttaagaaaccgcctttg. Outer Right Sequence: cggaatcgtcctgaaatgtt. Inner Left Sequence: aagtctccaccaatgcaaaa. Inner Right Sequence: ttctttcttttatttttcggtttca. Inner Primer PCR Length: 3143. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1837 |
C54A12.2(ok2376) II. |
C. elegans |
C54A12.2. Homozygous. Outer Left Sequence: AGGCTACCGTGTCGGTATTG. Outer Right Sequence: TCAGTCGGCAACGTATGAAA. Inner Left Sequence: GAAAAATGTTGAGGCGGTGT. Inner Right Sequence: ATCTTTGGCATGTTTGGCTC. Inner Primer PCR Length: 2721 bp. Deletion Size: 1540 bp. Deletion left flank: TCCCACTTCCTTCTGCAATAACCTTAACAC. Deletion right flank: CAGAGAATGCAATTTGATAATGATGGTTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1839 |
C18H2.2(ok2379) III. |
C. elegans |
C18H2.2. Homozygous. Outer Left Sequence: AAGTTGGAACCTTGGAGCCT. Outer Right Sequence: ACAGCGTCGTTGAAAGATCA. Inner Left Sequence: AACTGCTCCCATGTGACCTAA. Inner Right Sequence: CACTTCTGAAAATTCCACCGA. Inner Primer PCR Length: 3037 bp. Deletion Size: 1531 bp. Deletion left flank: TATTTTTCGTGTAACAATCTATTTTTCGTGGAACAATCTATTTTTCGTGTAACAATCTA TTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATT TTTC. Deletion right flank: ATCATCTTTGGATGTGACCAGCGCTGAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1840 |
M28.8(ok2380) II. |
C. elegans |
M28.8. Homozygous. Outer Left Sequence: AACTCCAGCTCGCAATGAAT. Outer Right Sequence: GCCAAGGTTTGCAAGTTTGT. Inner Left Sequence: TGTGCTCAGTATTCGGGATCT. Inner Right Sequence: ACAAACCGACAGATTTGCCT. Inner Primer PCR Length: 3039 bp. Deletion Size: 2145 bp. Deletion left flank: TGAACCTCTTTGTTTGTTCTTATCAATTTA. Deletion right flank: TTAATATCGGGTAAGACAAATTAGTGTGAT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1841 |
Y32G9A.8(ok2383) V. |
C. elegans |
Y32G9A.8 Homozygous. Outer Left Sequence: gcacagggaactggtttgtt. Outer Right Sequence: ggtaccgtctttttgggaca. Inner Left Sequence: gtcctcttcttgggctcctt. Inner Right Sequence: cagccaaaaatacactgcga. Inner Primer PCR Length: 2685. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1842 |
Y54E10A.3(ok2384) I. |
C. elegans |
Y54E10A.3. Homozygous. Outer Left Sequence: CACCATGCCAGTTATCAACG. Outer Right Sequence: CCGAAAAATTGTTTTGCAGC. Inner Left Sequence: TCGATTTCACTGCAGTCTGG. Inner Right Sequence: TGACATATTTCAACGCGACG. Inner Primer PCR Length: 2527 bp. Deletion Size: 1157 bp. Deletion left flank: TTCTGACAATAAAATAAACTTTATTTTTTA. Deletion right flank: TTAGAAAATATCCGAAAAAAATATCCGCCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1843 |
lin-42(ok2385) II. |
C. elegans |
F47F6.1. Homozygous. Outer Left Sequence: CGGTTACGCATTGAAAGACA. Outer Right Sequence: AGTCCCTTTTGCCTGGATCT. Inner Left Sequence: TTTTGCAGGAAACGTAAAGGA. Inner Right Sequence: AGGGGCCTGATCCTAAGAAA. Inner Primer PCR Length: 3109 bp. Deletion Size: 2632 bp. Deletion left flank: CCGGGTTCAGGCCCATATAGGCCTATAGGC. Deletion right flank: ACGGGGGGCTACCCGGCTGGGTGGGAAGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1844 |
F56C9.5(ok2386) III. |
C. elegans |
F56C9.5 Homozygous. Outer Left Sequence: tgaccgttttccaaaacaca. Outer Right Sequence: caaaatcgggcgtactcatt. Inner Left Sequence: atttcgacggtttacttgcg. Inner Right Sequence: cagccatacttcccaatcgt. Inner Primer PCR Length: 2278. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1845 |
dod-17(ok2387) IV. |
C. elegans |
K10D11.1. Homozygous. Outer Left Sequence: GTGCAAAGACCACCGATTTT. Outer Right Sequence: CTTGAGAGCGCCTTTCACTC. Inner Left Sequence: GACAAAACGCCCAGTTTCAT. Inner Right Sequence: CTTTGCTTCTATGTCGGCGT. Inner Primer PCR Length: 2109 bp. Deletion Size: 1489 bp. Deletion left flank: TTCATCTGTCTAGCGTTTGCTACTGCAATT. Deletion right flank: AATCGATGAGATGGTGGAACTCCGGCCGCA. Insertion Sequence: CGATGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1846 |
C30G12.6(ok2389) II. |
C. elegans |
C30G12.6. Homozygous. Outer Left Sequence: TTCATGGGAACACACTCCAA. Outer Right Sequence: CAGGGATCTCACTAGCCCAA. Inner Left Sequence: AACACGTGACGAATGATCCA. Inner Right Sequence: AAACCGTTTTCGCACAAATC. Inner Primer PCR Length: 3210 bp. Deletion Size: 1408 bp. Deletion left flank: TCATTCTTATTCCCTAAAAGAGCTGGAATG. Deletion right flank: TCACAGTTACTTCATCACAACATGTGGTTT. Insertion Sequence: TGTTACTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1847 |
Y76G2A(ok2390) I. |
C. elegans |
Y76G2A. Homozygous. Outer Left Sequence: CATACGCAAACGCCAAAGTA. Outer Right Sequence: CGGATGCTCTATTTGGGAAA. Inner Left Sequence: GGATACAAGGAACAGGCAGC. Inner Right Sequence: GTGAGCTTCTGTGATCCCGT. Inner Primer PCR Length: 2243 bp. Deletion Size: 833 bp. Deletion left flank: GCTGAAGGATCAGAACATCAGGAAGAGCCT. Deletion right flank: AAAACTTAAGTCAGGTGGAAAAATATTTTC. Insertion Sequence: TTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1848 |
F19C6.4(ok2392) X. |
C. elegans |
F19C6.4. Homozygous. Outer Left Sequence: AACATTCTGTCCCCTATGCG. Outer Right Sequence: AACCGTACAAAAAGCATGGC. Inner Left Sequence: CAGCCATACAGCGTTTTGAA. Inner Right Sequence: GCCTACGGAGCAGAAGATTG. Inner Primer PCR Length: 3163 bp. Deletion Size: 1030 bp. Deletion left flank: AAGCGATAATACTCCGTTTCATATACCAGT. Deletion right flank: ATATTAGAGGAGTTTTTTGGGTTGAAAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1849 |
C43E11.11(ok2393) I. |
C. elegans |
C43E11.11. Homozygous. Outer Left Sequence: TCAGATGCCCAAAGATGTGA. Outer Right Sequence: CTTCGGTGCTTAACGAGGTC. Inner Left Sequence: CGGAGATCACATCGGAGATT. Inner Right Sequence: GGGCTTTTTCTGCAGTCATC. Inner Primer PCR Length: 3346 bp. Deletion Size: 1230 bp. Deletion left flank: TTCCGAAAACCCGAGAAAACGATGACGATA. Deletion right flank: TTTAAATTTATTTATTTAACTTGTCTAACT. Insertion Sequence: AATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1850 |
C44C8.6(ok2394) IV. |
C. elegans |
C44C8.6 Homozygous. Outer Left Sequence: gctcaaaatttcggcacatt. Outer Right Sequence: accggactagctccaccttt. Inner Left Sequence: actctgtgccaccaaaaacc. Inner Right Sequence: catatccgtccattgttccc. Inner Primer PCR Length: 2719. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1851 |
hpr-9(ok2396) III. |
C. elegans |
Y39A1A.23 Homozygous. Outer Left Sequence: aaattcgctgaaatcatggc. Outer Right Sequence: gttgggtttttgatgtgcct. Inner Left Sequence: aatcgaaaaaccgacaccct. Inner Right Sequence: cctccaactttccgacaaga. Inner Primer PCR Length: 2639. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1853 |
dos-1(ok2398) III. |
C. elegans |
ZK507.4. Homozygous. Outer Left Sequence: CGCCGACTTCATCATTCTCT. Outer Right Sequence: AAAGGCACAGCACATTACCC. Inner Left Sequence: TATCTGCGTGACGGTTTTTG. Inner Right Sequence: GAGCGCGTCTTTAAAGGGTA. Inner Primer PCR Length: 2244 bp. Deletion Size: 1674 bp. Deletion left flank: TCGTTTGAATCCCACCATTCAGAACCCAGG. Deletion right flank: AAAGAAATCGCAAAAGACGCACCCCAATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1854 |
sms-1(ok2399) IV. |
C. elegans |
H21P03.3. Homozygous. Outer Left Sequence: TGAAAACAATGGCCAGATCA. Outer Right Sequence: TTCGTCTCGTCGAATCTGTG. Inner Left Sequence: ACGAGCACAAGTGTGTGTCC. Inner Right Sequence: TGATAAACCAGCAAGTCCCC. Inner Primer PCR Length: 1168 bp. Deletion Size: 620 bp. Deletion left flank: GAGAATTGATCCAATGAAACAGAGACGACG. Deletion right flank: GGTCAAATTTTAAAGCAAATTTTCGAAAAA. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1855 |
B0213.15(ok2401) V. |
C. elegans |
B0213.15 Homozygous. Outer Left Sequence: ggagaaaagcgtggtctctg. Outer Right Sequence: tttccgaaaaatcgaacagg. Inner Left Sequence: tagtgcaaacggagttggtg. Inner Right Sequence: tactgagaagaccgccgagt. Inner Primer PCR Length: 2540. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1856 |
B0213.15(ok2402) V. |
C. elegans |
B0213.15 Homozygous. Outer Left Sequence: ggagaaaagcgtggtctctg. Outer Right Sequence: tttccgaaaaatcgaacagg. Inner Left Sequence: tagtgcaaacggagttggtg. Inner Right Sequence: tactgagaagaccgccgagt. Inner Primer PCR Length: 2540. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1857 |
B0213.15(ok2403) V. |
C. elegans |
B0213.15 Homozygous. Outer Left Sequence: ggagaaaagcgtggtctctg. Outer Right Sequence: tttccgaaaaatcgaacagg. Inner Left Sequence: tagtgcaaacggagttggtg. Inner Right Sequence: tactgagaagaccgccgagt. Inner Primer PCR Length: 2540. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1858 |
ifd-1(ok2404) X. |
C. elegans |
R04E5.10. Homozygous. Outer Left Sequence: AGAATGCTTGAAAGCCGAGA. Outer Right Sequence: ACTACGGAAGGGCATGTGAC. Inner Left Sequence: CGACCGAAAATGTACCAACA. Inner Right Sequence: TTGCGGTAAACTCTGATCCC. Inner Primer PCR Length: 3151 bp. Deletion Size: 1863 bp. Deletion left flank: AATATCATGGTATAGCACTTTAAAAACTTT. Deletion right flank: ATTTTAAAAAAAGCAAATTAAAAACTAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1859 |
B0391.5(ok2405) V. |
C. elegans |
B0391.5 Homozygous. Outer Left Sequence: aagaccttcccgatttcgat. Outer Right Sequence: ccagcccatagtttccaaga. Inner Left Sequence: caattccggctcgaaataaa. Inner Right Sequence: cctgctctgcttggaatagg. Inner Primer PCR Length: 3191. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1860 |
F35A5.1(ok2406) X. |
C. elegans |
F35A5.1. Homozygous. Outer Left Sequence: AACCACCGAAACCAACAGAG. Outer Right Sequence: CGCCGTGAGGATGATAAGTT. Inner Left Sequence: ACTCCCAAACCGAAGGAAGT. Inner Right Sequence: TTCTGATCAATTTCCCGAGG. Inner Primer PCR Length: 2698 bp. Deletion Size: 2012 bp. Deletion left flank: AGCTGATTCTCTTGGTGGACCTAAGCCAAA. Deletion right flank: CAAACTGCGGCTTTAATTACACAGGAAGGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1861 |
arl-5(ok2407) III. |
C. elegans |
ZK632.8. Homozygous. Outer Left Sequence: GACAAGTCATTCCGCGATTT. Outer Right Sequence: TCGTCCAACAAATGATCGAA. Inner Left Sequence: GTTGCACCGCTAAACCCTAA. Inner Right Sequence: GCCAGAAGAAAGTGAGCCAG. Inner Primer PCR Length: 2126 bp. Deletion Size: 1199 bp. Deletion left flank: TCTTCCCGTTCTTTTTTATTCAAACTTATG. Deletion right flank: ATATTAAAATTAAAATTATTTTCAGTTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1862 |
F07G6.2(ok2408) X. |
C. elegans |
F07G6.2. Homozygous. Outer Left Sequence: AGTATGCTAGCCCGGAAGGT. Outer Right Sequence: GTCTCAGCAAAACCAGGGAG. Inner Left Sequence: TGCGCTGTTTAGAATTGTGC. Inner Right Sequence: CGATGTTTGGGTGTCACATT. Inner Primer PCR Length: 3052 bp. Deletion Size: 1625 bp. Deletion left flank: ATTTTTGCCGACATTAGTTTAAAAAATTAA. Deletion right flank: GTGCTAGGACGTAGCGCTTTCATGCAGGCG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1863 |
flp-12(ok2409) X. |
C. elegans |
C05E11.8. Homozygous. Outer Left Sequence: AATCAAAACGCAATTTTCGG. Outer Right Sequence: AGGGGAGGACCATCATTAGG. Inner Left Sequence: AAAATTGCAATAAACACGGGA. Inner Right Sequence: CTTGGTCGGCACATAAGCTC. Inner Primer PCR Length: 1155 bp. Deletion Size: 564 bp. Deletion left flank: AGCTTTTATAAATATCAGCCTAAATTTGGC. Deletion right flank: GGGTTTTCTTGCTGGGCCCCATAAGACGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1864 |
msh-2(ok2410) I. |
C. elegans |
H26D21.2. Homozygous. Outer Left Sequence: ACCATTTTGGCAACTTGGAG. Outer Right Sequence: GCGAAACCAATTCACCGTAT. Inner Left Sequence: CAACTCCCTCGAAAACCTTG. Inner Right Sequence: TCCCTGCAGGACCATTTTAC. Inner Primer PCR Length: 3099 bp. Deletion Size: 1300 bp. Deletion left flank: AATTAGTTACCTTCAAAGTGACTCGGAAAT. Deletion right flank: CCCTGTTCACTCGAGTATAGCTCAACGGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1865 |
hum-6(ok2411) X. |
C. elegans |
T10H10.1. Homozygous. Outer Left Sequence: GGGGAACGAAACCCATTAGT. Outer Right Sequence: TGGAAAACTGAACTCGAGCA. Inner Left Sequence: TCAAAACCGAAAGAGCACAA. Inner Right Sequence: GCTCTCGATCATCAACCACA. Inner Primer PCR Length: 3314 bp. Deletion Size: 1767 bp. Deletion left flank: CACCCCTACCTGTACCACACCACAGCTTCG. Deletion right flank: GGTTTAGTCTGTATATTGCACTTTTTGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1866 |
F01G12.2(ok2412) X. |
C. elegans |
F01G12.2 Homozygous. Outer Left Sequence: ggagctggagtggaaatgaa. Outer Right Sequence: ccgcctgctcatctatcttc. Inner Left Sequence: cgcaacggaatatccttttt. Inner Right Sequence: tcgctacccttgatattcgc. Inner Primer PCR Length: 1284. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1867 |
C10H11.1(ok2413) I. |
C. elegans |
C10H11.1. Homozygous. Outer Left Sequence: GCGCCGAAAAAGTACAAAAA. Outer Right Sequence: AGTAATGACGGTTTCACCGC. Inner Left Sequence: TTGTGCAGGAGAAACGTGAG. Inner Right Sequence: TGCATCGTTCTGTTTCCAAG. Inner Primer PCR Length: 3296 bp. Deletion Size: 2472 bp. Deletion left flank: GGATCGAAGAATGTCGATGTGAGACTTGTA. Deletion right flank: GTTGTGTACAAAGGAGCAGAACCTGAGCAG. Insertion Sequence: CT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1868 |
hum-8(ok2414) IV. |
C. elegans |
Y66H1A.6. Homozygous. Outer Left Sequence: AATTTTCGGCAATCGACACT. Outer Right Sequence: GATGCATTTGAATGAGGCAA. Inner Left Sequence: TTGACGGAATTCCCAAAAAT. Inner Right Sequence: CTCACCACAATGGCCAAATA. Inner Primer PCR Length: 3122 bp. Deletion Size: 1206 bp. Deletion left flank: AAAGTCCATTTCCTTTCAATTCAAATAACT. Deletion right flank: AATGTCTCGAAAACGGTTTAAAAGAGTAAA. Insertion Sequence: TTTTCCTTTCAATTTCAAATAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1869 |
W06B11.1(ok2415) X. |
C. elegans |
W06B11.1. Homozygous. Outer Left Sequence: AAAACGATATTGGGCTGTGG. Outer Right Sequence: GCATCGGTTTTCAGTGGAAT. Inner Left Sequence: AGATTGCCTGGGTGAAATGT. Inner Right Sequence: AGCCTATGCACAGAGCTGGT. Inner Primer PCR Length: 3070 bp. Deletion Size: 1660 bp. Deletion left flank: TTTAAAATGTTTGTTTTTTTGTAAATTGAT. Deletion right flank: TTATTTCAGTCTTTGGATGCCAAATTATAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1870 |
clec-49(ok2416) V. |
C. elegans |
W04D12.6. Homozygous. Outer Left Sequence: ACAGGAACCCCCTGAAAAAT. Outer Right Sequence: TACATCAACTGGGCACCAAA. Inner Left Sequence: AAACCGGAAAATCCTAAGCC. Inner Right Sequence: AATCCGGGAAAGGAAAATTG. Inner Primer PCR Length: 3163 bp. Deletion Size: 1614 bp. Deletion left flank: CGGGTTTTCAATTTCGTGATGTCATTGAAT. Deletion right flank: CCGGCAAATTGGCAAATTGCCGGAATTGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1871 |
stn-2(ok2417) X. |
C. elegans |
F27D9.8. Homozygous. Outer Left Sequence: ATTACGGCAAACAGAAACCG. Outer Right Sequence: CCCCTCTGGGAAATAGGAAC. Inner Left Sequence: TTGACTCATCGCGTGTCTTT. Inner Right Sequence: CGAATGAGCGTTCATAGCAA. Inner Primer PCR Length: 3180 bp. Deletion Size: 1569 bp. Deletion left flank: CGGTTCGGTAATATGCTTGCTCAAAAAGTT. Deletion right flank: TTGTTTCTACTCATGTTTCTTCGTCCTTTT. Insertion Sequence: TTGTTAAAGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1872 |
C27A2.1(ok2421) II. |
C. elegans |
C27A2.1. Homozygous. Outer Left Sequence: ATGCAACGTGCTAAAGCAAA. Outer Right Sequence: GTGGTTCCATTCCACATTCC. Inner Left Sequence: AAGCTCGAGCGAGACTTCAG. Inner Right Sequence: ACATCTGAATGGAACTGGGC. Inner Primer PCR Length: 3285 bp. Deletion Size: 2424 bp. Deletion left flank: AAATAATATTTATTTTTGTTGAAAAATTAG. Deletion right flank: TTGAAAACCGTGCACGTATCCACGATAAAC. Insertion Sequence: CTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1875 |
Y65B4A.3(ok2425) I. |
C. elegans |
Y65B4A.3. Homozygous. Outer Left Sequence: ACCTCCTCAGACGACTCGAA. Outer Right Sequence: GAGCGCGAAAATTCAAAGAG. Inner Left Sequence: GTCGCCATATCGTCGTTTTT. Inner Right Sequence: CCGATTTTAGAGGAAGACCAGA. Inner Primer PCR Length: 3213 bp. Deletion Size: 1830 bp. Deletion left flank: CATGGTTTCCGACTGTTTTTCCTGTTAAAT. Deletion right flank: TTTTTTCCACATGTGTGGATCTCAATTTAT. Insertion Sequence: GTTAAAAAATGTATGAAAAAAAATTTTAAAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1877 |
Y44A6D.3(ok2427) V. |
C. elegans |
Y44A6D.3. Homozygous. Outer Left Sequence: AGGTGTTCCACCAGCACAAT. Outer Right Sequence: TGCCGTGCTTCTATCTTCCT. Inner Left Sequence: TCTCTCATCTTTCGCTTCACC. Inner Right Sequence: CAACTCTTAAGCCACAAAACTGT. Inner Primer PCR Length: 3141 bp. Deletion Size: 1471 bp. Deletion left flank: ATTCTGATGGAAATGACTAGAAGGCAAGGC. Deletion right flank: ATTGATGTGCCTGAAATTTGAAAAAAATGT. Insertion Sequence: TTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1878 |
ptp-3(ok2428) II. |
C. elegans |
C09D8.1 Homozygous. NOTE: C09D8.1 used to be ptp-1; ptp-1 is now C48D5.2. Outer Left Sequence: aaatccgttgagcaaacacc. Outer Right Sequence: gtccttctcgattttcagcg. Inner Left Sequence: ttttacggccaattttctgc. Inner Right Sequence: atatccttgtgcgcgtaacc. Inner Primer PCR Length: 2770. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1880 |
nas-32(ok2430) V. |
C. elegans |
T02B11.7. Homozygous. Outer Left Sequence: GGATCTACCATGAGCCAGGA. Outer Right Sequence: CGAAAATGAGAACGGAAAGC. Inner Left Sequence: TGTGCACCCGTAGACACATT. Inner Right Sequence: GACGGGTCGTACTTTTGGAA. Inner Primer PCR Length: 2939 bp. Deletion Size: 1989 bp. Deletion left flank: AATTCGTCCGCCCATGGTGTATACCATCAC. Deletion right flank: CATGTCCAATGCTGGTGGATTCTCGGTTAT. Insertion Sequence: TTCTTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1881 |
nas-36(ok2431) I. |
C. elegans |
C26C6.3. Homozygous. Outer Left Sequence: AAAAATGAAGTGCCGGTGTC. Outer Right Sequence: GTTTATCAACAGGGCACGCT. Inner Left Sequence: TTTGCGCAATATGCATTCTC. Inner Right Sequence: CGTCGTCCCCTGAAAGATAA. Inner Primer PCR Length: 3089 bp. Deletion Size: 2659 bp. Deletion left flank: ATGAAAAAATTGGCGCATTCAAGAAGTTTT. Deletion right flank: TTTCTTGTTATAACATTTTCAAATTTCCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1882 |
sgn-1(ok2432) II. |
C. elegans |
F07H5.2. Homozygous. Outer Left Sequence: ACGTGTGTTTGTGGGTTTCA. Outer Right Sequence: AAAGCCACGTTCGATTCAAG. Inner Left Sequence: CCCCTTCTCAATATTCGGGT. Inner Right Sequence: AAGCTTCCAGCCTCCTTTGT. Inner Primer PCR Length: 3103 bp. Deletion Size: 1620 bp. Deletion left flank: TTGAGCACAATTCCGATGGCAAGGATCAAA. Deletion right flank: AGGTTTAATTATATTATTATAGTACACATC. Insertion Sequence: TATATTATTATAGTACAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1883 |
W03B1.2(ok2433) IV. |
C. elegans |
W03B1.2. Homozygous. Outer Left Sequence: ATGGCAATTGCGTATAAGGC. Outer Right Sequence: CTAGTGATGGCGCAGTTGAA. Inner Left Sequence: CAAAGACCTTGTCTGAACCTGA. Inner Right Sequence: AAACAGCACTGCTTCCAACC. Inner Primer PCR Length: 3025 bp. Deletion Size: 2350 bp. Deletion left flank: TGAGGATCCGGAATGAGAGCAGAAACCAGC. Deletion right flank: GAAGGAGTACGAGAACGAGTCAAAGAACAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1884 |
B0285.7(ok2434) III. |
C. elegans |
B0285.7. Homozygous. Outer Left Sequence: ATAGGCGCATTAGATGACGG. Outer Right Sequence: CATTTTCGCATTTCTCGGAT. Inner Left Sequence: TTGAACAAGAAATAACATTGAAAAA. Inner Right Sequence: CTGTGCCTGTCTCATGCCTA. Inner Primer PCR Length: 1167 bp. Deletion Size: 630 bp. Deletion left flank: ACAAATTCGCTTTCTCCACAGCCACCATCT. Deletion right flank: AGAATCTGCCTGCCTTATACCTAAATGTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1886 |
lgc-20&B0491.5(ok2436) II. |
C. elegans |
B0491.5, B0491.4. Homozygous. Outer Left Sequence: ATCCTTTCACCAATTCCACG. Outer Right Sequence: CATGGATCGGTCTTTGGAGT. Inner Left Sequence: GTCATTTCGTCGGAATTTGG. Inner Right Sequence: TTTGTAATTCAGCAAGGGACG. Inner Primer PCR Length: 3101 bp. Deletion Size: 1454 bp. Deletion left flank: CAAAACTAATGAGTCAAAGCGCTCAGTCAT. Deletion right flank: TTACAGAGAATTTTGTTAAATTTTAAAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1887 |
tom-1(ok2437) I. |
C. elegans |
M01A10.2. Homozygous. Outer Left Sequence: AGCGGAGAGTGAAGTTTTGC. Outer Right Sequence: AGGAGGGTTTGCAACAAAAA. Inner Left Sequence: GCCCGATTAATAGTCTCTCCAA. Inner Right Sequence: CGGTATTTCTTAATGTTAATGCAC. Inner Primer PCR Length: 3012 bp. Deletion Size: 2391 bp. Deletion left flank: GTTAACCATCTGCCCTTACCCAGTGTCGCC. Deletion right flank: TAATAAAGATGAAATGAATGTTTCAGTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1888 |
gly-10(ok2439) IV. |
C. elegans |
Y45F10D.3. Homozygous. Outer Left Sequence: CACACCAAGCCATACGTCAG. Outer Right Sequence: GCCCATTTTTGGAGATCAGA. Inner Left Sequence: TTTGGCCTCCTAACAAAACG. Inner Right Sequence: GTGCAAAAATCCTTTGCCAT. Inner Primer PCR Length: 3042 bp. Deletion Size: 1037 bp. Deletion left flank: CTTTTTGCAATTCAATTTTCAAATATTTGT. Deletion right flank: GAAATAGAGGCGGGGTGTAGTTTTGCAACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1889 |
F09G2.1(ok2440) V. |
C. elegans |
F09G2.1. Homozygous. Outer Left Sequence: TGAAACGAGTAGGCAGTCCC. Outer Right Sequence: TGACTTTTCTGACCAGCACG. Inner Left Sequence: AAAATTTTGCGGACAGGATG. Inner Right Sequence: TAATGGAAACTTTGGTCGGG. Inner Primer PCR Length: 3181 bp. Deletion Size: 1440 bp. Deletion left flank: TCAGCAATCTGCCGATTTATCTGAAAAAAT. Deletion right flank: CAAAATAGTAGGTGTCCCACCTGCAATCGA. Insertion Sequence: TTAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1891 |
Y51H1A.4(ok2443) II. |
C. elegans |
Y51H1A.4 Homozygous. Outer Left Sequence: tttccagattttctcgcgtt. Outer Right Sequence: tttcgcactgttttctcgtg. Inner Left Sequence: aagtgaaggaaatgccgaaa. Inner Right Sequence: ccaatgcatctcatcctcct. Inner Primer PCR Length: 2570. Deletion size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1892 |
F53B1.2(ok2444) X. |
C. elegans |
F53B1.2. Homozygous. Outer Left Sequence: ATGCTCTTTTCGCCCCTTAT. Outer Right Sequence: GCTCCAAATGTGGAATGCTT. Inner Left Sequence: GACCTATACCGGCAGATCCA. Inner Right Sequence: TCATGCTTCATACCCTGGCT. Inner Primer PCR Length: 1108 bp. Deletion Size: 383 bp. Deletion left flank: AGAAACGAGCTGAAACTATTTATGCGACGC. Deletion right flank: TGGCCAAGTCGTCAGATGGCACATCAACAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1893 |
lys-1(ok2445) V. |
C. elegans |
Y22F5A.4. Homozygous. Outer Left Sequence: AAAAGGCGATGCTGAGAAGA. Outer Right Sequence: TTGCTGCTGATGTCCTCTTG. Inner Left Sequence: GAGAGCAACGGACAAAAACG. Inner Right Sequence: GCACGGAAGTCATCGAAAGT. Inner Primer PCR Length: 3015 bp. Deletion Size: 1652 bp. Deletion left flank: ATTCTTGATCTTCATTTCTAACTAGAAACC. Deletion right flank: ATTTGGATCTGGAGCATTCGACACAACTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1894 |
sri-17(ok2446) I. |
C. elegans |
F15H9.3. Homozygous. Outer Left Sequence: CGAAGTAGGCAGGAATGAGG. Outer Right Sequence: TGGAGCACATCGAGTGAGAG. Inner Left Sequence: ACGATAGGCTTTTCCAACCA. Inner Right Sequence: TTCTCTGCGCTCTATCACCA. Inner Primer PCR Length: 1300 bp. Deletion Size: 466 bp. Deletion left flank: AAATTCCAGTTCGCAAGTTTTCTGACAGAA. Deletion right flank: GTCTATAATTACGAGTCTAATCAATGGCTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1895 |
hch-1(ok2447) X. |
C. elegans |
F40E10.1. Homozygous. Outer Left Sequence: AGCTTGGGTAGTGGTGGTTG. Outer Right Sequence: AACGCGATGGTTTCCTACTG. Inner Left Sequence: TGTAGATGTGCGAGCGGTAG. Inner Right Sequence: GCCGACTTCGTTAATGGAAA. Inner Primer PCR Length: 3007 bp. Deletion Size: 1611 bp. Deletion left flank: CAAGGCACCTGATGCAGAAATAGTTTGAAT. Deletion right flank: CCTTCGAAAAGATACGGAATTTCATCGGGT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1896 |
C18H7.2(ok2454) IV. |
C. elegans |
C18H7.2 Homozygous. Outer Left Sequence: aaccgcgcaaatgagtagat. Outer Right Sequence: gctccccctacttttgaacc. Inner Left Sequence: attcgggtcattgcttgaaa. Inner Right Sequence: aaggcactgattggttcagc. Inner Primer PCR Length: 3107. Deletion size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1897 |
clec-50(ok2455) V. |
C. elegans |
W04E12.8. Homozygous. Outer Left Sequence: AGTTGTTCGCATCCCTTTTG. Outer Right Sequence: ACACAACCCGGACACCTTTA. Inner Left Sequence: CAAAACCCCTGGATCAACTG. Inner Right Sequence: CATGCTTCTCGCACATTTTG. Inner Primer PCR Length: 3140 bp. Deletion Size: 1880 bp. Deletion left flank: CCTGACCGACCTTGTGCATACCGATCCACG. Deletion right flank: GTGATAACGTTAAAGAATGGTGCCATATAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1898 |
clec-50(ok2456) V. |
C. elegans |
W04E12.8. Homozygous. Outer Left Sequence: AGTTGTTCGCATCCCTTTTG. Outer Right Sequence: ACACAACCCGGACACCTTTA. Inner Left Sequence: CAAAACCCCTGGATCAACTG. Inner Right Sequence: CATGCTTCTCGCACATTTTG. Inner Primer PCR Length: 3140 bp. Deletion Size: 1387 bp. Deletion left flank: AGGCAGTTGTTTGGAGCGGCCGACACGTTC. Deletion right flank: AATTTTTATCACACAGTTTTTGTTTTAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1899 |
F28F8.2(ok2457) V. |
C. elegans |
F28F8.2 Homozygous. Outer Left Sequence: aatggcgttctctgctcagt. Outer Right Sequence: aggcgactatgcgtcatttc. Inner Left Sequence: cacaccaacacacgtaaggg. Inner Right Sequence: catggcaaatacacggaaga. Inner Primer PCR Length: 3079. Deletion size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1900 |
cwp-4(ok2458) V. |
C. elegans |
K11D12.1. Homozygous. Outer Left Sequence: AGGCTCATATTCGGCAACAC. Outer Right Sequence: ATGGCTCCAGTCTTACCCCT. Inner Left Sequence: GATCGTCGCCTAGAGACTGG. Inner Right Sequence: TCTTCTCCACGCATAATGGA. Inner Primer PCR Length: 3283 bp. Deletion Size: 1550 bp. Deletion left flank: CGCGGACACTGAGCAAGCGAACAACACCAA. Deletion right flank: GGAGGAAAAATTGACACATATAACTAACTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1901 |
C42C1.10(ok2459) IV. |
C. elegans |
C42C1.10 Homozygous. Outer Left Sequence: acgacttccaattgcattcc. Outer Right Sequence: acttccacatccaagaaccg. Inner Left Sequence: ctcacaaattcgaacggaaa. Inner Right Sequence: gcatcgtcaaaccactgaaa. Inner Primer PCR Length: 3301. Deletion size: about 2900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1902 |
flp-19(ok2460) X. |
C. elegans |
M79.4. Homozygous. Outer Left Sequence: CGAGAACTGAAACAAACGCA. Outer Right Sequence: TGATTTGATGTGCGCAATTT. Inner Left Sequence: AACCCACACCTCAACTTTCG. Inner Right Sequence: ATTGAACCATGTCTGACCGT. Inner Primer PCR Length: 1138 bp. Deletion Size: 505 bp. Deletion left flank: TTCAAATATCATCACTTTCTTATTTTCCGG. Deletion right flank: TATTTCAGGGCAACCAATTCAGTCACAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1903 |
flp-19(ok2461) X. |
C. elegans |
M79.4. Homozygous. Outer Left Sequence: CGAGAACTGAAACAAACGCA. Outer Right Sequence: TGATTTGATGTGCGCAATTT. Inner Left Sequence: AACCCACACCTCAACTTTCG. Inner Right Sequence: ATTGAACCATGTCTGACCGT. Inner Primer PCR Length: 1139 bp. Deletion Size: 268 bp. Deletion left flank: GAGTTTATTTTTTATTAACAATTATCTTTG. Deletion right flank: AACAAAAACCCAACTAATTTTGTGTGTTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1904 |
tag-266(ok2462) III. |
C. elegans |
W06E11.5. Homozygous. Outer Left Sequence: GCTCTTTTTCCGACACTTGC. Outer Right Sequence: CCTCGTCGTTTGACCATTTT. Inner Left Sequence: TCTCCTTTGTCGAGAATCTGAA. Inner Right Sequence: TCATGTCAGCCACACCATTT. Inner Primer PCR Length: 3192 bp. Deletion Size: 1425 bp. Deletion left flank: AAAGTAGATATATTTTTCAAAATTTTAAAG. Deletion right flank: TTGAAAATGTTTTAGAAAATTCATAAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1905 |
hse-5(ok2463) III. |
C. elegans |
B0285.5. Homozygous. Outer Left Sequence: AAAAGTATCGGGAGTTGGGG. Outer Right Sequence: TTATGTTTTGCCCGTTTTCC. Inner Left Sequence: CCAGAGTCTTTTTGTGGCGT. Inner Right Sequence: AGTTCCCAAAGCAACGTGAC. Inner Primer PCR Length: 3193 bp. Deletion Size: 1427 bp. Deletion left flank: AAAAGATGGTTCAACATTTGAATTATACAC. Deletion right flank: ACCAAAAAATCGACAGCCCTGATCAGGCTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1906 |
mes-1(ok2467) X. |
C. elegans |
F54F7.5. Homozygous. Outer Left Sequence: CAGAAACCATTTCCCTCGAA. Outer Right Sequence: CTGAAGACACTTGCTCAGCG. Inner Left Sequence: CCACAGTCGAAGGTTTGGAT. Inner Right Sequence: TGGCAAAAGAATCATGGTCA. Inner Primer PCR Length: 3220 bp. Deletion Size: 1722 bp. Deletion left flank: GGCACAATATCAATCAGATTCTGACAAAAA. Deletion right flank: CGGTACGTGATTTAGTTGTTTTTTTTTCTC. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1907 |
K03E5.1(ok2468) I. |
C. elegans |
K03E5.1. Homozygous. Outer Left Sequence: TTAGCGAGGGTCGAAGACAT. Outer Right Sequence: AAAATCTGACAAACGTGCCC. Inner Left Sequence: TTTAGCTTTGCACACGATGC. Inner Right Sequence: TTTCCTAACGAGACCCAACG. Inner Primer PCR Length: 2967 bp. Deletion Size: 1739 bp. Deletion left flank: TTGGGTGCGAAATCCGTGGCCTAATTTTCT. Deletion right flank: TAGTTTGATGAATACACCAGATTTGACGTG. Insertion Sequence: CT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1908 |
mlk-1(ok2471) V. |
C. elegans |
K11D12.10. Homozygous. Outer Left Sequence: CAGCCACTGCTCTTTCATCA. Outer Right Sequence: TGGCAACCCCAAGAAAAATA. Inner Left Sequence: TTTGAGTCTCGCTTGTTCCA. Inner Right Sequence: TTTCTATGCGGTGCATTTCA. Inner Primer PCR Length: 3205 bp. Deletion Size: 2971 bp. Deletion left flank: CTCATCGGCATTGTCGACTGAAAGTTTATT. Deletion right flank: ATTAGCTCAATTTTTTGCAAAACTAACTTG. Insertion Sequence: CATGATCTTTATGCGGGAAGTGGTGATATAAATCGAAAAAATCGGCATTCCATCGCGCC GGAAACCAAAGCAAGACGGTTAAAGCATCATAAACCAAAAAAAGCCGACATAACGGGTC CGACAGAAGTGAAACATATATTGTCTGTGCAAAAGGATGATAAAAATTTTAGAGTTAAA AGTAAGTTATATGGTTTAATATTCAATAAAATTGAAAGTTTTTTTGCATGCGTCATTTG GTATAGTAGAAACAATAATTTGAAATAAATATTAAACGTAAAATCAAGATTGCATGCTA GGGTTTCCATGGTAGGCAGGCGTGACCTAGTGCCTGCCTGAAAACTGCCGACCACATGC CTCTTTTCTACATTTTGGCAGAAATTTCAGGCAGGCGTTTTGGCGCCTACATGGAAGCC CAATAGCATGCAATTGTTCGTTCCGTTTACTTCTCATATGAAACTTATCTGCTAAATTA ATATTAACATAGGATATTTTTGAGTCGAAAACAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1909 |
gcy-19(ok2472) II. |
C. elegans |
C17F4.6. Homozygous. Outer Left Sequence: AATATCTCGGGCTTTTGCCT. Outer Right Sequence: AAAACGTCTGGAACGTGACC. Inner Left Sequence: AAATTTCACAGCACCGGAAC. Inner Right Sequence: AATAGATGCGGAATGGCAAA. Inner Primer PCR Length: 3073 bp. Deletion Size: 1376 bp. Deletion left flank: TTACTTAATATGAGCATTTCCATTTTTCGA. Deletion right flank: CTGGCGACGTTTCATGGGCTTCTTCTCCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1910 |
tbx-9(ok2473) III. |
C. elegans |
T07C4.6 Homozygous. Outer Left Sequence: ttcaattttccagtcgaccc. Outer Right Sequence: caacattttcggaccgtctt. Inner Left Sequence: gtttgcttgtttggaaggga. Inner Right Sequence: gaggtgagatggggtgaaga. Inner Primer PCR Length: 3003. Deletion size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1911 |
ins-27(ok2474) I. |
C. elegans |
ZC334.11. Homozygous. Outer Left Sequence: TGTTCAAAACGCACTTGGAG. Outer Right Sequence: TCAAAGCCCCATAACTTTGC. Inner Left Sequence: ATATTACCGCTGGTTGCTCC. Inner Right Sequence: CAAGCTTCAGCGCATAAACA. Inner Primer PCR Length: 1324 bp. Deletion Size: 461 bp. Deletion left flank: TCTACGTAGATCAAACCGACATGGGACAGC. Deletion right flank: AACTGATGAGAATAAAACAATTGTTAAGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1912 |
W05H7.3(ok2485) X. |
C. elegans |
W05H7.3 Homozygous. Outer Left Sequence: cttttcaaccggttttgcat. Outer Right Sequence: cgactaagagagcccgtgtc. Inner Left Sequence: ttcctgtgagaaaaatcccg. Inner Right Sequence: gatgagccaagcttagtggc. Inner Primer PCR Length: 2915. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1913 |
msh-2(ok2486) I. |
C. elegans |
H26D21.2. Homozygous. Outer Left Sequence: ACCATTTTGGCAACTTGGAG. Outer Right Sequence: GCGAAACCAATTCACCGTAT. Inner Left Sequence: CAACTCCCTCGAAAACCTTG. Inner Right Sequence: TCCCTGCAGGACCATTTTAC. Inner Primer PCR Length: 3099 bp. Deletion Size: 1772 bp. Deletion left flank: CCCGGCTGTTCAGCGAGTTTTCCCATCTCA. Deletion right flank: AATTATTCGATTTCTCTGAAATTAAATTAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1914 |
aqp-9(ok2487) I. |
C. elegans |
K07A1.16 Homozygous. Outer Left Sequence: gggaaaatcttgcgtttgaa. Outer Right Sequence: ctggacggaagattgtggat. Inner Left Sequence: cccacaaactctactccccc. Inner Right Sequence: tttaaaagctcaaactcaagaacc. Inner Primer PCR Length: 1134. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1915 |
ins-3(ok2488) II. |
C. elegans |
ZK75.3. Homozygous. Outer Left Sequence: GTCCCACTTCGATGCAATTT. Outer Right Sequence: GGAGGCTCTTTACTCGCCTT. Inner Left Sequence: CTATTGCACAACAACACCCG. Inner Right Sequence: TTCTTCCCTGTCTGCCATTT. Inner Primer PCR Length: 3189 bp. Deletion Size: 1449 bp. Deletion left flank: ACTATCATTAACTTTTCAAAATGTTAGTTT. Deletion right flank: AATAATGAAAAGTGCAAGAACAACGGAGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1916 |
pgp-8(ok2489) X. |
C. elegans |
T21E8.3 Homozygous. Outer Left Sequence: atccagagcacttgtcgctt. Outer Right Sequence: ggaagtgtttttgctttcgg. Inner Left Sequence: ttgaccaccagacagctgag. Inner Right Sequence: ggacaaacccaggaacttga. Inner Primer PCR Length: 3296. Deletion size: about 2100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1917 |
dnj-28(ok2490) I. |
C. elegans |
Y54E10BL.4. Homozygous. Outer Left Sequence: AAAACCGAGGCACAAAGAGA. Outer Right Sequence: AATCGATGTTCAATCGCTCC. Inner Left Sequence: CCGGAAATGCGTTATTTGTC. Inner Right Sequence: GTTAGGTATTTCGCGCCCTT. Inner Primer PCR Length: 3131 bp. Deletion Size: 2116 bp. Deletion left flank: AGTTAGACAGTAATTTCAAAAAAGTTAGTT. Deletion right flank: ATATGGCAGACGAGGAGTATGATATGGGTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1918 |
sedl-1(ok2497) X. |
C. elegans |
W05H7.3. Homozygous. Outer Left Sequence: CTTTTCAACCGGTTTTGCAT. Outer Right Sequence: CGACTAAGAGAGCCCGTGTC. Inner Left Sequence: TTCCTGTGAGAAAAATCCCG. Inner Right Sequence: GATGAGCCAAGCTTAGTGGC. Inner Primer PCR Length: 2915 bp. Deletion Size: 1236 bp. Deletion left flank: AAACTAAATTCAGAAAATATTTTTGGCTTC. Deletion right flank: TATTCAGAAATCAACTGGGCTGATGATACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1919 |
W07E6.3(ok2498) II. |
C. elegans |
W07E6.3 Homozygous. Outer Left Sequence: caccagatctcacgacgaaa. Outer Right Sequence: ccgttttcgaaattaagcca. Inner Left Sequence: gaaaaatccgattctggggt. Inner Right Sequence: aaatttcttcgggcacgtta. Inner Primer PCR Length: 3191. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1920 |
mig-10(ok2499) III. |
C. elegans |
F10E9.6. Homozygous. Outer Left Sequence: AACACATGGCATTGCAAAAA. Outer Right Sequence: GCAACAGAAGGTGTACGCTG. Inner Left Sequence: TGATATCCGGACAGAGAGGG. Inner Right Sequence: CCAAGGAGTCGGTGATTTGT. Inner Primer PCR Length: 3015 bp. Deletion Size: 2263 bp. Deletion left flank: ACCCACATACCTTATACTTTATCCGAAAAT. Deletion right flank: GTGCTTGAGATATCAATCTAGATGGTTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1922 |
F46H5.4(ok2501) X. |
C. elegans |
F46H5.4. Homozygous. Outer Left Sequence: AAACGCAACTCGGAAAAATG. Outer Right Sequence: CTACACGAATGCTTGCTGGA. Inner Left Sequence: TCAATTCCTGGTAATGGTGAGA. Inner Right Sequence: TGTTTCTCTGGTTCATTCATGG. Inner Primer PCR Length: 3072 bp. Deletion Size: 2420 bp. Deletion left flank: GTTCAGCCATGTTAAGAAGCCAAGTTATTC. Deletion right flank: ATGATTTGAGCTGAATGTAGCAGATTTCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1923 |
ckr-1(ok2502) I. |
C. elegans |
T23B3.4. Homozygous. Outer Left Sequence: TTTCAAAAACCCTGGTACGG. Outer Right Sequence: AAATCGCCATTGAAATACGC. Inner Left Sequence: TGAGTTGGAGATGAAGGGCT. Inner Right Sequence: GATCCTCACAATCCTCGGAA. Inner Primer PCR Length: 2705 bp. Deletion Size: 1289 bp. Deletion left flank: CTTTGGAATTGGATGTCTAGTTTTTTTAGT. Deletion right flank: CAGTGGGGAGCTGAGATAAAAACAGAATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1924 |
F45H10.4(ok2503) II. |
C. elegans |
F45H10.4 Homozygous. Outer Left Sequence: aacgaacgagttcaattggc. Outer Right Sequence: ggccaccgatttttcctatt. Inner Left Sequence: taaagcaatttccccacagg. Inner Right Sequence: ttacggccacatagcaaaaa. Inner Primer PCR Length: 3175. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1925 |
C49G9.1(ok2504) I. |
C. elegans |
C49G9.1. Homozygous. Outer Left Sequence: TTTTAAGCCATAACACCCGC. Outer Right Sequence: ATGCATCGACGAATACACCA. Inner Left Sequence: CCAGGAAATTGTCAACACGA. Inner Right Sequence: ATCCCTTCCTCCACATCTCA. Inner Primer PCR Length: 1210 bp. Deletion Size: 385 bp. Deletion left flank: TAAGGATTTGATAATTTCATGAAAATTAAA. Deletion right flank: ATCCAAATTTTTTTTTTCCAAAATTTTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1926 |
T02G5.3&mmaa-1(ok2512) II. |
C. elegans |
T02G5.1, T02G5.13. Homozygous. Outer Left Sequence: TGATTGGTGCACTGGTCATT. Outer Right Sequence: AATCACGATACCTTGGACGC. Inner Left Sequence: TCGTTTCGAAATTCGTCCTC. Inner Right Sequence: ATGCCTGGTGACGACTACCT. Inner Primer PCR Length: 2798 bp. Deletion Size: 1381 bp. Deletion left flank: GTTTATACTCTGGAAAAAGTTACAAAATCA. Deletion right flank: GTGGGATCAATTGTTAAAACTGCAACTTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1927 |
C38D4.4(ok2513) III. |
C. elegans |
C38D4.4. Homozygous. Outer Left Sequence: ACAAGAGGTGGAAGAGCCAA. Outer Right Sequence: CTATCCTTATCCGACGGCAA. Inner Left Sequence: AAGAAACGGCTGCGGTAATA. Inner Right Sequence: TGATAGCTTCTAGACACTCATTATC. Inner Primer PCR Length: 3063 bp. Deletion Size: 1751 bp. Deletion left flank: TATTTGTCCTTATTTATTTTATTATTTGAA. Deletion right flank: AATTGACCGAAATCTACGATAAGCATTTCG. Insertion Sequence: CCGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1928 |
exoc-8(ok2523) I. |
C. elegans |
Y105E8B.2. Homozygous. Outer Left Sequence: CTACCGACTGAGCTATCCGC. Outer Right Sequence: AAATTTCATGGCGTTTTTGG. Inner Left Sequence: TTTCGCAAAATGCACAACAT. Inner Right Sequence: GCCCCAGTCAACGTTAAAGA. Inner Primer PCR Length: 2583 bp. Deletion Size: 1474 bp. Deletion left flank: TTAAAAATGAACAAATTTTTTGGAAAATCT. Deletion right flank: TCACAGTTTGCCGTTTTCCTCGAATAGTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1929 |
inx-21(ok2524) I. |
C. elegans |
Y47G6A.1. Homozygous. Outer Left Sequence: AAAGTGGCACCGAGAAGTTG. Outer Right Sequence: TCAACGAACTCGAATCATCG. Inner Left Sequence: CTCGCCTCAAAACCAATGTT. Inner Right Sequence: CGTCGATACTGTGGAACGAG. Inner Primer PCR Length: 3086 bp. Deletion Size: 1960 bp. Deletion left flank: ATATTATGGGGACGCAGAAAAATTCGCATT. Deletion right flank: CTAATTTTGTTTATATTGATGAGAAAACAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1930 |
spr-3(ok2525) X. |
C. elegans |
C07A12.5. Homozygous. Outer Left Sequence: CCCATTTTCAAATTCCATCG. Outer Right Sequence: GCAAGCATCAAAACTGACGA. Inner Left Sequence: GCGAAAAGAGTGCGGTCTAC. Inner Right Sequence: GATGGGAAGGGAAGGGAATA. Inner Primer PCR Length: 2752 bp. Deletion Size: 595 bp. Deletion left flank: CCGCCAGTTTTGGAAGTGTAGTACTCGCAT. Deletion right flank: GTCTACCATATTTTGTCACACCGTGTCAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1931 |
feh-1&nhr-239(ok2526) III. |
C. elegans |
Y54F10AM.1, Y54F10AM.2. Homozygous. Outer Left Sequence: ACAACATCCACCATCCACCT. Outer Right Sequence: ATAACCTTATGCCCAAGCCA. Inner Left Sequence: TTTTCAGATTCTAGGCCGTCA. Inner Right Sequence: GAGCCTAAGCCTAAGCCCAC. Inner Primer PCR Length: 3094 bp. Deletion Size: 2350 bp. Deletion left flank: CAAATTAGACTTAGGCTTTAAATTGTTTGT. Deletion right flank: AAACCGGCAAATTGATTTGCCGAATTTGCC. Insertion Sequence: TTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1932 |
ZK418.8(ok2535) III. |
C. elegans |
ZK418.8 Homozygous. Outer Left Sequence: aaaaccggtgaagtttgagg. Outer Right Sequence: catttgcgaaatgggaaagt. Inner Left Sequence: ttttcgagctacaacgacttttt. Inner Right Sequence: attgcgagcccatttgttat. Inner Primer PCR Length: 3125. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1933 |
F56D12.5(ok2536) II. |
C. elegans |
F56D12.5 Homozygous. Outer Left Sequence: aatatcgcaacggtgtctgg. Outer Right Sequence: tctagcagaccaatttgggg. Inner Left Sequence: gttcttgcaggtatccccat. Inner Right Sequence: cagcagcacaattcattcaaa. Inner Primer PCR Length: 3037. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1934 |
W07B8.4(ok2537) V. |
C. elegans |
W07B8.4 Homozygous. Outer Left Sequence: caatggggtttcaaagcaat. Outer Right Sequence: gccgattttcagttagcctg. Inner Left Sequence: catgtattcctcgggattcg. Inner Right Sequence: ttcgctctgattcacttcca. Inner Primer PCR Length: 3069. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1935 |
gcy-20(ok2538) V. |
C. elegans |
F21H7.9. Homozygous. Outer Left Sequence: TTGCGACAGCGTATTTTCTG. Outer Right Sequence: TTCGAATTTTCGACCAAAGC. Inner Left Sequence: ACCAGACTCACCTTGGCAAC. Inner Right Sequence: GCTCTGAAAGTCTCGCTGCT. Inner Primer PCR Length: 3244 bp. Deletion Size: 1321 bp. Deletion left flank: GGTCATTTTGGTGGAAGTTGAGGGGCCACT. Deletion right flank: TGAGTGTCTGATTCTATGGTCTTTAATTAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1936 |
M28.4(ok2539) II. |
C. elegans |
M28.4 Homozygous. Outer Left Sequence: agcgattccaaaatcactgg. Outer Right Sequence: tgcctggtaggcagaaaagt. Inner Left Sequence: cgctggattgttggttatca. Inner Right Sequence: gtcattggaattggaggtgg. Inner Primer PCR Length: 3023. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1937 |
rgs-7(ok2540) X. |
C. elegans |
F56B6.2. Homozygous. Outer Left Sequence: ACAGCGCAAGGTAGGTCAAT. Outer Right Sequence: ATCCCCAACAAAATTGGTCA. Inner Left Sequence: GAGTGTCGTCTGCTGGTTCA. Inner Right Sequence: CAGTTTCTCACCTCATCGCA. Inner Primer PCR Length: 3326 bp. Deletion Size: 1491 bp. Deletion left flank: CGTTGCCTTTCATTGCCCACGCACCCGCTA. Deletion right flank: CAGATTCAATGTTGAACACTTATCTGAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1938 |
Y116A8B.5(ok2541) IV. |
C. elegans |
Y116A8B.5 Homozygous. Outer Left Sequence: aaaataccggcgtcactgtc. Outer Right Sequence: atggctatttggagtggcaa. Inner Left Sequence: agctgaagcgtcagaaggac. Inner Right Sequence: ggtttggggaaagtgtcaac. Inner Primer PCR Length: 3290. Deletion size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1939 |
C50A2.2(ok2542) IV. |
C. elegans |
C50A2.2. Homozygous. Outer Left Sequence: AAAATCGTCGTCGAAACCTG. Outer Right Sequence: CTGACGCAAAATTGCAGAAA. Inner Left Sequence: ACAACGAACCGAGCCGAT. Inner Right Sequence: GTGCGTATTGGGAAGGTAGC. Inner Primer PCR Length: 3005 bp. Deletion Size: 1982 bp. Deletion left flank: ATTTAGTGTGACTAGGTTACTGTAGCACCA. Deletion right flank: CGTCAGATTGTGTTTACCAACAAAAAAAAT. Insertion Sequence: GACTTTTTTCTGCAATTTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1940 |
F55D12.5(ok2543) I. |
C. elegans |
F55D12.5 Homozygous. Outer Left Sequence: accatttgcctgttctcctg. Outer Right Sequence: actacaacagcaacccgtcc. Inner Left Sequence: aatcgcactcaggttgttga. Inner Right Sequence: tccaaccacaactaccacg. Inner Primer PCR Length: 1181. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1941 |
rbr-2(ok2544) IV. |
C. elegans |
ZK593.4. Homozygous. Outer Left Sequence: GAGGGGAAGATGAGTGTCCA. Outer Right Sequence: GCATGTCAGTGTTGATTCGG. Inner Left Sequence: TGCGTTGCTTGTAATGAAGG. Inner Right Sequence: TGAGCATGCTTCAAGACCAC. Inner Primer PCR Length: 3298 bp. Deletion Size: 1311 bp. Deletion left flank: CGAGTCGAGTAGGAAGTGGATTTCCTCGAA. Deletion right flank: GAGCAAAAGATGCTATCTATCGAGAACAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1942 |
ace-2(ok2545) I. |
C. elegans |
Y44E3A.2. Homozygous. Outer Left Sequence: GATGCGGATTTTCGAGTTGT. Outer Right Sequence: ACTTGCCTGCCTAGCAGTGT. Inner Left Sequence: ATGATTCGATGCTTCCCTTG. Inner Right Sequence: ATTCATGAGCACCGATCTCC. Inner Primer PCR Length: 3182 bp. Deletion Size: 1470 bp. Deletion left flank: TCAGCAAAATCAATAAGAGAGCAAGTAAAA. Deletion right flank: GTGTTAGAGAGTGATAATTGGAAAATTGAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1943 |
Y11D7A.8(ok2550) IV. |
C. elegans |
Y11D7A.8. Homozygous. Outer Left Sequence: ACGTTATGTCAGATTGCCCC. Outer Right Sequence: CAGAATGAGCCAAACAAGCA. Inner Left Sequence: CCACGATGCCACTAAAAGGT. Inner Right Sequence: AGTCTTTCCATCCGATTCCA. Inner Primer PCR Length: 2844 bp. Deletion Size: 1143 bp. Deletion left flank: ACATCTTTCATTTAATGTTTCGGAATTGCA. Deletion right flank: TTTCATCTATAATTTCAGCATATAGGAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1944 |
M01E5.2(ok2552) I. |
C. elegans |
ok2552. Homozygous. Outer Left Sequence: CAAAGATTGTGGCGGAAAAT. Outer Right Sequence: CGGTAGCTGATTTTCGTGGT. Inner Left Sequence: GTTACACCTTTTCCTGGCGA. Inner Right Sequence: CTAAAATTCTGCGGAAACCG. Inner Primer PCR Length: 2997 bp. Deletion Size: 2279 bp. Deletion left flank: ATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAA AATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAA AAATAGATTGTTACACGAAAAAATAGATTGTTAC. Deletion right flank: CAAAAAACTGTGAAAATTCACTTCAACTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1945 |
C10F3.7&fut-8(ok2558) V. |
C. elegans |
C10F3.6, C10F3.7. Homozygous. Outer Left Sequence: CAGTCAAAGGTGGCAACTCA. Outer Right Sequence: CGAAAATTGAAGCCCATTTG. Inner Left Sequence: TTGGTGCGAGAAGAACACAG. Inner Right Sequence: CATCAACTCCCACCAAATCC. Inner Primer PCR Length: 2789 bp. Deletion Size: 2239 bp. Deletion left flank: TCTCTACCGTTCATATACTTACCCCATCGA. Deletion right flank: GTAGCAAATGCGGTAATTGCACAATAGGTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1946 |
C30F12.7(ok2559) I. |
C. elegans |
C30F12.7. Homozygous. Outer Left Sequence: GGGTGTTCTTGCACCTGAAT. Outer Right Sequence: TTTGAATTTCCTTTGCCCTG. Inner Left Sequence: AGATGTTCATGAAAACGCCC. Inner Right Sequence: GATTGGTCATGGGGCTCTAA. Inner Primer PCR Length: 2691 bp. Deletion Size: 2003 bp. Deletion left flank: TAGGTTCCCATGCTTGAAAATATAAAGTCT. Deletion right flank: TGTGGGTTTATAAAACTTAATGAAAAACGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1947 |
Y106G6A.2(ok2561) I. |
C. elegans |
Y106G6A.2. Homozygous. Outer Left Sequence: TTCGGCTGACATGAAGACTG. Outer Right Sequence: CTTCAACAGCAAATGCCTGA. Inner Left Sequence: CGAAGGGTATGGGGAGAAAT. Inner Right Sequence: GGGGAACGAAACCCATAAGT. Inner Primer PCR Length: 2400 bp. Deletion Size: 1281 bp. Deletion left flank: GTGCGCCTTTAGAGTACTTTAGTTTCAAAC. Deletion right flank: AACCGGGTTATTGTCGATTCAATATTCATG. [NOTE (11-18-2015) A user has reported that this strain was heterozygous for ok2561 by PCR analysis.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1949 |
tra-2(ok2563) II. |
C. elegans |
C15F1.3 Homozygous. Outer Left Sequence: aaccagaaaagtcgccttga. Outer Right Sequence: tccacatcaagcatccagaa. Inner Left Sequence: ttggtgtgatggcaaagatg. Inner Right Sequence: atgcattcctgcgattcttc. Inner Primer PCR Length: 3370. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1950 |
F38A6.3(ok2564) V. |
C. elegans |
F38A6.3 Homozygous. Outer Left Sequence: aatcttgacgtcctctggga. Outer Right Sequence: acggaggtatgaggacaacg. Inner Left Sequence: tggaagacaatcggaaaagg. Inner Right Sequence: taaatcggagccagatccac. Inner Primer PCR Length: 2977. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1951 |
gcc-1(ok2565) X. |
C. elegans |
C15C7.2 Homozygous. Outer Left Sequence: ttaaaaatgctgagggtggc. Outer Right Sequence: caatgggcaaagacgagaat. Inner Left Sequence: tggcaaatatcattgcagga. Inner Right Sequence: cggtgacgagagagtcacaa. Inner Primer PCR Length: 2903. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1952 |
B0207.10(ok2568) I. |
C. elegans |
B0207.10 Homozygous. Outer Left Sequence: agtgatatgtgatgtggccg. Outer Right Sequence: accgtaaccccctttttcac. Inner Left Sequence: ttggcgagaacgttcaataa. Inner Right Sequence: tgtgttctctgtccccacaa. Inner Primer PCR Length: 1200. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1953 |
lec-7(ok2569) X. |
C. elegans |
R07B1.2 Homozygous. Outer Left Sequence: accctaaacgacattcgcac. Outer Right Sequence: aactatgcatgtgcatccca. Inner Left Sequence: aaacatctcaaaaatgcccg. Inner Right Sequence: gctcacgctaccatttcctc. Inner Primer PCR Length: 2100. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1954 |
Y48E1B.13(ok2570) II. |
C. elegans |
Y48E1B.13 Homozygous. Outer Left Sequence: ttcattttcacggccacata. Outer Right Sequence: tgaaaagtgccattgtttgg. Inner Left Sequence: tatgcagttttccaacgacg. Inner Right Sequence: atataccatgtgcccgcttc. Inner Primer PCR Length: 2793. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1955 |
T27A3.6(ok2571) I. |
C. elegans |
T27A3.6 Homozygous. Outer Left Sequence: atgtgggaattggcgataaa. Outer Right Sequence: tccggttcactgacttttcc. Inner Left Sequence: ggttgtatctacgggagcca. Inner Right Sequence: ttgcatttttctagccgctt. Inner Primer PCR Length: 2177. Deletion size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1956 |
C47B2.7(ok2572) I. |
C. elegans |
C47B2.7 Homozygous. Outer Left Sequence: ttggcgcgaaattacttttt. Outer Right Sequence: ttggaagctaaaaagccgac. Inner Left Sequence: caatatttagcgcgaaaccaa. Inner Right Sequence: aaaaaggctccaaaccttga. Inner Primer PCR Length: 1183. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1957 |
W03G11.2(ok2574) X. |
C. elegans |
W03G11.2 Homozygous. Outer Left Sequence: aacccaagatggatgcaaaa. Outer Right Sequence: tctgtggagcatcaggatca. Inner Left Sequence: tcttcatcgggtatgtgcttt. Inner Right Sequence: atcccagtggttttgacgtg. Inner Primer PCR Length: 3140. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1958 |
T07D4.1(ok2575) II. |
C. elegans |
T07D4.1. Homozygous. Outer Left Sequence: TTGGTTGGATCAGAAAGTGATG. Outer Right Sequence: GATTGCATGGTAAGACAGTGGA. Inner Left Sequence: ACCATTACGAATAGCATTGGCT. Inner Right Sequence: TTGTTCTGCTCTCGACATGTTT. Inner Primer PCR Length: 2673 bp. Deletion Size: 1767 bp. Deletion left flank: GTACAAGTGTTTGAAAAACCCTATAAGTAG. Deletion right flank: TTTTAACATCCACTTCACTTTGATTCCTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1959 |
F35H12.2(ok2576) X. |
C. elegans |
F35H12.2 Homozygous. Outer Left Sequence: cccaacaccttcagtcaggt. Outer Right Sequence: acctccatcctcaacacagg. Inner Left Sequence: ggaatactgggttttccgct. Inner Right Sequence: ggaagggacacacggaagta. Inner Primer PCR Length: 3288. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1960 |
F42A8.1(ok2579) II. |
C. elegans |
F42A8.1 Homozygous. Outer Left Sequence: caacgtgattatttgccacg. Outer Right Sequence: ttccaaacccaatttgaacc. Inner Left Sequence: tccagacgtattcctttccaa. Inner Right Sequence: aaatcaacttgtccaagggc. Inner Primer PCR Length: 1291. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1961 |
C06G3.7(ok2580) IV. |
C. elegans |
C06G3.7 Homozygous. Outer Left Sequence: gccgagacaacaagaaggtt. Outer Right Sequence: tcatacatcacacgacgcaa. Inner Left Sequence: tcgatttttcacagaaattgttaag. Inner Right Sequence: gagaaaaaccaaagagcagca. Inner Primer PCR Length: 3009. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1962 |
mlt-10(ok2581) II. |
C. elegans |
C09E8.3. Homozygous. Outer Left Sequence: AGGTTAAATTCCGAGTCGCC. Outer Right Sequence: TTTAGGTCGCTACTCAGCGG. Inner Left Sequence: AGGCAGAGATGGAAGACGAG. Inner Right Sequence: AAAATGCGGTTTATTGAACTGA. Inner Primer PCR Length: 3023 bp. Deletion Size: 1771 bp. Deletion left flank: CCACAAATCTCCCAGTACAAAGTACAAATT. Deletion right flank: TCCGAGTTGCTCGCCGAGCCGACATCGTCT. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1963 |
col-61(ok2582) I. |
C. elegans |
C01H6.1. Homozygous. Outer Left Sequence: CATTTTGTCCCTTCTTCCGA. Outer Right Sequence: ATTAAACGTGGCAAAGCACC. Inner Left Sequence: GAAGGTGTCTTCCTCCCCTC. Inner Right Sequence: AAATTGTGGCCAACTTCCAG. Inner Primer PCR Length: 2583 bp. Deletion Size: 1697 bp. Deletion left flank: AGTGAATTCAGTGTCCCAATGGAACGAGAA. Deletion right flank: GAGCCCATCCATAACGTGACGAAACAAAGG. Insertion Sequence: GCTCGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1964 |
K04G2(ok2584) I. |
C. elegans |
K04G2. Homozygous. Outer Left Sequence: AGGGGAAACAATGCATTCAG. Outer Right Sequence: CCAACAAGACAAGAATCGCA. Inner Left Sequence: TGAGAGTGAGAAGGACATGGAA. Inner Right Sequence: TGTGGAGCTCACGAAACACT. Inner Primer PCR Length: 1099 bp. Deletion Size: 387 bp. Deletion left flank: AATTGTTTTAAATCAGTTAAGCAAGCAGGT. Deletion right flank: GAAAAGTAGTCAAATACTTTATTTTACAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1965 |
Y105E8A.12(ok2585) I. |
C. elegans |
Y105E8A.12 Homozygous. Outer Left Sequence: cccgatcatcccaagattta. Outer Right Sequence: gctccaatgcgaatttgttt. Inner Left Sequence: ccaaatttgtactcgacccg. Inner Right Sequence: catcgattttgggaatcagg. Inner Primer PCR Length: 3158. Deletion size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1966 |
R11A5.4(ok2586) I. |
C. elegans |
R11A5.4. Homozygous. Outer Left Sequence: TGGGGGATCAAGTCAAGGTA. Outer Right Sequence: GGATCCCGAATGCAGAGATA. Inner Left Sequence: TGGGTTAGGAGTTGGTGGAG. Inner Right Sequence: ACGTCGTTCATCAAACGTCA. Inner Primer PCR Length: 2625 bp. Deletion Size: 1961 bp. Deletion left flank: ATAATTTTTTTCAGGGAGACTTCCATCTTC. Deletion right flank: ATTTTTTATTTGAAACGCATCTATTGTTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1967 |
aqp-4(ok2587) V. |
C. elegans |
F40F9.9. Homozygous. Outer Left Sequence: TTTAAATACTTCCCCGCACG. Outer Right Sequence: GTTCCAGCACAATCACATGG. Inner Left Sequence: GTTTGTGCTTTGCTCAACGA. Inner Right Sequence: TTGCCAAAGACAACGAACTG. Inner Primer PCR Length: 2660 bp. Deletion Size: 1180 bp. Deletion left flank: GACCTAAAACACTGTTCTATTTCACACTTT. Deletion right flank: AGGCTCCTTTTACAGTCACACGTATGGGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1968 |
C23H3.5(ok2588) II. |
C. elegans |
C23H3.5. Homozygous. Outer Left Sequence: AGCCCAAGCCAATTATCCTT. Outer Right Sequence: AACACGAACTTTGAATCGCC. Inner Left Sequence: TGGACATGTCAGATTTGGGA. Inner Right Sequence: TAATCTTGGGAAGTGGGCAA. Inner Primer PCR Length: 3031 bp. Deletion Size: 1218 bp. Deletion left flank: TTTTAGGTCAATCCTGTTCATCAATACCTG. Deletion right flank: TTGTCGGAAAATATCAATTCCGGCAATTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1969 |
C32B5.13(ok2589) II. |
C. elegans |
C32B5.13. Homozygous. Outer Left Sequence: CTCACCTGAGCCGTTCTTTC. Outer Right Sequence: GTCCGGCCACATACAAGAGT. Inner Left Sequence: AAACTTGCTCTCAGTTGCCC. Inner Right Sequence: GGACCGAAGACGTCTCAAAC. Inner Primer PCR Length: 2981 bp. Deletion Size: 1120 bp. Deletion left flank: TTCAACCAAAATATATCTTACAAGCCCATA. Deletion right flank: GCATAGGATGCATTGCACTATCCCTGATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1970 |
F33D11.10(ok2590) I. |
C. elegans |
F33D11.10. Homozygous. Outer Left Sequence: CATTTCGTCGATTTGTGTCG. Outer Right Sequence: TTTTCGCCGTATTATCTCGG. Inner Left Sequence: ACAAAGTTGATGGCGACTCC. Inner Right Sequence: GGAAATTTACGCGACTCGAC. Inner Primer PCR Length: 1348 bp. Deletion Size: 583 bp. Deletion left flank: AGAATAGTACAGCCTGTGTGATGGTAAGAG. Deletion right flank: GGAAATTGAAAAAGTCGCAGTCTTTCCGGT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1971 |
F57F4.4(ok2599) V. |
C. elegans |
F57F4.4 Homozygous. Outer Left Sequence: acagcagcatccggtaattc. Outer Right Sequence: aggactttgcgacagcatct. Inner Left Sequence: tgttcaaattacggcaaacg. Inner Right Sequence: acggagctctcttgtacgga. Inner Primer PCR Length: 3086. Deletion size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1972 |
F21F3.1(ok2600) I. |
C. elegans |
F21F3.1. Homozygous. Outer Left Sequence: TCTCCACATCCTCATCTCCC. Outer Right Sequence: CGGTGGCCTAGAAAAACAAA. Inner Left Sequence: CGTTGAAAATGTATGAGCCG. Inner Right Sequence: TGGAGGTGCAGGTTCTACAG. Inner Primer PCR Length: 1269 bp. Deletion Size: 572 bp. Deletion left flank: GTGTTTTTTGTGTGTGAGTGTGTGTGTGTG. Deletion right flank: GACTATTCAACCCCAGCAAAGAAATCGGTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1973 |
W04A4.4(ok2601) I. |
C. elegans |
W04A4.4. Homozygous. Outer Left Sequence: AAGTAACATGCTCATCCCCG. Outer Right Sequence: TTGAATGCATGAGTTGCTCC. Inner Left Sequence: TTTGTTCCCCTATTCGCATC. Inner Right Sequence: GCCAAAAGGCTATCCTATGATCT. Inner Primer PCR Length: 3177 bp. Deletion Size: 1678 bp. Deletion left flank: GTAGAAAAAAATACCGTTTTTTGTTTGAAG. Deletion right flank: CCCAAATTGCTCTTGTTGATCCTTACAGAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1974 |
smd-1(ok2602) I. |
C. elegans |
F47G4.7. Homozygous. Outer Left Sequence: AAACAGGAAAGGGGGAGAGA. Outer Right Sequence: AAGCCTTCAGATTCAAGCGA. Inner Left Sequence: CGACAAAGAGATGGGGAGAA. Inner Right Sequence: CGCACTCCAGGTCATAGACA. Inner Primer PCR Length: 3240 bp. Deletion Size: 1093 bp. Deletion left flank: GAGCGTAGACTAGGGTTTCCGTCTGCAAAT. Deletion right flank: GAACTCAACTTCTCTGTGGAATGTGTAAAG. Insertion Sequence: CAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1975 |
klc-1(ok2609) IV. |
C. elegans |
M7.2 Homozygous. Outer Left Sequence: aaatggcgccaagagatatg. Outer Right Sequence: tcacgcaattttgagttcgt. Inner Left Sequence: attgtcaggctgctggatct. Inner Right Sequence: cgattcaataattttcgggg. Inner Primer PCR Length: 2292. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1976 |
uev-1(ok2610) I. |
C. elegans |
F39B2.2. Homozygous. Outer Left Sequence: GAAATGCGTACTCGCACTGA. Outer Right Sequence: GGAAAAGTTCGAGGGGAAAG. Inner Left Sequence: ACGGATTTATTCGGATGGGT. Inner Right Sequence: TACCGGGGAGAGTAAACTGG. Inner Primer PCR Length: 1301 bp. Deletion Size: 480 bp. Deletion left flank: CTTGTCCGAGAGGACTACACAGTTAGCCTT. Deletion right flank: CCGTTCGTTTCACCACCAAAGTTCACATGG. Insertion Sequence: TGCAAACGCGCTCCACT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1977 |
Y66H1B.2(ok2611) IV. |
C. elegans |
Y66H1B.2. Homozygous. Outer Left Sequence: AGCGAGTCCAGTGTCGATTT. Outer Right Sequence: CGCTTACCGAAAATGCAAGT. Inner Left Sequence: GACGTCCTGGGAAGAACTTG. Inner Right Sequence: TCCAAAACTTTAAACCGCCA. Inner Primer PCR Length: 3218 bp. Deletion Size: 1763 bp. Deletion left flank: TTAAAAATATTGAGTTTCAACAATTTTACA. Deletion right flank: ATCGCGTAGACTCCTGGTTCTGTTGGAGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1978 |
ZK1248.15(ok2612) II. |
C. elegans |
ZK1248.15. Homozygous. Outer Left Sequence: GTACATGCAATGAGACCGGA. Outer Right Sequence: GTTTTCATGGAAGAGGCCAA. Inner Left Sequence: GAAGGTACATTCGTCATCCGA. Inner Right Sequence: ACCACGTGTTCCATGGTCTT. Inner Primer PCR Length: 1119 bp. Deletion Size: 577 bp. Deletion left flank: AAGAGTGATCTCGTCTGCTAGTGGGATCGA. Deletion right flank: AGCCGTTTATCTGAATCTGTTGCTCTGTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1979 |
del-3(ok2613) I. |
C. elegans |
F26A3.6. Homozygous. Outer Left Sequence: TCATCGCTTCTACGTGCATC. Outer Right Sequence: ATAATTGGAAGGGTTTCCCG. Inner Left Sequence: TAGCCCCCTACACCTCACAG. Inner Right Sequence: TAAATCGGCACCTGCTTTC. Inner Primer PCR Length: 1222 bp. Deletion Size: 350 bp. Deletion left flank: TATATAAATAAGACACAACTGGCGTCGATT. Deletion right flank: ATAATCAGCTGCTTCACGAAGCGATGGATT. Insertion Sequence: TCGTGAAAGCAGCTGATTACGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1980 |
C02C6.3(ok2614) X. |
C. elegans |
C02C6.3. Homozygous. Outer Left Sequence: CGTGTCTCTTCACATGCGTT. Outer Right Sequence: AAGTGAGGGAAAAGCAGCAA. Inner Left Sequence: CATTTGCTGAAAAACGCTGA. Inner Right Sequence: GCTGGCAGGTGGTTAAATGT. Inner Primer PCR Length: 2605 bp. Deletion Size: 1841 bp. Deletion left flank: TTTTCAAATAGACGATTTAACCTCTTAATA. Deletion right flank: AATTTTGGGTTGGGTCTTGGTTTAATATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1981 |
lin-23(ok2615) II. |
C. elegans |
K10B2.1 Homozygous. Outer Left Sequence: cgttttcatcgttttccgtt. Outer Right Sequence: attttatgggccaccatctg. Inner Left Sequence: caccgagcttcaacaactca. Inner Right Sequence: ctcttcgtctacgtcgcctc. Inner Primer PCR Length: 2567. Deletion size: about 1100 bp. [NOTE (08/24/2021): A user has reported that their stock of RB1981 received directly from RB appears to be heterozygous. Not known if that is also the case for CGC stock.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1982 |
vit-1(ok2616) X. |
C. elegans |
K09F5.2. Homozygous. Outer Left Sequence: AGCGTGAGCTCAAGGAGAAG. Outer Right Sequence: AGCTTCGTATCCACGACGAC. Inner Left Sequence: ACAAGGATGCTGAGACCACC. Inner Right Sequence: GCTACTGGCTCAACGGAGAA. Inner Primer PCR Length: 3252 bp. Deletion Size: 1797 bp. Deletion left flank: AAGGAAGCCATTGATGCCCTCAGACTTCTT. Deletion right flank: CGTGAAGTTCAACTCTCTCTTACCTCTACC. Insertion Sequence: CTTTCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1983 |
K05F1.5(ok2617) II. |
C. elegans |
K05F1.5. Homozygous. Outer Left Sequence: CTCACATTCACCCAGTGTGC. Outer Right Sequence: AACATCCCAACCACGAACTC. Inner Left Sequence: TTGGTGAGTACACCCTGAACA. Inner Right Sequence: TATTGCAAGTTGTTTTGCGG. Inner Primer PCR Length: 3142 bp. Deletion Size: 1240 bp. Deletion left flank: CCATTTGTCGTCAGGAACATTGGCTAGAAA. Deletion right flank: TGCACATATCTTCTGTTAAATTGTCCTTTT. Insertion Sequence: CATATTTTTTGTTAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1984 |
clec-227(ok2618) V. |
C. elegans |
F08H9.5. Homozygous. Outer Left Sequence: TTATCCGGACAATCCGTAGC. Outer Right Sequence: AAAGCAATCCGGTCAATACG. Inner Left Sequence: ACTTCAATACACCGGATGGC. Inner Right Sequence: ACTTTGTGCCAGCCAACTTT. Inner Primer PCR Length: 2163 bp. Deletion Size: 1295 bp. Deletion left flank: TTATAAAAGAAAAATTGTATTTTTTTGAAA. Deletion right flank: TTTATTATGTGAATGCTCCAACTGGATTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1985 |
C48B4.1(ok2619) III. |
C. elegans |
C48B4.1. Homozygous. Outer Left Sequence: TTTCCCCAACACAAACCATT. Outer Right Sequence: TGACGTGGATGGCTTAAACA. Inner Left Sequence: CCAATGGTGCCATTTCTTCT. Inner Right Sequence: ATGAAGTAACCAAGCGGTGG. Inner Primer PCR Length: 3288 bp. Deletion Size: 1509 bp. Deletion left flank: TACGAACAGCTGAATATCGAATTGAAATAG. Deletion right flank: AGTTCCGTTTGGGCATAAGTTCCAATGATC. Insertion Sequence: GTTCCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1986 |
Y111B2A.19(ok2620) III. |
C. elegans |
Y111B2A.19 Homozygous. Outer Left Sequence: attttcggtaatttgccggt. Outer Right Sequence: aaaattacgctccgcctctt. Inner Left Sequence: tctgccagtttgctggaaat. Inner Right Sequence: tgcgcgacgctacttataga. Inner Primer PCR Length: 3222. Deletion size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1987 |
Y40C5A.4(ok2622) IV. |
C. elegans |
Y40C5A.4. Homozygous. Outer Left Sequence: CAGAAGCGTTTTGCTGTGAC. Outer Right Sequence: TTTTTGTGGGTGTGATTGGA. Inner Left Sequence: TGGGTCAACGATAAGATCCC. Inner Right Sequence: TTGCACTCATCAGTATTGTTCAC. Inner Primer PCR Length: 3131 bp. Deletion Size: 1099 bp. Deletion left flank: TGTGCAACATCTCGTTATGAGATAACAAAA. Deletion right flank: AAAAAGTATATTAGGGCAGGAATATGGGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1988 |
spe-17(ok2623) IV. |
C. elegans |
ZK617.3. Homozygous. Outer Left Sequence: TGCTGCACCTAACAATCAGC. Outer Right Sequence: CAAGCGAACAGCAGTCACAT. Inner Left Sequence: GCTTGAATTTTTGACTGTGGC. Inner Right Sequence: GTTGTCGAATTATTGCGGCT. Inner Primer PCR Length: 1167 bp. Deletion Size: 285 bp. Deletion left flank: GGTAATCTCTAGTTGTCTTCCAGTTTCAGT. Deletion right flank: CTCGGAAGTTGAGAACGTGGCGGCCACGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1989 |
flp-10(ok2624) IV. |
C. elegans |
T06C10.4. Homozygous. Outer Left Sequence: CCTATGATCCAAGCCCTCAA. Outer Right Sequence: AAAACTTGACGACTGGTGGG. Inner Left Sequence: TCCAATTAACGTTTATGACCGA. Inner Right Sequence: GCATGATGACGTGGATTTTG. Inner Primer PCR Length: 1168 bp. Deletion Size: 682 bp. Deletion left flank: CCCATCTCACTAATTATACGCCTAAATCTT. Deletion right flank: ACATTCGATTCGGAAAACGAAGAGTCGATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1990 |
flp-7(ok2625) X. |
C. elegans |
F49E10.3. Homozygous. Outer Left Sequence: GAAGGCGGAGTCATAGCATC. Outer Right Sequence: TGAAGGACTGGAAAACAGGC. Inner Left Sequence: ATGAGAAGAAGGGGGTGGAG. Inner Right Sequence: TTGGGTAGCGACCAATCTGT. Inner Primer PCR Length: 1302 bp. Deletion Size: 548 bp. Deletion left flank: TCCTATTTTTTCTATTTTTTATATTTTTCA. Deletion right flank: TGCAAACACCTTGATTACCAAGAACAAAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1991 |
F26F2.1(ok2626) V. |
C. elegans |
F26F2.1 Homozygous. Outer Left Sequence: attttcgaaacgccaagcta. Outer Right Sequence: tgagcaacagtttcaggacg. Inner Left Sequence: tcatttgagcttgttgctgg. Inner Right Sequence: gcggagggtaagagatttttg. Inner Primer PCR Length: 3101. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1992 |
C44B9.1(ok2627) III. |
C. elegans |
C44B9.1 Homozygous. Outer Left Sequence: acaccctggcacactttttc. Outer Right Sequence: ggatacattttcccgctcaa. Inner Left Sequence: taattttgcttgcttccgct. Inner Right Sequence: aatcaccgtccttctggaaa. Inner Primer PCR Length: 3150. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1993 |
C06B3.3(ok2628) V. |
C. elegans |
C06B3.3 Homozygous. Outer Left Sequence: ggcaaagatcacaattccgt. Outer Right Sequence: tgggaatgggaagagatttg. Inner Left Sequence: aaggcttcgcatctcttgg. Inner Right Sequence: tgcaaggtaccattaaccga. Inner Primer PCR Length: 1208. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1994 |
dod-24(ok2629) IV. |
C. elegans |
C32H11.12. Homozygous. Outer Left Sequence: TTCCGTGATCACAATTGACC. Outer Right Sequence: GGTTAACCTCCCCAATTCGT. Inner Left Sequence: TGTGTCCCGAGTAACAACCA. Inner Right Sequence: ATTGTCGTCACTTTTCGGCA. Inner Primer PCR Length: 1260 bp. Deletion Size: 401 bp. Deletion left flank: CCATGAACAGTGGATAATCGATGAGCTTAT. Deletion right flank: TTCTGGAGCCTGAATAGAACTATATTTAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1995 |
F35E2.1(ok2630) I. |
C. elegans |
F35E2.1. Homozygous. Outer Left Sequence: TGCGGATCTTGTTGTCTGAG. Outer Right Sequence: ATGGAACTTGTTCGGGTGAG. Inner Left Sequence: AAGGCGTATGTCCGAAGATG. Inner Right Sequence: CAATTGATTTGTAGACTGATTGGAA. Inner Primer PCR Length: 1374 bp. Deletion Size: 311 bp. Deletion left flank: ACTCTCTCATAGTTTATAGTGTGGGAAAGT. Deletion right flank: TTTGGGAAACATCCACATAAAGCTGTATCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1996 |
try-11&try-8(ok2641) V. |
C. elegans |
F25E5.3 & F25E5.10. Homozygous. Outer Left Sequence: CGAGGGAACAACTCCAGAAG. Outer Right Sequence: CTTGTTCGCAGTGTTGCAGT. Inner Left Sequence: TGTCCACATATGAGTCTGCCA. Inner Right Sequence: TGAACGACAATCTGGACATGA. Inner Primer PCR Length: 3023 bp. Deletion Size: 1520 bp. Deletion left flank: CAGCTTCAAGCAACATGTGGACGTAACACA. Deletion right flank: CATGGAACTTACTCACGGCGGCACCTCCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1997 |
mtr-4(ok2642) IV. |
C. elegans |
W08D2.7. Homozygous. Outer Left Sequence: CAGCTCACACATCTGCTGGT. Outer Right Sequence: AGAGCATCATCGTTTCCCAG. Inner Left Sequence: CGTCTCCAATCAAAGCACTG. Inner Right Sequence: CACTTTTTCTTTCGGCTTTCA. Inner Primer PCR Length: 3060 bp. Deletion Size: 1554 bp. Deletion left flank: CTTAAAATATTTTTAACTTCAGAATGGGTC. Deletion right flank: AAAGAATTATTCAAATTCAACGAGAACCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1998 |
hog-1(ok2643) X. |
C. elegans |
W06B11.4. Homozygous. Outer Left Sequence: TGAAGCTAATGCTGAACCGA. Outer Right Sequence: CAGTACAAACGGCTGCACAT. Inner Left Sequence: TTGTGGCCTAAAATGCAAAA. Inner Right Sequence: TCATGCTTGTTTTTCTACCGA. Inner Primer PCR Length: 1280 bp. Deletion Size: 487 bp. Deletion left flank: GTAGTTTTCTAAAATTTTATTGTTAACAGT. Deletion right flank: AGATAAGATGTTTTGCAGATACAGCGAGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB1999 |
grl-7(ok2644) V. |
C. elegans |
T02E9.2. Homozygous. Outer Left Sequence: AGACCCTCCGTACCTGGTTT. Outer Right Sequence: CTTTGAATGGCAGTGTGACG. Inner Left Sequence: AAGCTCGGAAGCGTGCTG. Inner Right Sequence: CTATTGCATAACCGCCCATC. Inner Primer PCR Length: 1207 bp. Deletion Size: 424 bp. Deletion left flank: CGATTCCTGAGCTGTAGCAACTTCCGCGAC. Deletion right flank: CGGAATAGCATTCTGGAAATAGAATCAACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2000 |
maoc-1&E04F6.6(ok2645) II. |
C. elegans |
E04F6.3, E04F6.6. Homozygous. Outer Left Sequence: AACGATGGAGAGGAAACGTG. Outer Right Sequence: TGAACCACGTCCAGAAGATG. Inner Left Sequence: GGACGGTCATTGTTATCTCTTG. Inner Right Sequence: CGGTGGGAATAAGACAGAGG. Inner Primer PCR Length: 3145 bp. Deletion Size: 2110 bp. Deletion left flank: ATACTTTTTTTGCAAATTATTTAAAACATC. Deletion right flank: AGTAAAACCATTCAAATATAATATAAATTC. Insertion Sequence: AGTAAAAACGTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2001 |
F52E10.3(ok2646) X. |
C. elegans |
F52E10.3. Homozygous. Outer Left Sequence: TCGGACTCCTGTTCGCTAGT. Outer Right Sequence: TGGCAGTTTCTCTTCTCCGT. Inner Left Sequence: CAACGGGCATCTTTGTAATCT. Inner Right Sequence: GGATTTATGGCTCTCACCCA. Inner Primer PCR Length: 1229 bp. Deletion Size: 533 bp. Deletion left flank: GTGGAAATTCGTTTTCAGTAGGGCGTATTT. Deletion right flank: TAATATTTTTAAATTCAAGTTATAAGCATT. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2002 |
F41E7.2(ok2647) X. |
C. elegans |
F41E7.2 Homozygous. Outer Left Sequence: aatgccaactatgattcgcc. Outer Right Sequence: tctcgcggatacaaagacct. Inner Left Sequence: aagaacagggaatcggaacc. Inner Right Sequence: ttctctcctcgttccacctc. Inner Primer PCR Length: 3078. Deletion size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2003 |
Y48E1A.1(ok2655) II. |
C. elegans |
Y48E1A.1. Homozygous. Outer Left Sequence: TTCAGCTTTGAAATTTCCGC. Outer Right Sequence: GCCATTTTGGGCAATAAAAA. Inner Left Sequence: CTCCGTCGTCTGATCCTCTC. Inner Right Sequence: TTCAGGAATGAGATCCCTCG. Inner Primer PCR Length: 2607 bp. Deletion Size: 1490 bp. Deletion left flank: CAGTTTCAATTCCCGCTGCCATATTTCCCT. Deletion right flank: TTTTGTCTCAGAAAATCCGCATTTTTTGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2004 |
clec-63(ok2656) II. |
C. elegans |
F35C5.6. Homozygous. Outer Left Sequence: ACACCCATCAGTCCTTCCTG. Outer Right Sequence: ACCAAAACATGCCTACCTGC. Inner Left Sequence: GGTGTTATCAGTGATGGGGG. Inner Right Sequence: TACCCCAGATATGTCCGAGC. Inner Primer PCR Length: 2202 bp. Deletion Size: 823 bp. Deletion left flank: AATTTCTGAAGATCAGACAAAAATAGAGAG. Deletion right flank: TTGGATGGCAGAACATCAACGCATACAGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2005 |
T28F2.7(ok2657) I. |
C. elegans |
T28F2.7. Homozygous. Outer Left Sequence: CGTCGATTCCAGTAATCCCA. Outer Right Sequence: CATTCATCTGCATGGACACC. Inner Left Sequence: CGCAGCTAGAGTTTCACAGC. Inner Right Sequence: CAGAGCTTTAACATTGAGATGCC. Inner Primer PCR Length: 1202 bp. Deletion Size: 776 bp. Deletion left flank: AAACCTGAAAATCTTAGTAGCATAAGAACA. Deletion right flank: CTGAAATTCGAAAAAGTTGGTGAGCAAATT. Insertion Sequence: CACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2006 |
spi-1(ok2658) II. |
C. elegans |
R10H1.4. Homozygous. Outer Left Sequence: TTGGTCACTGATATGCGCTC. Outer Right Sequence: AAGTCGACCGAGTCGTCAAT. Inner Left Sequence: GGGAAATGAAAATAAGGTCAATG. Inner Right Sequence: TGCTCAACGAGATGTGGAAA. Inner Primer PCR Length: 1194 bp. Deletion Size: 711 bp. Deletion left flank: ATGACCGAGACTGGTCCGACCTCCGATATT. Deletion right flank: GGATTAAATGAAGTTTGGATGGTTTGTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2007 |
grl-6(ok2659) X. |
C. elegans |
K10C2.5. Homozygous. Outer Left Sequence: ACAAACACCAACAGCGATGA. Outer Right Sequence: TCAATTGCAAAAATGCTCGT. Inner Left Sequence: TTGTTGGATTTTGCTTTTACGA. Inner Right Sequence: CTCAGAATTTCCCCCAAAAA. Inner Primer PCR Length: 1134 bp. Deletion Size: 570 bp. Deletion left flank: TTGGCAGAATGTATCGGTATGAGCTATGTA. Deletion right flank: GGTTTATTGCTGAAACTTACTGAGCCGGGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2008 |
pgp-14(ok2660) X. |
C. elegans |
F22E10.3. Homozygous. Outer Left Sequence: TCCAGAAGCAGAATTTTGGG. Outer Right Sequence: TGGGTTTTCGAAGGTTTCAC. Inner Left Sequence: GGACCAAAGCTCTGGCAAT. Inner Right Sequence: TTGTTTGCTGTTGTTTCGGA. Inner Primer PCR Length: 1234 bp. Deletion Size: 688 bp. Deletion left flank: GACCAAAGCTCTGGCAATTGCAATTCTCTG. Deletion right flank: AAAGATTGAGTTAGACTGTAATTGATGGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2009 |
F46A8.9(ok2661) I. |
C. elegans |
F46A8. Homozygous. Outer Left Sequence: TTTTTACGCGGTAAACCCTG. Outer Right Sequence: AAATTTGGAAGGTTTTGGGG. Inner Left Sequence: TATTCCACACTCAACGCGAG. Inner Right Sequence: ATGGCTGATTATGCTGGGAG. Inner Primer PCR Length: 2229 bp. Deletion Size: 997 bp. Deletion left flank: TGTTTCAATAATACAATAGCTATTTCAGAA. Deletion right flank: AGCGGCAAGATCCACGCCAATGGTCATTCC. Insertion Sequence: GA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2010 |
ZK795.4(ok2662) IV. |
C. elegans |
ZK795.4 Homozygous. Outer Left Sequence: catcaaccaccaccagtgag. Outer Right Sequence: aaaatcgatgcattcggaag. Inner Left Sequence: cggttgggacgatcaaaag. Inner Right Sequence: tcataatacttttccgccgc. Inner Primer PCR Length: 3038. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2011 |
ugt-62(ok2663) III. |
C. elegans |
M88.1. Homozygous. Outer Left Sequence: AAACATGGTTCCCGACATTC. Outer Right Sequence: AATTCGGTGCATTTGGAAAA. Inner Left Sequence: GCAACTTTGGAATTTTTGGG. Inner Right Sequence: ATCAGATTTCCTGCGCAACT. Inner Primer PCR Length: 3024 bp. Deletion Size: 1367 bp. Deletion left flank: ACGCTAAATTGTTTTAATACATTTTAAAGT. Deletion right flank: ATGAAATATTTCTCGATTAAAGTTTCTCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2012 |
T21C9.11(ok2664) V. |
C. elegans |
T21C9.11. Homozygous. Outer Left Sequence: AAAATTTGAATCGGGCGTTA. Outer Right Sequence: ACTCTTTCGCCTGAAATCCA. Inner Left Sequence: CGATTTTTGTACATTCAGGCAA. Inner Right Sequence: TTTCTGGTCGAAAGTGGTCA. Inner Primer PCR Length: 3024 bp. Deletion Size: 2525 bp. Deletion left flank: AGGCAAAAATCCATTTGTTCCGTCATTTTT. Deletion right flank: GAAATGCCACGTCAGCAGAGTGAAATGTGG. Insertion Sequence: GAACGAAAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2013 |
T08A9.13(ok2666) X. |
C. elegans |
T08A9.13. Homozygous. Outer Left Sequence: AAGAAAAGCTTGCAACGAGC. Outer Right Sequence: AGCTCCAATTGCAGTTTCGT. Inner Left Sequence: TCAATTGTTCCCCACTCTCC. Inner Right Sequence: CAATGCCACTTCGGTTTCTT. Inner Primer PCR Length: 2631 bp. Deletion Size: 1432 bp. Deletion left flank: AATGTACTAAACATTTATACTATGTTGCAA. Deletion right flank: TTGAGAAGCTTTTTGTGCAGCAATAATGGC. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2014 |
F47G4.5(ok2667) I. |
C. elegans |
F47G4.5. Homozygous. Outer Left Sequence: AAATCGGAAGACAAGCATCG. Outer Right Sequence: AATCCTCTCCAAGTCCCGTT. Inner Left Sequence: TGAATACAAGCCTTCGCCTT. Inner Right Sequence: TTTTCCTTCCAGTGCAATTC. Inner Primer PCR Length: 1117 bp. Deletion Size: 570 bp. Deletion left flank: AAGTGTCCATGCTGATAATATTATCTGAAA. Deletion right flank: ACGGTTGAAGATGACCGCCGCTGTCGGATC. Insertion Sequence: CGGTTGAAGATAATATTATCTGAAACGGTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2015 |
acs-5(ok2668) III. |
C. elegans |
Y76A2B.3 Homozygous. Outer Left Sequence: aacaacacgttgctggagtg. Outer Right Sequence: ccacccatggcctaactcta. Inner Left Sequence: tctaatcgagttggattcacg. Inner Right Sequence: tgcaattacagggtcaacca. Inner Primer PCR Length: 3069. Deletion size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2016 |
gfi-1(ok2669) V. |
C. elegans |
F57F4.3. Homozygous. Outer Left Sequence: AGATAGATGGAAGAGCGGCA. Outer Right Sequence: TCGAGATGTACGACGAGTGC. Inner Left Sequence: AGCTTCCTTGACGTTGCAGT. Inner Right Sequence: GGCTGGATATGGTGGAAAGA. Inner Primer PCR Length: 1147 bp. Deletion Size: 658 bp. Deletion left flank: TTTACAACTGGAATAGTGTTTGTGGTGTTTACGGCAGCTTCCTTGACGTTGCAGTTGGT TCCGGTTGTGCAGCAGTAACCGGTGATATCCTTGTCTGTGGAGATGGTCTTACGCTCGT TGTTTAATCCAAGGGACTTGCAAATTGTCTTTGGAACGCAATGATATGACTTGTAAAGA ACATTATTGACAGTTGTCTCAAGAGATCCGCAATATCCGTCACATGATACGGTTCCTCC AACGTTGACATTTCCGTCACTGGTGTAGACTCCGACGTAGCACTTGGCTGGTCC. Deletion right flank: ATTCCAAGTTGATAGCATGTGCTGACTGGATCGCAAGTGTAAATTGTAGCGTTGGTGAG AGCTCCATTGTACATGGTTGAGAGAGTAGCAGAAGCGCATTCTCCCTTACATGCTTGCC AACCAGCGATGGAAATTGGCATGTTATTGACGTAAAGACCAGAGAAGCAAGCGATTGGA TAATCACGGAAGTTCGTAACTGGCATTGAAGTATTGATCTTTCCACCATATCCAGCCAA ATCGACGTTGCAGTTGTTGTAGTTGTCGCAGCAGCATCCCGTAACTGTGGTATCATATG GAAGTGGTTTGCACTCGTCGTACATCTCGAGTTGTCTGCAGAATTGGGTTGGCACGCAT CCGAAGATAGCAACTGGGTCTTGGTTGAGGGTAGCTTGAATTGAGGCGCACTTTCCTGG GCAGAAGATTTCAGATCCAGTGGCCTTTCCTTGAGCGTAGATTCCAGCGAAGCACTTGC GGAATCCAGATGGTACAGTCTTGTTCTTTGGTGGATCAAGGCAGAGATCAGTGTTACAG CAGCATCCGGAGACTCCTGGGATTGGGGAGGCACACCAGTTGTTCATGTTGAGAGATTG GCAAACAGTGCTTGGGTCGCATCCGTAAAGAGTTGCTGTGGTGGCAACTCCGTTGAGTG TAGTGTTCAATGAGATGGACGCACATTGTCCCTGGCAAGCTCCGAGAATGACTGGAGTA GATGGAACACCGTTGACATAAAGTCCAGTGTAGCAAGCAATAGCATAGTCGACTGAAGT TGGTGGTGGTGGTGGAGTGATGGTGGTATTGGCAATGTTACAGTTGTTGGCATTGTTAC AGCAGCATCCAGTGACTTGGTTGTCATTCCAAACTGGTTTGCAGTTGTCGTAGAGTTCA AGGGAGTTACAGATCGAGTTTGGCATGCAGTGATAGGTGTTGACTTGGAATCCACCGAC AACTCCTGAGAGGGATGAGCATTGTCCGTTACATGGAATTTGAGCTCCAACGTTAACTG CGCTTCCATTAACAATGTAGTTCGAGCTGATACCAGCATAGCACATAAGTTGGTTTCCT GGGTTACGAGCTGGATAGACTGTTGGATCAATACAGGCATTGGTGTTACAGCAGCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2017 |
T21D12.3(ok2670) IV. |
C. elegans |
T21D12.3 Homozygous. Outer Left Sequence: cgctgaaaaacggagaagtt. Outer Right Sequence: taatcaaacgacaccgtcca. Inner Left Sequence: cgaaatttttgaatttttgaatcc. Inner Right Sequence: tggctcaacaactatggtgc. Inner Primer PCR Length: 1362. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2018 |
grl-5(ok2671) V. |
C. elegans |
Y47D7A.5. Homozygous. Outer Left Sequence: TTTTTCCCTCTTTATCCCGC. Outer Right Sequence: TGTAAATGTTGTTCCACCGC. Inner Left Sequence: CCAGCCCAACCTAAGCCTAA. Inner Right Sequence: AAACTTTCTGCAAAATGCTCTACA. Inner Primer PCR Length: 1187 bp. Deletion Size: 624 bp. Deletion left flank: ATTAATGTCAATCAGGCTTTCAAGTCAAGG. Deletion right flank: AATCACACTGTTACAAGAGTACAGAAAGAA. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2019 |
csq-1(ok2672) X. |
C. elegans |
F40E10.3. Homozygous. Outer Left Sequence: AGATCCCAGACGATCCAGTG. Outer Right Sequence: CCGAGGCAAAACATCCTAAA. Inner Left Sequence: TGAAAATATGGATGACGAATGTG. Inner Right Sequence: AAGAAACTACCAAGCGGCAA. Inner Primer PCR Length: 1222 bp. Deletion Size: 348 bp. Deletion left flank: AAGTTTATATCCTTGCTAGAAAAAAATAAT. Deletion right flank: AAACACTCCGACTCCAACTTCGAGGCTCTC. Insertion Sequence: TGTGCTCCAGAGAGATCCAAAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2020 |
T22F7.4(ok2673) III. |
C. elegans |
T22F7.4. Homozygous. Outer Left Sequence: CGTGACGTCAGCACACTTTT. Outer Right Sequence: AATTTTCTTGCCCCCTTCTC. Inner Left Sequence: ACGCGTCGCAATTTTTGTAG. Inner Right Sequence: CGTTTCGCTCGTTTATGTTG. Inner Primer PCR Length: 1283 bp. Deletion Size: 491 bp. Deletion left flank: ATTAATTTTTGTGAACGCCTATTTTAGAGG. Deletion right flank: AAAAAAATTTTTGAAAAAAAAATTTTTTTT. Insertion Sequence: GG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2021 |
srt-34(ok2674) V. |
C. elegans |
F54E2.6. Homozygous. Outer Left Sequence: TGGTGTTCTTCCGACTGTCA. Outer Right Sequence: AATTATTTTGGCGTTCGCTG. Inner Left Sequence: TGCATAGTTTTGCAATTCACC. Inner Right Sequence: GGTTCTGTGCTTTCGATTCC. Inner Primer PCR Length: 1286 bp. Deletion Size: 496 bp. Deletion left flank: AGGTAGGTTCGTTTATCATCGAAAAGCACA. Deletion right flank: TTCAAGCATAATTGTTGATTGAAGATTTAT. Insertion Sequence: ATTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2022 |
ZK1307.1(ok2675) II. |
C. elegans |
ZK1307.1 Homozygous. Outer Left Sequence: tcacctccttattggttgcc. Outer Right Sequence: atttgccggtgtcttttgag. Inner Left Sequence: tgcaggtgggtagtagaggg. Inner Right Sequence: agatttacaagggttcgggg. Inner Primer PCR Length: 1192. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2023 |
btb-13(ok2676) II. |
C. elegans |
ZC204.11. Homozygous. Outer Left Sequence: AATGAGAGAAGAGACGGCGA. Outer Right Sequence: CTGCTGAGCGTCCATTATGA. Inner Left Sequence: TTGGGATACACTGTAACAAAACC. Inner Right Sequence: CAAGAATCCTGTCTGACGCA. Inner Primer PCR Length: 1210 bp. Deletion Size: 686 bp. Deletion left flank: ATCCGAAAGCTGTGGGAACTCGGCGCACGT. Deletion right flank: GCTGTAAATTTGCATGTTAATTTTGCTCAA. Insertion Sequence: TTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2024 |
gly-15(ok2682) I. |
C. elegans |
C54C8.11. Homozygous. Outer Left Sequence: TCAAGCTGACAACGTTCCTG. Outer Right Sequence: CTTGTCCTTGCGTTGTCCTT. Inner Left Sequence: GGGTCCTGCCACTCAGACTA. Inner Right Sequence: CCGACACTACTTGAATAACCCC. Inner Primer PCR Length: 1138 bp. Deletion Size: 449 bp. Deletion left flank: TTTGTCACGTTTTTGCCATTGGTTTTGGTA. Deletion right flank: TTTGAGGTGATACAAAAAAACTGTCAACTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2025 |
eri-1(ok2683) IV. |
C. elegans |
T07A9.5. Homozygous. Outer Left Sequence: CCAAAGAACTTCCATCTGCC. Outer Right Sequence: TGCGGGTCATCACTAATCCT. Inner Left Sequence: TTTCGATAGGATGACGAAACG. Inner Right Sequence: GGGCTTTAACACAATTCTCCC. Inner Primer PCR Length: 1218 bp. Deletion Size: 811 bp. Deletion left flank: CCCGGAAAAAATGATTTTCTTGCGGGAAAA. Deletion right flank: TTTTCAGATTCGTCGGTTCTGGTTTCAGCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2026 |
gla-3(ok2684) I. |
C. elegans |
T02E1.3. Homozygous. Outer Left Sequence: AGACCCTGAATGAATCCGTG. Outer Right Sequence: GTGGCTCCTTGAGAGTTTCG. Inner Left Sequence: TACCATATCCCACCACAGCA. Inner Right Sequence: ATCGAGCAGATTCTCGTTGC. Inner Primer PCR Length: 1125 bp. Deletion Size: 657 bp. Deletion left flank: CAGAGTGATCAAATGAGTAATGGTCATCAC. Deletion right flank: GAAAGCTCAAGTCCTGTCGTGATGTCTTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2027 |
src-1(ok2685) I. |
C. elegans |
Y92H12A.1 Homozygous. Outer Left Sequence: ctggcaccacgtgatatttg. Outer Right Sequence: tatccgctcacctctgcttt. Inner Left Sequence: catttacatggtggtgagcg. Inner Right Sequence: attcctcggcacataaccag. Inner Primer PCR Length: 2697. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2028 |
set-12(ok2686) X. |
C. elegans |
K09F5.5. Homozygous. Outer Left Sequence: AAACCGTTTGAAAGTCCACG. Outer Right Sequence: GACAGTTTTGCGGTGTTGAA. Inner Left Sequence: AGATTGCCCATGATGCTTCT. Inner Right Sequence: CTTTCCTCACTGACAATGGC. Inner Primer PCR Length: 1090 bp. Deletion Size: 448 bp. Deletion left flank: TGGCTAGTGGAACAGGAGCTGTGACATCGG. Deletion right flank: TTGTTTTCAAAGTATTACAAAGTCAACTTA. Insertion Sequence: AACAGGAGCTGTGACAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2029 |
add-2(ok2687) V. |
C. elegans |
F57F5.4 Homozygous. Outer Left Sequence: aacgaatccgtggttacgaa. Outer Right Sequence: tcggatggaagtgatgatga. Inner Left Sequence: catcacatttcgatcaccca. Inner Right Sequence: caaacaacgatggaaattattg. Inner Primer PCR Length: 3279. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2030 |
nlp-3(ok2688) X. |
C. elegans |
F48C11. Homozygous. Outer Left Sequence: ATACCCGCCATCATCTCAAA. Outer Right Sequence: TATTTCGGTATCTGCCGAGC. Inner Left Sequence: TCAGCAGCACTTGACAAACA. Inner Right Sequence: AAAATGTTCTTGACGCGGAG. Inner Primer PCR Length: 3211 bp. Deletion Size: 1618 bp. Deletion left flank: AACCCAAGTTGCTACAAATCATTTGAAACA. Deletion right flank: TGCTTACAATGAACAATTGTGTCCCGGATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2031 |
D2005.1(ok2689) I. |
C. elegans |
D2005.1. Homozygous. Outer Left Sequence: TGCAAACTCCACCATTCTCA. Outer Right Sequence: AAGAAATTCAACGTGCCACC. Inner Left Sequence: TCGAAAGCAGCAAGAGTGAA. Inner Right Sequence: GATGACTGAATACTATCAAATACCT. Inner Primer PCR Length: 1124 bp. Deletion Size: 512 bp. Deletion left flank: ATGAGATATGCCCATATGCATTCTCATTTG. Deletion right flank: ACATTGCTCTGCGGGCAAGAATAATAGCAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2032 |
rop-1(ok2690) V. |
C. elegans |
C12D8.11. Homozygous. Outer Left Sequence: AAGGCCACAATCTGTTCTGC. Outer Right Sequence: GACAAGAAGCAACCCCAAAA. Inner Left Sequence: CTTGTCCGATCTTCCAATCC. Inner Right Sequence: ACACCATGAGCTGGTTCACA. Inner Primer PCR Length: 3130 bp. Deletion Size: 1172 bp. Deletion left flank: TAATCTGAGTAGGCATTGAGCATTGGACAT. Deletion right flank: GTTTTGCACACAGTAACTACTAAATTCAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2033 |
C49A1.2(ok2691) I. |
C. elegans |
C49A1.2. Homozygous. Outer Left Sequence: ACAACCCCAGGTCAATGGTA. Outer Right Sequence: AGGAGATAACGTGGTGGTGG. Inner Left Sequence: AGAACCGTTCGGCTACAAAA. Inner Right Sequence: GCCCATAAAAACCTGACACC. Inner Primer PCR Length: 3118 bp. Deletion Size: 1707 bp. Deletion left flank: CGTCCAATCTATCAACTTCTACTTGCACTT. Deletion right flank: AGTTTTAAGCTCCTCTGATAGCTCTGTTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2034 |
F52H3.4(ok2692) II. |
C. elegans |
F52H3.4. Homozygous. Outer Left Sequence: TTAGCGAAGCATTTTTGCCT. Outer Right Sequence: CGACCCGAAGAATTGACATT. Inner Left Sequence: GGAAAAACGCGACTGTCAAT. Inner Right Sequence: CACGAAAATTATCGGGATGC. Inner Primer PCR Length: 1138 bp. Deletion Size: 455 bp. Deletion left flank: ACGCGACTGTCAATTTGGACGATGATGGAA. Deletion right flank: AGTACTATGACTTCGAGTTCTGCTATTCCG. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2035 |
asp-4(ok2693) X. |
C. elegans |
R12H7.2. Homozygous. Outer Left Sequence: ATCTGTTGCTTAGTGGCGCT. Outer Right Sequence: GTGAACTGATGCTGACCGAA. Inner Left Sequence: CCATGGATTCCTCACTTTCG. Inner Right Sequence: TGCTTCATCACCGTTACGAC. Inner Primer PCR Length: 1185 bp. Deletion Size: 613 bp. Deletion left flank: AGACAGAACGGAATGGTCGTGGAGCTGGAT. Deletion right flank: GAGAAAAGATTCGATGGGACCTTCTTCTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2036 |
Y42A5A.4(ok2694) V. |
C. elegans |
Y42A5A.4. Homozygous. Outer Left Sequence: CTGCGCTCATTTTCCTTTTC. Outer Right Sequence: CGATCTCCGGCATATTGATT. Inner Left Sequence: GAACCGGAAACTTCATCTCG. Inner Right Sequence: TTCCCATGATTTCCTCCTTG. Inner Primer PCR Length: 1092 bp. Deletion Size: 647 bp. Deletion left flank: CATACTAGTTCATACCAGTCAAATTGAAAT. Deletion right flank: GGAAATTCGAACAATTTGGTTTCAAAAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2037 |
dkf-1(ok2695) I. |
C. elegans |
W09C5.5. Homozygous. Outer Left Sequence: TCCTCTAGCAAAACCTTCCG. Outer Right Sequence: GTGGTACACGGGAAATGGTC. Inner Left Sequence: AAAATGTTTTAAAATACAAAAGAGA. Inner Right Sequence: AGTTTCCAACCGCGCTCTAT. Inner Primer PCR Length: 1154 bp. Deletion Size: 876 bp. Deletion left flank: TTTTTTCAATTTTTTTTTTTTGTTTTTTTC. Deletion right flank: GAGGTACATATTCCTGGTATCCAAATTCCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2038 |
W09C5.5(ok2696) I. |
C. elegans |
W09C5.5 Homozygous. Outer Left Sequence: tcctctagcaaaaccttccg. Outer Right Sequence: gtggtacacgggaaatggtc. Inner Left Sequence: aaaatgttttaaaatacaaaagagagg. Inner Right Sequence: agtttccaaccgcgctctat. Inner Primer PCR Length: 1153. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2039 |
set-13(ok2697) II. |
C. elegans |
K12H6.11. Homozygous. Outer Left Sequence: CTCTAGGTCTTTTGCGCAGG. Outer Right Sequence: CAGTGAGATGTCGGCTGCTA. Inner Left Sequence: GGACTATAACTCGAGAACCGC. Inner Right Sequence: CGAAAACGGTTACTTTTCGAG. Inner Primer PCR Length: 1249 bp. Deletion Size: 759 bp. Deletion left flank: ACTCAGAATTTTATTTTAAACATTTTGTTA. Deletion right flank: TTGAATTTATTTTTTCAGAGTTTTCCAAGG. Insertion Sequence: AATTGTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2040 |
T19F4.1(ok2698) V. |
C. elegans |
T19F4.1. Homozygous. Outer Left Sequence: CGGATTTCCATACATCACCC. Outer Right Sequence: CTGTCTTGTGAGCATCTGCC. Inner Left Sequence: CCACCTTTTCATCCCACATT. Inner Right Sequence: TTGCAACTATCACATGCCCA. Inner Primer PCR Length: 1155 bp. Deletion Size: 579 bp. Deletion left flank: CGGTTGTAATCGGTTCACATTTTCGGAGCG. Deletion right flank: ATCACTTTCAACATATATGGCATATATTCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2041 |
try-7(ok2699) I. |
C. elegans |
ZC581.6. Homozygous. Outer Left Sequence: ATCACATCACAAACGCCAGA. Outer Right Sequence: TGTTCTGACTCCGCCTCTTT. Inner Left Sequence: ATGATGCAGGCAGCAATACA. Inner Right Sequence: TGCCATCATGTGGAATTTCT. Inner Primer PCR Length: 1257 bp. Deletion Size: 452 bp. Deletion left flank: CAACTTTAACTGTGTTTTTCTAATCAATAA. Deletion right flank: GAAGAGTACAGTTCCATTGTTTCGTTACCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2042 |
grl-5(ok2700) V. |
C. elegans |
Y47D7A.5. Homozygous. Outer Left Sequence: TTTTTCCCTCTTTATCCCGC. Outer Right Sequence: TGTAAATGTTGTTCCACCGC. Inner Left Sequence: CCAGCCCAACCTAAGCCTAA. Inner Right Sequence: AAACTTTCTGCAAAATGCTCTACA. Inner Primer PCR Length: 1187 bp. Deletion Size: 365 bp. Deletion left flank: AGAAATTATTAGTTCAAAAGTACACCAGTC. Deletion right flank: AACTCCAGTGTCAATATCCATAACATCCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2043 |
ZK1307.1(ok2701) II. |
C. elegans |
ZK1307.1. Homozygous. Outer Left Sequence: TCACCTCCTTATTGGTTGCC. Outer Right Sequence: ATTTGCCGGTGTCTTTTGAG. Inner Left Sequence: TGCAGGTGGGTAGTAGAGGG. Inner Right Sequence: AGATTTACAAGGGTTCGGGG. Inner Primer PCR Length: 1193 bp. Deletion Size: 626 bp. Deletion left flank: ATCTGGAAGACCCTCTGTTTGCTCCATTGT. Deletion right flank: AACAATGTACACCCGTGGTCATTTTATTAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2044 |
C30A5.3(ok2702) III. |
C. elegans |
C30A5.3 Homozygous. Outer Left Sequence: aacgtcttggtgtcgagctt. Outer Right Sequence: ggtgatccgttcgtagagga. Inner Left Sequence: ggtcgcatttgttccagaat. Inner Right Sequence: cagcccatttttgcagtttt. Inner Primer PCR Length: 3126. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2045 |
spp-1&umps-1(ok2703) III. |
C. elegans |
T07C4.4 & T07C4.1 Homozygous. Outer Left Sequence: agaaccgaggagcttcaaca. Outer Right Sequence: acgagaagcgacgatagcat. Inner Left Sequence: gatgctgcgttgtccagtag. Inner Right Sequence: tgaaaaatccggagagccta. Inner Primer PCR Length: 1229. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2046 |
cyp-35A3(ok2709) V. |
C. elegans |
K09D9.2. Homozygous. Outer Left Sequence: AAACGGCGGTAAATATGCAG. Outer Right Sequence: GTTTTCCATGTGGCTCGAAT. Inner Left Sequence: AGACTTTCCGGAATATGGGG. Inner Right Sequence: TTTGCCAAAGATTCTCCCAG. Inner Primer PCR Length: 1107 bp. Deletion Size: 345 bp. Deletion left flank: ATTACTAAGTTCATATCCATTCAGATGCTC. Deletion right flank: AAGAATAGAAGACATAAAATCTGGAAAATA. Insertion Sequence: TGACATTGATAAATCAGCAAAGAAAAATCAGCATTGATAAATCAGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2047 |
prmt-1(ok2710) V. |
C. elegans |
Y113G7B.17. Homozygous. Outer Left Sequence: AACTACGAGTTTTGGGGGCT. Outer Right Sequence: TTTCGTGTGTGTTGGGTCTC. Inner Left Sequence: TTTCAGCCCAAAAATCGAAG. Inner Right Sequence: GGCCCTAAAAGTGGATTTCA. Inner Primer PCR Length: 1126 bp. Deletion Size: 532 bp. Deletion left flank: CGTAGAGACGAGCCTTGTCCGGGAACAACA. Deletion right flank: CTTCCCGTTTTCGGTACTCATTGTCCCGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2048 |
Y48G1C.10(ok2711) I. |
C. elegans |
Y48G1C.10. Homozygous. Outer Left Sequence: TCGCTACGCGATACTTTGTG. Outer Right Sequence: AACCCGGTGATTTAATGCAG. Inner Left Sequence: TTGTGCATTACGCATTTTCAG. Inner Right Sequence: TAAAGTTCTGGCGGAGGAAA. Inner Primer PCR Length: 1187 bp. Deletion Size: 575 bp. Deletion left flank: GAGAATCGGATAAAAATAATTTATTTAAGT. Deletion right flank: CCGAATAACGAGAAGCCGCATGTTATAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2049 |
grl-12(ok2712) V. |
C. elegans |
F28A12.2. Homozygous. Outer Left Sequence: CATGCACTTTTTCCCTTGTG. Outer Right Sequence: AATCCAGTTCATTCGTTCCG. Inner Left Sequence: TCTTCTCATCAAGATTCCAAAAGTT. Inner Right Sequence: TACCTTTGTCCGCAGGTCTC. Inner Primer PCR Length: 1291 bp. Deletion Size: 998 bp. Deletion left flank: ATTCCTTGAATATCTTAATATTTCCATTTA. Deletion right flank: TGCGGAAGCTGGAGCAGAAAAGAGAAGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2050 |
W05G11.4(ok2713) III. |
C. elegans |
W05G11.4. Homozygous. Outer Left Sequence: AAGTTGGCTTCCTCTCACCA. Outer Right Sequence: TGAGTAAAAATTTTCGGCGG. Inner Left Sequence: TTATATTCTGCGCAATCATCG. Inner Right Sequence: TGGAAAATATTTGGCTGGAAA. Inner Primer PCR Length: 3073 bp. Deletion Size: 1767 bp. Deletion left flank: CTCGTAAGAGGTGACATTGGAACACTTTCA. Deletion right flank: AGAAATCATCAACAATTATTACTTCCCATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2051 |
inx-10(ok2714) V. |
C. elegans |
T18H9.5. Homozygous. Outer Left Sequence: CTTGGTCTCATGTGTGCGTT. Outer Right Sequence: GGCTGGACATTCTGGTGAGT. Inner Left Sequence: GCTTCTCCATTAAATCTTGTGTTG. Inner Right Sequence: AAATCCAGCGATGCAACAAT. Inner Primer PCR Length: 1112 bp. Deletion Size: 689 bp. Deletion left flank: TGAAGCGTCATCATTCGTATCACAAAAACT. Deletion right flank: TAACTTGACAATCTCATTGATTTTTATTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2052 |
ttbk-2(ok2715) IV. |
C. elegans |
F36H12.8. Homozygous. Outer Left Sequence: CAATGCAGGTGCTCAAAATG. Outer Right Sequence: GAATGACCTCGTTCCCTTGA. Inner Left Sequence: AAGTGTTGGTGCTCGGAGAG. Inner Right Sequence: CCAAAACCACATACTTCGGC. Inner Primer PCR Length: 1207 bp. Deletion Size: 525 bp. Deletion left flank: AAGCTCTTGAGGATCTCCACAACATTGGAT. Deletion right flank: TGCTATAGAGTTAGTTGAACTTATAGTAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2053 |
ges-1(ok2716) V. |
C. elegans |
R12A1.4 Homozygous. Outer Left Sequence: ggagcacatttgcctcattt. Outer Right Sequence: caaaacattgtaggggtcgg. Inner Left Sequence: ttttcaggttttgagctattttca. Inner Right Sequence: tgccacaaacgaaattatgg. Inner Primer PCR Length: 1139. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2054 |
fbxb-44(ok2717) II. |
C. elegans |
K05F6.5. Homozygous. Outer Left Sequence: TGGCTAGCCCTACCTTTCCT. Outer Right Sequence: GCGCCGATATGTGTGTATGT. Inner Left Sequence: TCAACATGGGAGTTATGGAGC. Inner Right Sequence: GCGTGAAACGAGTAGCTTGG. Inner Primer PCR Length: 1230 bp. Deletion Size: 408 bp. Deletion left flank: TGAAAAGAATGGAGCTGCTTACAATCCAAA. Deletion right flank: GCTTCCAAAAATTACCTGATCGCACTACGT. Insertion Sequence: CATTGTTTTGGAAGGAATTCATCACGAGTTTGCACCAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2055 |
ugt-1(ok2718) V. |
C. elegans |
AC3.7. Homozygous. Outer Left Sequence: AGCCATGAGGACAAAGTTCG. Outer Right Sequence: TGTTGAAAATGCTTTGCCAG. Inner Left Sequence: TTGCTCTTCCATGTCTCGAA. Inner Right Sequence: TCGTCTAGATTCCGCCATTT. Inner Primer PCR Length: 1255 bp. Deletion Size: 787 bp. Deletion left flank: TTGCATTTCCAACACCATCACTTCCAAAAC. Deletion right flank: TTTGTTCAGTACTACATGTTAGATGCTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2056 |
C45B2.1(ok2719) X. |
C. elegans |
C45B2.1. Homozygous. Outer Left Sequence: CTCGGCCACGATTTATCTTC. Outer Right Sequence: ATCGGAGTCCAGTCAGCATT. Inner Left Sequence: AAAACTTGCCGAAAACAATCT. Inner Right Sequence: TTTACACCGTCAGGCTTCAA. Inner Primer PCR Length: 1338 bp. Deletion Size: 495 bp. Deletion left flank: GCGTTCTGATTTGTCAGAAAACTGTTACAA. Deletion right flank: GTACGGACGATACGGATTCCCAGGAGGAAA. Insertion Sequence: ACCGATTCCAGCAACCATCTGCAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2057 |
grl-14(ok2720) V. |
C. elegans |
T03D8.4. Homozygous. Outer Left Sequence: TCAATTAGCCACTGCACCAA. Outer Right Sequence: TGGCAAACATTCGTGGTAAA. Inner Left Sequence: CGAAGTGAAGGGAGGATCAC. Inner Right Sequence: GCCTTTTATTGCCTATCCCC. Inner Primer PCR Length: 1308 bp. Deletion Size: 405 bp. Deletion left flank: CCAGCCACAAATAATCTATCAACAAACGAC. Deletion right flank: AAAAAATTAGTTAAATTGAGCAAAAATTAA. Insertion Sequence: TTCGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2058 |
grl-2(ok2721) V. |
C. elegans |
T16G1.8. Homozygous. Outer Left Sequence: GGCTCCTCCACCTCTTATCC. Outer Right Sequence: ATTTTCTATCGCCTGGCCTT. Inner Left Sequence: GCTCCAGTATCTGCTCCATCA. Inner Right Sequence: CTTTTTCACAACCGGGAATC. Inner Primer PCR Length: 1196 bp. Deletion Size: 397 bp. Deletion left flank: GGGCCATTTCCACCGGCACCTCTTTATGTG. Deletion right flank: TTAATTCTAGAAACAATTGGAAAAATATGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2059 |
ins-28(ok2722) I. |
C. elegans |
ZC334.9. Homozygous. Outer Left Sequence: AATTGGAGAAACTTGGCAGG. Outer Right Sequence: CAAAAGCGCCAGATAAAAGG. Inner Left Sequence: GGGTTCATTCCCTGGAAAA. Inner Right Sequence: TTTCACCCCAAATGTTCAGA. Inner Primer PCR Length: 1129 bp. Deletion Size: 584 bp. Deletion left flank: ACCTTTGTACCTACCGTCCGCCTAGGTGCC. Deletion right flank: AAGAGCACAAAGAATGAGCGCATCATATTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2060 |
W10C8.5(ok2723) I. |
C. elegans |
W10C8.5. Homozygous. Outer Left Sequence: ACATGATGGCTCAAGTGGGT. Outer Right Sequence: GCCGTGTTGAAACTCTGTCA. Inner Left Sequence: CGAGCCTGAGAAGTTGGAAA. Inner Right Sequence: AGAAAATATTCCGGGAACGC. Inner Primer PCR Length: 1180 bp. Deletion Size: 927 bp. Deletion left flank: TCATAGACTCCTCCAACAGATTCCGAGTGT. Deletion right flank: TTGGCTCCTTCTGGACCATTGAGCTTGGCG. Insertion Sequence: CCGAGTGATTCCGATTCCGATTCCGATTCCGTGATTCGTGATTCCGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2061 |
ora-1(ok2724) IV. |
C. elegans |
F57H12.3. Homozygous. Outer Left Sequence: CGCTGAGATCAGCATCAAAA. Outer Right Sequence: CAGAATGTTTTTCGCCCAAT. Inner Left Sequence: CGGAGAAAGGGGGTATGTTT. Inner Right Sequence: GGGAAATCGGGAATGAATAAA. Inner Primer PCR Length: 1158 bp. Deletion Size: 464 bp. Deletion left flank: TCAGCTGCTCTTCTTCTTTTGACTATTGTA. Deletion right flank: GAAATCATGGAATCTCTTCCAAAGGATGTT. Insertion Sequence: AAAAAAAAAAAAGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2063 |
gst-5(ok2726) II. |
C. elegans |
R03D7.6. Homozygous. Outer Left Sequence: AATGCATCACAAAAGGGAGC. Outer Right Sequence: AATCTTCTGCCACCATCGAC. Inner Left Sequence: CGGAAGTGGTGGCAGATATT. Inner Right Sequence: TGCCGTTTGGAGAGGTTAGT. Inner Primer PCR Length: 3286 bp. Deletion Size: 1265 bp. Deletion left flank: CACATAAATTGTGAAAAATCAATGAGACCA. Deletion right flank: AGAGGCTCAAGTGAACTCTCTTGCCGATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2064 |
cpg-2(ok2727) III. |
C. elegans |
B0280.5. Homozygous. Outer Left Sequence: ATTCCAATTGAACCAACCCA. Outer Right Sequence: ACGGAAGGAAACTAAGGGGA. Inner Left Sequence: GGTACCCACCCCTTTTCAA. Inner Right Sequence: GTCATCTCTCTCGTCGGCTT. Inner Primer PCR Length: 3031 bp. Deletion Size: 1791 bp. Deletion left flank: ACGATGGCACGGCCGTTAGTGCAAGCAGTG. Deletion right flank: CGAGTTATTTTTTTGGCTTTTTTCTTTAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2065 |
C45B2.1(ok2728) X. |
C. elegans |
C45B2.1. Homozygous. Outer Left Sequence: CTCGGCCACGATTTATCTTC. Outer Right Sequence: ATCGGAGTCCAGTCAGCATT. Inner Left Sequence: AAAACTTGCCGAAAACAATCT. Inner Right Sequence: TTTACACCGTCAGGCTTCAA. Inner Primer PCR Length: 1338 bp. Deletion Size: 663 bp. Deletion left flank: GGAACATACTTCCTTTGCCTTGGAATAATA. Deletion right flank: AGCGTAATCTCAACGATTTGTACGATGACT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2066 |
F39E9.7(ok2729) II. |
C. elegans |
F39E9.7. Homozygous. Outer Left Sequence: AGAATGAGGGGAGAAGGGAA. Outer Right Sequence: TACAACCGAGGAACTGAGGG. Inner Left Sequence: ATTTAATTGAAAACCCCGCA. Inner Right Sequence: CAGGTTTGTAGCAAATTTGTTGTT. Inner Primer PCR Length: 1169 bp. Deletion Size: 485 bp. Deletion left flank: TACAGATTTAATTGAAAACCCCGCATGACC. Deletion right flank: TCATGTGGCCTCTCTGCTTTTCCCGTACCG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2067 |
flp-9(ok2730) IV. |
C. elegans |
C36H8.3. Homozygous. Outer Left Sequence: AAGGGGATGGGAGAGAAGAA. Outer Right Sequence: GTAGATTTGCGGCGTTGATT. Inner Left Sequence: TGATGGCTTTCTCTTGTCCA. Inner Right Sequence: GAGCCAGATTTGGATGCACT. Inner Primer PCR Length: 1134 bp. Deletion Size: 432 bp. Deletion left flank: AAAACATTTTCTGTCGCGTTGAGGCCGTTA. Deletion right flank: CTTTAATTTTCAAAAAATTATTTCAAGAAT. Insertion Sequence: TTTTCTGTCGCGTTGAGGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2068 |
C43G2.2(ok2731) IV. |
C. elegans |
C43G2.2. Homozygous. Outer Left Sequence: CACATCGCCAATCTTGACAC. Outer Right Sequence: GTTCAAAAGGCGCATGAAAT. Inner Left Sequence: CAAAACTTGGCGCAATAACA. Inner Right Sequence: CTTTTAACGGACCACACGCT. Inner Primer PCR Length: 1156 bp. Deletion Size: 547 bp. Deletion left flank: TGATAAAGTTGATCGGAGACTTGAATCATT. Deletion right flank: GGTTTATCACACTCCAAATCAAACTGAAAT. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2069 |
wrt-9(ok2732) X. |
C. elegans |
B0344.2. Homozygous. Outer Left Sequence: GCAAAAATTGGGCCATTAAA. Outer Right Sequence: TAATTTTGAAAACCGCCGAG. Inner Left Sequence: CTCCCCATTTGTTGAACACC. Inner Right Sequence: TGGTCCTGAATCTGTTGCTG. Inner Primer PCR Length: 1246 bp. Deletion Size: 979 bp. Deletion left flank: CCAACCTCTTCCAGCCCAACCGCCGAAAAT. Deletion right flank: GTCTATACGAGGTCGTTACTTACCAATCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2070 |
Y110A7A.6(ok2733) I. |
C. elegans |
Y110A7A.6. Homozygous. Outer Left Sequence: TGTTGCAGGAGAACGAGATG. Outer Right Sequence: CGCACACTTTTTGGCATTTA. Inner Left Sequence: CGTATTTCGTGCCGAAGAGT. Inner Right Sequence: TCGCGTCGAGACCTGTTAC. Inner Primer PCR Length: 1306 bp. Deletion Size: 840 bp. Deletion left flank: AAACGAGCAGGTTCGAGTTCCAAACGTCAT. Deletion right flank: AATATTCATCTTCTTCCAAGAAGTATTTAT. Insertion Sequence: TGCACTTGTCGGACTGCCGGCACGTGGCAAAACATACATCTCAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2071 |
ced-3(ok2734) IV. |
C. elegans |
C48D1.2. Homozygous. Outer Left Sequence: CAAAAGGACGCTCTGCCTAT. Outer Right Sequence: TGTCGTGTCGAGACCAGGTA. Inner Left Sequence: AGCAGATCGATTGTTGTTCAAG. Inner Right Sequence: TTGGTCCCAAAAACCAAAAA. Inner Primer PCR Length: 1118 bp. Deletion Size: 682 bp. Deletion left flank: GGCTTTCGCTCCAAAGAATATAAAATAATC. Deletion right flank: TTAAATATCAGTTTACATTAGGAACAAGGC. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2072 |
grd-6(ok2735) V. |
C. elegans |
T18H9.1. Homozygous. Outer Left Sequence: TAAATCATTTTTCAGGGGCG. Outer Right Sequence: CTTGTGAAGGCACAGTTGGA. Inner Left Sequence: CCACTGTTGCCCCGTATATC. Inner Right Sequence: TATGAACACGCAAGCTCACC. Inner Primer PCR Length: 1190 bp. Deletion Size: 825 bp. Deletion left flank: CAACTCCTTATATTGAGCGCCCGGTTCCAG. Deletion right flank: GAGGCAATAACACTTTTCCATTGCCATCTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2073 |
unc-53(ok2736) II. |
C. elegans |
ok2736. Homozygous. Outer Left Sequence: TTCCACAATCGAATGAACCA. Outer Right Sequence: TCAATTTCCGGATCTCAAGG. Inner Left Sequence: TCACGGGATCCATCGACA. Inner Right Sequence: AGCAAGAGCTCAAAGAACGC. Inner Primer PCR Length: 1282 bp. Deletion Size: 301 bp. Deletion left flank: TGCGGCACCGTGCATGAACATTCGGATTGT. Deletion right flank: GAGTTGCAGCCAGAGGATCGTTTCGAAGAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2074 |
fbxa-121(ok2737) I. |
C. elegans |
Y18D10A.18. Homozygous. Outer Left Sequence: CTTGGAAGCCAGTTGGACAT. Outer Right Sequence: TGACATTTACCGATCTGCCA. Inner Left Sequence: GTGATCTCGAACTTCCAGGG. Inner Right Sequence: ATGGATGCCCTCTACGAATG. Inner Primer PCR Length: 1117 bp. Deletion Size: 765 bp. Deletion left flank: CAACAGTAACCAATTTGGCATAGCGATGAT. Deletion right flank: GTTATTACCTCTCCAGATAATCCAATTGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2075 |
phg-1(ok2741) II. |
C. elegans |
F27E5.4. Homozygous. Outer Left Sequence: GGTGATTCTCCCGTTGGTAA. Outer Right Sequence: AAACGGAAATGGCAGAGAGA. Inner Left Sequence: GACAGTTACGCTGTGCTTGG. Inner Right Sequence: CTCCCGGGGTATTCTGAAAT. Inner Primer PCR Length: 1222 bp. Deletion Size: 472 bp. Deletion left flank: GCTCAGAACATGCAACTTCCTTCCAGCCGA. Deletion right flank: CACTGATCGAGTTTTCTTTTTTACTTTTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2076 |
ora-1(ok2742) IV. |
C. elegans |
F57H12.3. Homozygous. Outer Left Sequence: CGCTGAGATCAGCATCAAAA. Outer Right Sequence: CAGAATGTTTTTCGCCCAAT. Inner Left Sequence: CGGAGAAAGGGGGTATGTTT. Inner Right Sequence: GGGAAATCGGGAATGAATAAA. Inner Primer PCR Length: 1158 bp. Deletion Size: 312 bp. Deletion left flank: ACTACAAACATTCCAGCGTCCACCACCACC. Deletion right flank: GAAGAAATTCCAAGAATTCAAAGAGAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2077 |
W09C5.7(ok2743) I. |
C. elegans |
W09C5.7. Homozygous. Outer Left Sequence: GACTCACAAAACGGGACGAT. Outer Right Sequence: AGTGTGAAGCCCCACTCAAT. Inner Left Sequence: CGAAATCGGCGTGTTAGAAT. Inner Right Sequence: TACTTTTTGAAAATTAAGCCCTCT. Inner Primer PCR Length: 1299 bp. Deletion Size: 480 bp. Deletion left flank: TTCACATGCCCAATTATGCAAGGATATGTG. Deletion right flank: ACGTCACGTTTTTCTCGTTTGATTTGCATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2078 |
M28.9(ok2744) II. |
C. elegans |
M28.9 Homozygous. Outer Left Sequence: gaaacccgaaccatctgaaa. Outer Right Sequence: agcactgcggaaggtagtgt. Inner Left Sequence: gcttcatagccctgatctcg. Inner Right Sequence: aaattccccaaaatcgaagg. Inner Primer PCR Length: 1142. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2079 |
B0303.7(ok2745) III. |
C. elegans |
B0303.7 Homozygous. Outer Left Sequence: agagcaccaggaagcttgaa. Outer Right Sequence: atatttggatgcaccaagcc. Inner Left Sequence: tctggagatcccacgagaac. Inner Right Sequence: cgcagagaaatgagctatttgaa. Inner Primer PCR Length: 3072. Deletion size: about 2300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2080 |
Y50E8A.9(ok2746) V. |
C. elegans |
Y50E8A.9 Homozygous. Outer Left Sequence: cgcaacagcaaaacgttaga. Outer Right Sequence: atgtgtttgtgcatgcctgt. Inner Left Sequence: tggacgaaaatcatggtgaa. Inner Right Sequence: ctaccttctaggcgacaccg. Inner Primer PCR Length: 1249. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2081 |
ZK637.13(ok2747) III. |
C. elegans |
ZK637.13 Homozygous. Outer Left Sequence: gaaaaactcgtcgaagccac. Outer Right Sequence: gaagtttcaggggttgagca. Inner Left Sequence: cgaattctaaaaaggcgacg. Inner Right Sequence: tttccatctttacccaaccc. Inner Primer PCR Length: 3001. Deletion size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2082 |
F53C3.4(ok2748) II. |
C. elegans |
F53C3.4 Homozygous. Outer Left Sequence: cctcgccattttcatcattt. Outer Right Sequence: atgatgcagttaaatgcggg. Inner Left Sequence: aaatggaacacgtaaatgatcg. Inner Right Sequence: tcactctcgaactaaaaatagatacca. Inner Primer PCR Length: 1169. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2083 |
T24H10.1(ok2749) II. |
C. elegans |
T24H10.1 Homozygous. Outer Left Sequence: cggattattgacgcgtttct. Outer Right Sequence: tggcaaaactaccacgtgaa. Inner Left Sequence: cgcgtccacatcttttctct. Inner Right Sequence: gcaaaacttccagcgatttc. Inner Primer PCR Length: 1157. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2084 |
clp-7(ok2750) IV. |
C. elegans |
Y77E11A.11 Homozygous. Outer Left Sequence: ttccgcattggaaaagattc. Outer Right Sequence: atgggatcactcttcggatg. Inner Left Sequence: aacaagaacgaggcgtcatc. Inner Right Sequence: ggaatggagccaagtgga. Inner Primer PCR Length: 1114. Deletion size: about 200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2085 |
nhr-74(ok2751) I. |
C. elegans |
C27C7.3 Homozygous. Outer Left Sequence: caactgatttgcccgaattt. Outer Right Sequence: gttggcgttgaggacacttt. Inner Left Sequence: aaaaatatgccgaacatccg. Inner Right Sequence: ttgcaacacgattcgaaataa. Inner Primer PCR Length: 1195. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2086 |
C29E4.10(ok2752) III. |
C. elegans |
C29E4.10 Homozygous. Outer Left Sequence: tcattccttcaatcatcccc. Outer Right Sequence: ttctcgccatacatccttcc. Inner Left Sequence: aattatcttgattttaccaagtattgc. Inner Right Sequence: gtgtgctctgaaacgctgaa. Inner Primer PCR Length: 1161. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2088 |
F11E6.8(ok2754) IV. |
C. elegans |
F11E6.8 Homozygous. Outer Left Sequence: gaatgcatctgagcagcaaa. Outer Right Sequence: gccaggcaagaacagaaaag. Inner Left Sequence: ttagtgaaaagacggcctgg. Inner Right Sequence: tgcggtcaaaacactgaaag. Inner Primer PCR Length: 1244. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2089 |
R166.5(ok2755) II. |
C. elegans |
R166.5 Homozygous. Outer Left Sequence: gtgctcggacatttgttgaa. Outer Right Sequence: aattccgcgcattagaagaa. Inner Left Sequence: aagtctcacaatctccgcgt. Inner Right Sequence: tcaggagacgtattgaaggtaattt. Inner Primer PCR Length: 1217. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2090 |
Y105C5A.23(ok2765) IV. |
C. elegans |
Y105C5A.23(ok2765) IV. Homozygous. Outer Left Sequence: ggcctgttcttggaaaatga. Outer Right Sequence: gtagcaaggaaactcgcagg. Inner Left Sequence: cagagctcctccaacgtgat. Inner Right Sequence: tttctgaatttttacctgtttttga. Inner Primer PCR Length: 1181. Deletion size: about 200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2091 |
F23A7.7(ok2766) X. |
C. elegans |
F23A7.7 Homozygous. Outer Left Sequence: ttgaggaaggaatgtttggc. Outer Right Sequence: gcgacgagaaaaaggaagtg. Inner Left Sequence: ttctctaccatctcgattccg. Inner Right Sequence: gtttgttagcataacccggc. Inner Primer PCR Length: 1103. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2092 |
T09A5.1(ok2767) II. |
C. elegans |
T09A5.1 Homozygous. Outer Left Sequence: gcaggagaatctaatgggca. Outer Right Sequence: aaaagtttgaccacaacccg. Inner Left Sequence: gactccaaagtacccgagca. Inner Right Sequence: cgcagcttactgcttttcaa. Inner Primer PCR Length: 1115. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2093 |
F52C6.3(ok2768) II. |
C. elegans |
F52C6.3 Homozygous. Outer Left Sequence: catgctgctctccatcaaaa. Outer Right Sequence: ttcacaatgaacacaatgcg. Inner Left Sequence: aaaaacatcacagtggaagcg. Inner Right Sequence: gtgcgcaacagcgtacttt. Inner Primer PCR Length: 1167. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2094 |
F25C8.3(ok2769) V. |
C. elegans |
F25C8.3 Homozygous. Outer Left Sequence: agtcctgcgatttcatccac. Outer Right Sequence: gccttgttttggatcattgg. Inner Left Sequence: tatgttcgggctcagtgtga. Inner Right Sequence: tggcagatttgaatgaagca. Inner Primer PCR Length: 3167. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2095 |
F56D6.2(ok2770) IV. |
C. elegans |
F56D6.2 Homozygous. Outer Left Sequence: gccttttgcggtaatttgaa. Outer Right Sequence: tagtggcatccatccaatga. Inner Left Sequence: attcatggaagaggctgacg. Inner Right Sequence: ttttaagttgaaatgtgtggagc. Inner Primer PCR Length: 1331. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2096 |
Y57G11C.43&Y57G11C.44(ok2771) IV. |
C. elegans |
Y57G11C.43, Y57G11C.44. Homozygous. Outer Left Sequence: CAAACTCTTCAACACGCCAA. Outer Right Sequence: CAGGAAATTGGAAATCGCAT. Inner Left Sequence: GGGAAACAAAAAGCGGAAAT. Inner Right Sequence: CGTCGTTTCTTCAACACGAA. Inner Primer PCR Length: 2809 bp. Deletion Size: 2090 bp. Deletion left flank: GGTTCATTACCGTGAATTACTTTTTTTAGA. Deletion right flank: TCTTTTATTCTAACAAACACTGGCTTCAAG. Insertion Sequence: AGAAAAATTTACAAAACACTGAGCTTGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2097 |
Y92H12BR.6(ok2772) I. |
C. elegans |
Y92H12BR.6 Homozygous. Outer Left Sequence: caccatgtgtatcccccttc. Outer Right Sequence: gcaccacgtgatcagagaaa. Inner Left Sequence: ttggattttctgtacgacgtg. Inner Right Sequence: aagaaaaacccccgaaaatc. Inner Primer PCR Length: 1197. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2098 |
ins-25(ok2773) I. |
C. elegans |
ZC334.8 Homozygous. Outer Left Sequence: cgttgggaaaagtcttgagg. Outer Right Sequence: accaaaacctgaaatggcac. Inner Left Sequence: ttggacgaaaatcacgaaaa. Inner Right Sequence: tttttcaacaaactgtgggg. Inner Primer PCR Length: 1200. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2099 |
C44B9.5(ok2774) III. |
C. elegans |
C44B9.5 Homozygous. Outer Left Sequence: tgtatttccagcgctaccgt. Outer Right Sequence: cactgctgccagaacaccta. Inner Left Sequence: cccggaaaccatacgtaaaa. Inner Right Sequence: attcttgggacttggtgtcg. Inner Primer PCR Length: 1116. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2100 |
wht-2(ok2775) IV. |
C. elegans |
C10C6.5. Homozygous. Outer Left Sequence: GGCGATGGGAAAATAGGATT. Outer Right Sequence: TACAAACCGGTAAAGACGGC. Inner Left Sequence: TTTTTAATTTCAGGTGGCGAA. Inner Right Sequence: CGATGAGGCATGCGTATAGA. Inner Primer PCR Length: 1301 bp. Deletion Size: 800 bp. Deletion left flank: GGTTTCGCATGCCCTCGTAACTTCAATCCT. Deletion right flank: ACAAAACACTTTCGAATCCATGGATTTGCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2101 |
R09B5.6(ok2776) V. |
C. elegans |
R09B5.6 Homozygous. Outer Left Sequence: aagctcaatggctttttcca. Outer Right Sequence: cgtttttctgccaagctttc. Inner Left Sequence: cagaaattttcccccacaaa. Inner Right Sequence: cagcgaccaatttgtccataa. Inner Primer PCR Length: 1097. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2102 |
C10H11.10(ok2777) I. |
C. elegans |
C10H11.10 Homozygous. Outer Left Sequence: gcggtgaaaccgtcattact. Outer Right Sequence: actccacatccatcgaaagg. Inner Left Sequence: cttcggcttatccaaatcca. Inner Right Sequence: caaactccctcctcgtgtgt. Inner Primer PCR Length: 1105. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2103 |
grd-3(ok2778) IV. |
C. elegans |
W05E7.1 Homozygous. Outer Left Sequence: gagaagtttgccgagtttgc. Outer Right Sequence: gagatagctcggctccagaa. Inner Left Sequence: acgcaacgtttgagtgacaa. Inner Right Sequence: aggctttgggatttagacgg. Inner Primer PCR Length: 1302. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2104 |
grl-26(ok2779) IV. |
C. elegans |
K02D7.6 Homozygous. Outer Left Sequence: ccaccattgctggaaaaatc. Outer Right Sequence: ccaaacaaaagttcccgtgt. Inner Left Sequence: tcgatttattaccgttttgcg. Inner Right Sequence: gtgagtatccgcgtctgtca. Inner Primer PCR Length: 1212. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2105 |
T07D10.2(ok2780) I. |
C. elegans |
T07D10.2 Homozygous. Outer Left Sequence: atgggagccttctttcctgt. Outer Right Sequence: gtcaaggcacccaaatcagt. Inner Left Sequence: ctcaccccaacaccaatttc. Inner Right Sequence: tcgatgcaccatgaaggtaa. Inner Primer PCR Length: 1161. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2106 |
F23B2.5(ok2781) IV. |
C. elegans |
F23B2.5 Homozygous. Outer Left Sequence: atgtgtcccgttttggatgt. Outer Right Sequence: agcgtccgaatctgaagaaa. Inner Left Sequence: cggtacttgcaaagaaggct. Inner Right Sequence: ctgcagatcgttttccgaat. Inner Primer PCR Length: 1193. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2107 |
Y51F10.4(ok2782) I. |
C. elegans |
Y51F10.4 Homozygous. Outer Left Sequence: taccggaaattttcaatccg. Outer Right Sequence: ggctaagatcgtgagaccca. Inner Left Sequence: aatttgccaatttgccgtaa. Inner Right Sequence: aatggggaactttgacacca. Inner Primer PCR Length: 1198. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2108 |
inx-11(ok2783) V. |
C. elegans |
W04D2.3 Homozygous. Outer Left Sequence: ttgtttgttccgtttggaca. Outer Right Sequence: tatgaaaaccgcaggaatgg. Inner Left Sequence: tttcgacccgaaacatttta. Inner Right Sequence: ggttttcacgcgttttagatg. Inner Primer PCR Length: 1205. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2109 |
R166.5(ok2784) II. |
C. elegans |
R166.5 Homozygous. Outer Left Sequence: gtgctcggacatttgttgaa. Outer Right Sequence: aattccgcgcattagaagaa. Inner Left Sequence: aagtctcacaatctccgcgt. Inner Right Sequence: tcaggagacgtattgaaggtaattt. Inner Primer PCR Length: 1217. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2110 |
C39B10.1(ok2789) X. |
C. elegans |
C39B10.1 Homozygous. Outer Left Sequence: tgtggacaaccaggagcata. Outer Right Sequence: gtgtttccgggattcacaac. Inner Left Sequence: tgaagcatcagtgaggtagaatg. Inner Right Sequence: tcttgtcctgatccttctaggc. Inner Primer PCR Length: 1189. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2111 |
F46F2.3(ok2790) X. |
C. elegans |
F46F2.3 Homozygous. Outer Left Sequence: ggtgaaggttcaggcttctg. Outer Right Sequence: gtgatcatctccaagtggca. Inner Left Sequence: ccgtatgttagtgcgagtagaa. Inner Right Sequence: ggagctgaacaaggtctcca. Inner Primer PCR Length: 1189. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2112 |
grl-21(ok2791) IV. |
C. elegans |
ZC168.5 Homozygous. Outer Left Sequence: ccacgtcaatctggtcacac. Outer Right Sequence: aagctcatcgctgcttgaat. Inner Left Sequence: ttcgttgagcgaccatacac. Inner Right Sequence: cgctggtgtttgattgtgtt. Inner Primer PCR Length: 1287. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2113 |
F57G12.2(ok2792) X. |
C. elegans |
F57G12.2 Homozygous. Outer Left Sequence: gctgccattttcagatggtt. Outer Right Sequence: ccccaattgttttcgatcat. Inner Left Sequence: cacatgattcaaggcactcg. Inner Right Sequence: cacatgattcaaggcactcg. Inner Primer PCR Length: 1274. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2114 |
K12G11.3(ok2799) V. |
C. elegans |
K12G11.3 Homozygous. Outer Left Sequence: aatggaccacttgaagtccg. Outer Right Sequence: atcaacgaatgaaagacggg. Inner Left Sequence: cagtcccatctccagctgat. Inner Right Sequence: cgatttttcaatgcgatgag. Inner Primer PCR Length: 1362. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2115 |
aqp-8(ok2800) X. |
C. elegans |
K02G10.7. Homozygous. Outer Left Sequence: AAGCAGAAAAGGAGCGTGAA. Outer Right Sequence: TCAGGGCCTACCGTAACATC. Inner Left Sequence: ATGTTTTAGAGGGCGGTTGC. Inner Right Sequence: GCCCATTCTGAAGTTTCGAC. Inner Primer PCR Length: 1177 bp. Deletion Size: 436 bp. Deletion left flank: TAACTATGTATAAACATGGATCAGAAGTTG. Deletion right flank: ATTCCCCAGGCAATATGGCAAGACGTTGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2116 |
M01H9.3(ok2801) IV. |
C. elegans |
M01H9.3 Homozygous. Outer Left Sequence: ttgtttgtttgacggaacca. Outer Right Sequence: tgggtcccaattcaaatcat. Inner Left Sequence: tgggaaaagcgtgagctact. Inner Right Sequence: gctgaatacttctcaccgcc. Inner Primer PCR Length: 1207. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2117 |
D1086.6(ok2802) V. |
C. elegans |
D1086.6 Homozygous. Outer Left Sequence: cgatgatcaaaaacgctgtg. Outer Right Sequence: gagaagcagcacgtgttcag. Inner Left Sequence: cgacaagacaaaagaagttatttaca. Inner Right Sequence: gactgatcacagtgcggaaa. Inner Primer PCR Length: 1203. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2119 |
acr-23(ok2804) V. |
C. elegans |
F59B1.9 Homozygous. Outer Left Sequence: acatgtagacgtcgatggca. Outer Right Sequence: cagaatgagccgcaacaata. Inner Left Sequence: gtttccaaacgcacacattg. Inner Right Sequence: cgtgggcggtagaggtaaat. Inner Primer PCR Length: 1100. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2120 |
Y6B3B.5(ok2805) I. |
C. elegans |
Y6B3B.5 Homozygous. Outer Left Sequence: aaattccttgatttggtgcg. Outer Right Sequence: cattccacacgacgaaaatg. Inner Left Sequence: tccgcgtccaatacaataca. Inner Right Sequence: aatgcaggtcaaactccacc. Inner Primer PCR Length: 1131. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2121 |
F35C5.7(ok2806) II. |
C. elegans |
F35C5.7 Homozygous. Outer Left Sequence: ccggaaatttttattccggt. Outer Right Sequence: aatttttgtttgtgccccac. Inner Left Sequence: gcaggaaattttcattccga. Inner Right Sequence: ggctccaaaacagcaaagtc. Inner Primer PCR Length: 1104. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2122 |
C56E6.3(ok2807) II. |
C. elegans |
C56E6.3 Homozygous. Outer Left Sequence: ttttgtcgcagttcaacgag. Outer Right Sequence: gcgacaatatcggaagaagc. Inner Left Sequence: gccaaaatctctgtttttcagg. Inner Right Sequence: caggcttggaggagattctg. Inner Primer PCR Length: 1177. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2123 |
Y39A3CL.5(ok2808) III. |
C. elegans |
Y39A3CL.5 Homozygous. Outer Left Sequence: cttttggtttttgcggagtc. Outer Right Sequence: caaggcgggacttgattaaa. Inner Left Sequence: cagggatcactggagccac. Inner Right Sequence: tcgaaaaatttcgggaaaaa. Inner Primer PCR Length: 1206. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2124 |
grl-8(ok2809) V. |
C. elegans |
ZC487.5 Homozygous. Outer Left Sequence: caagaagccaactcctcgtc. Outer Right Sequence: acttcgcggttttcttctga. Inner Left Sequence: accccatccttaaaaccgac. Inner Right Sequence: cctcagccatcattccactt. Inner Primer PCR Length: 1292. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2125 |
wrt-2(ok2810) X. |
C. elegans |
F52E4.6 Homozygous. Outer Left Sequence: ccgaaaaatttggcaacact. Outer Right Sequence: atcaaaaacatgcgaggagg. Inner Left Sequence: gttagaatggcacgctggac. Inner Right Sequence: tggaggagaggttttggatg. Inner Primer PCR Length: 1100. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2126 |
F23B2.5(ok2811) IV. |
C. elegans |
F23B2.5 Homozygous. Outer Left Sequence: atgtgtcccgttttggatgt. Outer Right Sequence: agcgtccgaatctgaagaaa. Inner Left Sequence: cggtacttgcaaagaaggct. Inner Right Sequence: cggtacttgcaaagaaggct. Inner Primer PCR Length: 1193. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2127 |
plk-3(ok2812) IV. |
C. elegans |
F55G1.8 Homozygous. Outer Left Sequence: gtaggacggcatggagagtc. Outer Right Sequence: tcacgcatttgaggtggata. Inner Left Sequence: catagacgacatgctcctgg. Inner Right Sequence: ttcttctcttcgggtctcca. Inner Primer PCR Length: 1307. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2128 |
F59B8.2(ok2832) IV. |
C. elegans |
F59B8.2 Homozygous. Outer Left Sequence: cttgtcccttttggtgcatt. Outer Right Sequence: cgtccaacagaaccgctaat. Inner Left Sequence: gagtgacagttccgtgagca. Inner Right Sequence: atttttctccgaaaatccgc. Inner Primer PCR Length: 1200. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2130 |
C03A3.3(ok2834) X. |
C. elegans |
C03A3.3 Homozygous. Outer Left Sequence: aaagtacccccagctcacct. Outer Right Sequence: tgggagaaattctttggcac. Inner Left Sequence: acggtaaaagaggtcaccga. Inner Right Sequence: acacaccagagcacgatgag. Inner Primer PCR Length: 1138. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2131 |
Y7A9A.1(ok2835) IV. |
C. elegans |
Y7A9A.1 Homozygous. Outer Left Sequence: gctttcaaaagattggctgc. Outer Right Sequence: tttcgatcctccagttccac. Inner Left Sequence: gtatacaggatccatcgccg. Inner Right Sequence: ccattttcacatttccactgc. Inner Primer PCR Length: 1171. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2133 |
C39B10.1(ok2841) X. |
C. elegans |
C39B10.1 Homozygous. Outer Left Sequence: tgtggacaaccaggagcata. Outer Right Sequence: gtgtttccgggattcacaac. Inner Left Sequence: tgaagcatcagtgaggtagaatg. Inner Right Sequence: tcttgtcctgatccttctaggc. Inner Primer PCR Length: 1189. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2134 |
ZK287.2(ok2842) V. |
C. elegans |
ZK287.2 Homozygous. Outer Left Sequence: tgttgaaaggcatgcgacta. Outer Right Sequence: tcatttttccaggcgtcttc. Inner Left Sequence: tgacgtttagcgatttttagca. Inner Right Sequence: ttcaatgatggtaggagccg. Inner Primer PCR Length: 1157. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2135 |
F33D4.4(ok2843) IV. |
C. elegans |
F33D4.4. Homozygous. Outer Left Sequence: CGACGTGATATCCGACATTG. Outer Right Sequence: CTTGGGCTTACACGGAAGAG. Inner Left Sequence: ACAAAGTGACCAGCACATGG. Inner Right Sequence: CATGCTTCAAGACGCAAAGA. Inner Primer PCR Length: 1174 bp. Deletion Size: 655 bp. Deletion left flank: CCTCCGAACAAAAAGAAAAATGATTTTGCT. Deletion right flank: TTTTATTTCTCATCAACATAATCAAAATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2136 |
ZC123.4(ok2844) I. |
C. elegans |
ZC123.4. Homozygous. Outer Left Sequence: CGACTCCCCTGCAAAGTTAG. Outer Right Sequence: AAGCTGGGGGAAGGATCTTA. Inner Left Sequence: CCACATATCCAGGGAAGTTGA. Inner Right Sequence: GCAACGGTGTATAAGTGCGA. Inner Primer PCR Length: 1173 bp. Deletion Size: 306 bp. Deletion left flank: TCAAGAGTTATGGCCGCAACGGCGCCTCCG. Deletion right flank: AACAACTCCCTTTCGCAATACGTTGAGCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2137 |
grl-18(ok2845) V. |
C. elegans |
T05C3.4. Homozygous. Outer Left Sequence: AAAAATCCCCGTAGCCATTT. Outer Right Sequence: TATCACAACAACTGAGGCCG. Inner Left Sequence: CGCTGAGTTCAAGCAGAAAA. Inner Right Sequence: ACCAATCGAGACTACGGCAA. Inner Primer PCR Length: 1203 bp. Deletion Size: 586 bp. Deletion left flank: AGGACTGCTTGTTGAACTTTCTAAGATATT. Deletion right flank: TGAGTTGACGTCTCATAATTTCTTTTTGCC. Insertion Sequence: GAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2138 |
nep-2(ok2846) II. |
C. elegans |
T05A8.4. Homozygous. Outer Left Sequence: TTTACCTGTTTTGCCGGTTC. Outer Right Sequence: TTCAAACTTCCCAGTCCACC. Inner Left Sequence: CTTTTCACCCTTCCTACCCC. Inner Right Sequence: TCCTACTTCCAGATGGCACC. Inner Primer PCR Length: 1323 bp. Deletion Size: 362 bp. Deletion left flank: AGCAAACGCGCCCCACTGAACTTCTTTCAC. Deletion right flank: GAATTCGTAGAAATCATCGCAGGGGTCGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2139 |
F54D12.7(ok2852) II. |
C. elegans |
F54D12.7. Homozygous. Outer Left Sequence: TGGCTAAATCCAACTCCGAC. Outer Right Sequence: GGAAAAATGTGCAAGGGGTA. Inner Left Sequence: TGCCAGGTAATTTCCAGTTG. Inner Right Sequence: AAAACTGACGGAGAATTCGAT. Inner Primer PCR Length: 1210 bp. Deletion Size: 250 bp. Deletion left flank: ATTTGTGCTTCCCGATAAGTCCATCCAGTT. Deletion right flank: TTGTTACAGCCATCCGTGAAAGTGTATTCT. Insertion Sequence: TGTTACAGCCATCCGTGAAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2140 |
mec-9(ok2853) V. |
C. elegans |
C50H2.3. Homozygous. Outer Left Sequence: AACTCTCGGAGCACAAATGC. Outer Right Sequence: TTGGCACAACAACGACAAGT. Inner Left Sequence: GAATTGTAAGCAGGGACATCG. Inner Right Sequence: TTGGCGTCATCGTCAAAAT. Inner Primer PCR Length: 1113 bp. Deletion Size: 408 bp. Deletion left flank: TCCACCAATTCCACCACCGGTTTCTTTTAA. Deletion right flank: AGCACCGTTCAAACAGGGTTTTTCGGCGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2141 |
F53B6.2(ok2854) I. |
C. elegans |
F53B6.2. Homozygous. Outer Left Sequence: GCTGTTCACGTGCTTTTTCA. Outer Right Sequence: AATGAGCAGGGTTTTTGTGG. Inner Left Sequence: CATTTGGTGCGGTAAGCAAT. Inner Right Sequence: TTCCAGATCAAGAGCAACCA. Inner Primer PCR Length: 1290 bp. Deletion Size: 962 bp. Deletion left flank: TCTTTGCTCACTTGAACTCGTTGTCTATTC. Deletion right flank: ATCGCATTGAGACCATTGTACAGACTTTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2142 |
K09C4.1(ok2855) X. |
C. elegans |
K09C4.1. Homozygous. Outer Left Sequence: TTAGCCACTTCCTTCCAAGC. Outer Right Sequence: AAGCTGATTGAATGATGCCC. Inner Left Sequence: TTCTTGGAATACAAAGCCCG. Inner Right Sequence: CAACTGACCTGTCCAACTGC. Inner Primer PCR Length: 1253 bp. Deletion Size: 1070 bp. Deletion left flank: GTAAATTTCAATTTATGGAATTTCAACAAT. Deletion right flank: AAACTCAATAAGAGTGTTGTTTGTTACAGA. Insertion Sequence: GTTTGTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2143 |
W02D9.3(ok2857) I. |
C. elegans |
W02D9.3. Homozygous. Outer Left Sequence: CACAATTTTCTCCTCGCGTT. Outer Right Sequence: TGTAGGCCTGATGTGGATGA. Inner Left Sequence: AAGAAGGTCCGACTCCACAA. Inner Right Sequence: GGGCTCAAAAGTGGACAAAA. Inner Primer PCR Length: 1114 bp. Deletion Size: 476 bp. Deletion left flank: AAGCCTGCACGAGAAACGCGCCAACGTCCA. Deletion right flank: AAAGTACGTAAACACCGTACACTCTACGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2144 |
F26E4.3(ok2858) I. |
C. elegans |
F26E4.3. Homozygous. Outer Left Sequence: CCCAGGCTCCTGTAATTTGA. Outer Right Sequence: AGGTTTGAAAATTTGCAGCG. Inner Left Sequence: CCAAAGTTCGTAGAGCCTCG. Inner Right Sequence: CACCTCTAATTTTGAAGAGTTTACA. Inner Primer PCR Length: 1165 bp. Deletion Size: 313 bp. Deletion left flank: TTCGTAAAACAATTGACACGGGAAAACGTT. Deletion right flank: GAGTTGATTCTACCTTCCGATATGATGGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2145 |
tir-1(ok2859) III. |
C. elegans |
F13B10.1. Homozygous. Outer Left Sequence: CGGGAGATAGAAGGCATCTG. Outer Right Sequence: ACGGGGCTTAATTTCCTCAT. Inner Left Sequence: AAACCTTCGAAAATCGAGCA. Inner Right Sequence: CTGCCAGTCCTGTTGCTCTT. Inner Primer PCR Length: 1356 bp. Deletion Size: 354 bp. Deletion left flank: ATTTGTGAGCATTTGGTAGGTGTAAACAGA. Deletion right flank: GGAGGCCACTTCTTTTAATGCTTGGATTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2146 |
C50F4.14(ok2860) V. |
C. elegans |
C50F4.14. Homozygous. Outer Left Sequence: AAGCAGTGGCTACCAACCAT. Outer Right Sequence: CCCGCCTTAACTACCATTCA. Inner Left Sequence: AAATGCAAACTTCGAGCAGC. Inner Right Sequence: GAATCCAACCAAATGGGAGA. Inner Primer PCR Length: 1274 bp. Deletion Size: 722 bp. Deletion left flank: GCTTCACTTTGTCAGATTTTGCCTCGCTAG. Deletion right flank: AAAACGGTCGTTAAACTACGTCCAACATAG. Insertion Sequence: TTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2147 |
acs-13(ok2861) I. |
C. elegans |
Y65B4BL.5. Homozygous. Outer Left Sequence: TATTCGGCTTTGAGGAGAGC. Outer Right Sequence: AAAGGCCACTGGTGAGTTTG. Inner Left Sequence: TGAACAAATGATTGAGCGACA. Inner Right Sequence: ACCGATGAGCTCAAAACGAC. Inner Primer PCR Length: 1131 bp. Deletion Size: 603 bp. Deletion left flank: GGATCACCATTCCGACGTGTCCGGCTAGCG. Deletion right flank: TGAGTGAGCATCACACCTTTCGGTGTTCCA. [NOTE: ok2861 has been found to be same molecular lesion as ok2815. These alleles are likely two isolates of the same deletion pulled from the screening pool.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2148 |
F53B6.2(ok2862) I. |
C. elegans |
F53B6.2. Homozygous. Outer Left Sequence: GCTGTTCACGTGCTTTTTCA. Outer Right Sequence: AATGAGCAGGGTTTTTGTGG. Inner Left Sequence: CATTTGGTGCGGTAAGCAAT. Inner Right Sequence: TTCCAGATCAAGAGCAACCA. Inner Primer PCR Length: 1290 bp. Deletion Size: 631 bp. Deletion left flank: GCCACTCCACCAATTCCCAATGTCAATTTC. Deletion right flank: CTGAATGCATTTGAGAGCAGCTTTTTGTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2149 |
srw-100(ok2880) V. |
C. elegans |
Y46H3C.1. Homozygous. Outer Left Sequence: GGAATTGAGCATGTCAAGCA. Outer Right Sequence: GGGAATTCACCGAAAATCAA. Inner Left Sequence: TGCCGACATACAACAAGTTCA. Inner Right Sequence: CAAATCGGCAAATCGGTAAT. Inner Primer PCR Length: 1118 bp. Deletion Size: 373 bp. Deletion left flank: AACTCAATTCACAATACTCCTTTTAATTTC. Deletion right flank: ATGGCCACTGTGAGATTGGTACTAGTTAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2150 |
F13B12.6(ok2881) IV. |
C. elegans |
F13B12.6 Homozygous. Outer Left Sequence: cgaacgatgctacgagatga. Outer Right Sequence: aacacggaaaaatcaaacgg. Inner Left Sequence: ctggttgtcttgctgtccaa. Inner Right Sequence: aaaggataccgccgaaaaat. Inner Primer PCR Length: 1294. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2151 |
F17C11.2(ok2895) V. |
C. elegans |
F17C11.2. Homozygous. Outer Left Sequence: ATGTGTGTGCTGCAAGAAGG. Outer Right Sequence: CGGAACGTCGCCTATAAAAA. Inner Left Sequence: GGTATTCAATCGCAGCGG. Inner Right Sequence: ATTCGGTTTGTCATCGCACT. Inner Primer PCR Length: 1325 bp. Deletion Size: 1048 bp. Deletion left flank: GACGTTGCTAACTGTGTTAATGCGTGTTTC. Deletion right flank: ATAATATTTCCTAAATTCTCTCATCTCAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2152 |
R144.3(ok2897) III. |
C. elegans |
R144.3 Homozygous. Outer Left Sequence: atgacggatgatgatgacga. Outer Right Sequence: cgagacgacgcaataacatc. Inner Left Sequence: catcgtcttggaaaaatcgg. Inner Right Sequence: gggatcaattgaaatcaggg. Inner Primer PCR Length: 1125. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2153 |
C47E12.3(ok2898) IV. |
C. elegans |
C47E12.3 Homozygous. Outer Left Sequence: attgaacagcggggatattg. Outer Right Sequence: ctaggggcttgaatctgcac. Inner Left Sequence: cgattccattcgatcttcaa. Inner Right Sequence: attttcaggagacgcagacg. Inner Primer PCR Length: 1158. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2154 |
ptp-8(ok2899) IV. |
C. elegans |
T12B3.1 Homozygous. Outer Left Sequence: cgagtagggtccaacgagaa. Outer Right Sequence: ccaaaacgttggagaccaat. Inner Left Sequence: ttgtcgacattttcccaatg. Inner Right Sequence: caagttcgcgataagtggaa. Inner Primer PCR Length: 1239. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2155 |
Y71D11A.5(ok2900) III. |
C. elegans |
Y71D11A.5 Homozygous. Outer Left Sequence: ccagtttcagctgtgtcgaa. Outer Right Sequence: gttttgcacgtacttccacg. Inner Left Sequence: aaactaggcttgttgggggt. Inner Right Sequence: cgaagctaataatggtgccaa. Inner Primer PCR Length: 1313. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2156 |
R02F11.1(ok2901) V. |
C. elegans |
R02F11.1 Homozygous. Outer Left Sequence: atgaagcaactcgccatctc. Outer Right Sequence: agaaagactgggggcaattt. Inner Left Sequence: atccgactttcagctccaga. Inner Right Sequence: aggtgtatccagttgggcag. Inner Primer PCR Length: 1108. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2157 |
cdh-12(ok2902) III. |
C. elegans |
Y71D11A.1 Homozygous. Outer Left Sequence: atggccgagtacaccttcac. Outer Right Sequence: ccagagtcctgagcttccac. Inner Left Sequence: attccgcaaaactccacg. Inner Right Sequence: aggatcgtaacgttcaaccg. Inner Primer PCR Length: 1102. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2158 |
Y41E3.3(ok2918) IV. |
C. elegans |
Y41E3.3 Homozygous. Outer Left Sequence: ctcggcacatatttcggttt. Outer Right Sequence: atatgcccagtcaactccca. Inner Left Sequence: gaaattttcccgaactttcaa. Inner Right Sequence: aaaaagtttcccaaaaaccg. Inner Primer PCR Length: 1098. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2159 |
ins-16(ok2919) III. |
C. elegans |
Y39A3A.5 Homozygous. Outer Left Sequence: gagcgcgtaaatcttagcca. Outer Right Sequence: ttaattccggcaaagtaccg. Inner Left Sequence: gtctgaaccttggtcaagca. Inner Right Sequence: ggaaaatttcaatttcggca. Inner Primer PCR Length: 1191. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2160 |
cdh-10(ok2920) IV. |
C. elegans |
C45G7.5 Homozygous. Outer Left Sequence: acctcaaatccccgatcttt. Outer Right Sequence: taggccaccaacttcaatcc. Inner Left Sequence: tcaaaaaccgtggtgatcatt. Inner Right Sequence: cccactctgcagttttcaca. Inner Primer PCR Length: 1163. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2161 |
ZK858.6(ok2921) I. |
C. elegans |
ZK858.6 Homozygous. Outer Left Sequence: agttcgatgaacatggctcc. Outer Right Sequence: cgacaatttgccagttgcta. Inner Left Sequence: ctccagcgatgagtgaactg. Inner Right Sequence: ctgttatcaatccagcgcaa. Inner Primer PCR Length: 1327. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2162 |
C18H9.8(ok2922) II. |
C. elegans |
C18H9.8 Homozygous. Outer Left Sequence: gatgcctgtgtcaagagctg. Outer Right Sequence: ccacttcaaccttgccaact. Inner Left Sequence: ggacctccaagagcacctact. Inner Right Sequence: acgcacaattccatgaagaa. Inner Primer PCR Length: 1309. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2163 |
hmit-1.1(ok2923) V. |
C. elegans |
Y51A2D.4 Homozygous. Outer Left Sequence: aaggccgttttagtccgaat. Outer Right Sequence: tatttgtgcatgagcccgta. Inner Left Sequence: tttggatttccaggttctcg. Inner Right Sequence: atcaaagcctgctggaagac. Inner Primer PCR Length: 1151. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2164 |
T04D3.3(ok2924) I. |
C. elegans |
T04D3.3 Homozygous. Outer Left Sequence: tctcacagttcacctgacgc. Outer Right Sequence: cggaagttttggctagcagt. Inner Left Sequence: ttcaaggataaatttgccgc. Inner Right Sequence: agggtcactgcatttttcca. Inner Primer PCR Length: 1290. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2165 |
C06E7.1(ok2932) IV. |
C. elegans |
C06E7.1 Homozygous. Outer Left Sequence: gttctcgtccgaaacgtcat. Outer Right Sequence: gaaattggggaggaatttgg. Inner Left Sequence: tgcaatgttcttgttgcactc. Inner Right Sequence: ggatatcgaggatattgcgg. Inner Primer PCR Length: 1179. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2166 |
his-70(ok2933) III. |
C. elegans |
E03A3.4 Homozygous. Outer Left Sequence: tccgtaaactttaggccacg. Outer Right Sequence: tgttcattgaaatcaccgga. Inner Left Sequence: ccatccactgcagacacagt. Inner Right Sequence: acgtttttgaacgaaatggg. Inner Primer PCR Length: 1316. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2167 |
secs-1(ok2934) V. |
C. elegans |
D1054.13 Homozygous. Outer Left Sequence: accttgccagcgtcataatc. Outer Right Sequence: cacgcagtgaaatcttgcat. Inner Left Sequence: aaatgattcgttgatcggga. Inner Right Sequence: tgttgtacccctttgcactg. Inner Primer PCR Length: 1121. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2168 |
ZK1240.2(ok2935) II. |
C. elegans |
ZK1240.2 Homozygous. Outer Left Sequence: tgtagtggttttgctctgcg. Outer Right Sequence: cttggcgatacagttggctt. Inner Left Sequence: aattgccagacgacaaatcc. Inner Right Sequence: tggccggaaattagcataaa. Inner Primer PCR Length: 1130. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2169 |
F29G6.3(ok2936) X. |
C. elegans |
F29G6.3 Homozygous. Outer Left Sequence: tgtggtgctcatgcttcttc. Outer Right Sequence: tcacacacctacaggtccca. Inner Left Sequence: ctcaaactttctgcgaaggg. Inner Right Sequence: tccgctttgactcatgacag. Inner Primer PCR Length: 1207. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2170 |
clc-11(ok2937) V. |
C. elegans |
F44G3.10. Homozygous. Outer Left Sequence: TAGCACACAAGGTGGCACTC. Outer Right Sequence: AAAACTCCCAACTCTTCGCA. Inner Left Sequence: CTCACATCCCAGGAAGCATT. Inner Right Sequence: AACGTTTTTGCTGACACACG. Inner Primer PCR Length: 1145 bp. Deletion Size: 664 bp. Deletion left flank: AGTAATAATAAGAATTTAATAAACGAGTAA. Deletion right flank: AACGATTCCAACGCTGCCTCCATCATCCGT. Insertion Sequence: AACGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2171 |
Y4C6A.1(ok2938) IV. |
C. elegans |
Y4C6A.1. Homozygous. Outer Left Sequence: GAAAACTCCAAACGGGACAA. Outer Right Sequence: ATTCGGCATACCTTCAAACG. Inner Left Sequence: AAATCAAAAGCCGTTCGTG. Inner Right Sequence: CCCCAACTGAAAATGGCTTA. Inner Primer PCR Length: 1236 bp. Deletion Size: 408 bp. Deletion left flank: CTGTTCAAGTGCAACTTTTCAACTTCTGAA. Deletion right flank: CTGTATTCATCGGTTCGTTTTCTTAAAAAA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2172 |
ttr-30(ok2939) X. |
C. elegans |
T08A9.2. Homozygous. Outer Left Sequence: TAGCGGTGACTCAACGGATT. Outer Right Sequence: AGAAACACGAGTCCCGAGAA. Inner Left Sequence: AAAACGAAGTCACATCATTGAAAA. Inner Right Sequence: CGTGGTTTTTGATAGGAGTACCA. Inner Primer PCR Length: 1116 bp. Deletion Size: 501 bp. Deletion left flank: GAAACATTTGCTATAAAACTTCTCGTCCTC. Deletion right flank: AATCTTCAATCGGTTTCTGTGAACGGAACA. Insertion Sequence: AGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2173 |
F12D9.1(ok2940) X. |
C. elegans |
F12D9.1. Homozygous. Outer Left Sequence: TAATGTGGTCCGCACAAAAA. Outer Right Sequence: GAGCAAAGTTGCGATTGTGA. Inner Left Sequence: TTTACTTGTGCATTTTTCCCA. Inner Right Sequence: TAGCGCAGCGTAGTTGGATA. Inner Primer PCR Length: 1192 bp. Deletion Size: 543 bp. Deletion left flank: ACGCGGCCACATTCTTCCCAGTCACGTTTT. Deletion right flank: TTTCAGATGCTGTAATTAGGATTTAGTTGA. Insertion Sequence: TTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2174 |
F59D6.7(ok2941) V. |
C. elegans |
F59D6.7. Homozygous. Outer Left Sequence: ACGGGCAAATTCCACATATT. Outer Right Sequence: AATACAAAACGGTATGCGCC. Inner Left Sequence: TTCATACATTTGATTGGTGTACTAA. Inner Right Sequence: AAATGCACACGTGGGGTTAG. Inner Primer PCR Length: 1297 bp. Deletion Size: 570 bp. Deletion left flank: TAGAAATTAATTCAAAAATCGCATCGACAT. Deletion right flank: CTGGGACATTCAAGAAGTCGTCACGTGACA. Insertion Sequence: CATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2175 |
klp-20(ok2942) III. |
C. elegans |
Y50D7A.6. Homozygous. Outer Left Sequence: ATCACAACGGGAATCTGGAG. Outer Right Sequence: TTCAACGGCAAAAATGTTCA. Inner Left Sequence: GAATTTGGAATCCTCCCGAT. Inner Right Sequence: TCATATTTCTCACCTCAATTTCTCA. Inner Primer PCR Length: 1133 bp. Deletion Size: 588 bp. Deletion left flank: CAAGGAGAGCGGTTGAAGGAGGCGGCGAAG. Deletion right flank: CAAATCGTGCGAAGAATATTCAAAACGTCG. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2176 |
gly-4(ok2943) V. |
C. elegans |
Y116F11B.12. Homozygous. Outer Left Sequence: TGACACCAGATTTGACGGAA. Outer Right Sequence: CAAAAACCTCCGAAGCACAT. Inner Left Sequence: AAATTTTGCTTTTTGGGCCT. Inner Right Sequence: CCAAATTTTGCGACTTACTATCG. Inner Primer PCR Length: 1177 bp. Deletion Size: 617 bp. Deletion left flank: ATCATCACGGCACAATGAGAAAAGTTGCTC. Deletion right flank: ATTAGATGTCGATAGTAAGTCGCAAAATTT. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2177 |
hlh-11(ok2944) III. |
C. elegans |
F58A4.7. Homozygous. Outer Left Sequence: AAGCTTGCGTCTTGAGAAGG. Outer Right Sequence: AAACTTGGCAATGTTGGAGG. Inner Left Sequence: GAGGAGATGATGAGTTCGGG. Inner Right Sequence: GGAATATACGTTGAGACGCCA. Inner Primer PCR Length: 1099 bp. Deletion Size: 432 bp. Deletion left flank: GGACACAAAGGAGAAGATATACCTGACGGT. Deletion right flank: CACATTGCCATCTTCATATGCTTCATCGGC. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2178 |
sre-48(ok2945) II. |
C. elegans |
Y39G8B.3. Homozygous. Outer Left Sequence: AGGTGCACACCTTTTTGCAT. Outer Right Sequence: ACCTTTTGGAAAAATTGCGA. Inner Left Sequence: AGCGACTGGGTGAAACAGAA. Inner Right Sequence: GCACCTGAATAATGCGAAAAA. Inner Primer PCR Length: 1272 bp. Deletion Size: 508 bp. Deletion left flank: GTCTCTGTCTCCTTTTTCAGCTCTTCGCAC. Deletion right flank: AGAATTTTCTAGAATTTTCCAAAAGGTTTC. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2179 |
F59A3.10(ok2955) I. |
C. elegans |
F59A3.10 Homozygous. Outer Left Sequence: ttgccgaaaataagtttgcc. Outer Right Sequence: ttagtgtcgtcagtggggaa. Inner Left Sequence: acggctatttcctctgaacg. Inner Right Sequence: tcaaaatgggtcaaaaagaaaaa. Inner Primer PCR Length: 1236. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2180 |
W07B8.1(ok2956) V. |
C. elegans |
W07B8.1. Homozygous. Outer Left Sequence: TGTGGGAATTTGCCAAAACT. Outer Right Sequence: GTCGACCTGTTGCGACCTAT. Inner Left Sequence: GGCCGGAAATTATTAGGTCA. Inner Right Sequence: ACTTTCAGCCACTTTCGTCG. Inner Primer PCR Length: 1352 bp. Deletion Size: 561 bp. Deletion left flank: CACGGTATTCCTACCGGAGGATCCTATGAA. Deletion right flank: AACTTCCAGTTATTGCAAAAGAAAAACGGA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2181 |
ZK643.3(ok2957) III. |
C. elegans |
ZK643.3. Homozygous. Outer Left Sequence: AACTCGCAAAGCTCCAAAAA. Outer Right Sequence: TCGCTTCAAGACCCAGTACC. Inner Left Sequence: CTATTCTAACGGCTCGCCAA. Inner Right Sequence: CCGATCCATTTCAATTTGCT. Inner Primer PCR Length: 1177 bp. Deletion Size: 534 bp. Deletion left flank: CTCATCTCATGTCTCTTATACGGAGCATTC. Deletion right flank: ATAGAATTCCAAGCATTGGATAATGATTAA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2182 |
ZK632.3(ok2958) III. |
C. elegans |
ZK632.3. Homozygous. Outer Left Sequence: CGCTCATCGTCAGTGAAAAA. Outer Right Sequence: GTCAGTTTTGCGGATGTCCT. Inner Left Sequence: CCCATTCCACGTTTTTGAGT. Inner Right Sequence: ACTTGCTCTTCAACGCCATT. Inner Primer PCR Length: 1108 bp. Deletion Size: 371 bp. Deletion left flank: GCCGACCATATCGCCTGTTGGAAGGGTGTT. Deletion right flank: AAGACGAGAATTCGTTGCATTTTCCTCATC. Insertion Sequence: TCCCTTCCAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2183 |
grl-16(ok2959) I. |
C. elegans |
Y65B4BR.6. Homozygous. Outer Left Sequence: AACTGAAGTGTGGGTGAGGG. Outer Right Sequence: TCATTCGGAAATGAACACGA. Inner Left Sequence: GGAGTGGTGCGAATCTGACT. Inner Right Sequence: CTTCCCCCTATTCTGCAACA. Inner Primer PCR Length: 1236 bp. Deletion Size: 473 bp. Deletion left flank: TCCGGCGTTGTAGCCTCCTTGTGGGGCGAC. Deletion right flank: AAGTAGAATGGACTTTGTCGCTCCTTAAGG. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2184 |
clc-32(ok2960) V. |
C. elegans |
F10A3.1. Homozygous. Outer Left Sequence: TGCGGACTGCAAATAAAGTG. Outer Right Sequence: CGTGTGCTTTGTACGCTGAT. Inner Left Sequence: TCCCGTTTCTACTTGGTTTTT. Inner Right Sequence: TTCCGAAACAAAATGCACAA. Inner Primer PCR Length: 1208 bp. Deletion Size: 327 bp. Deletion left flank: TTCAGGGTAAGCACTAAATTGAGTTCCGTG. Deletion right flank: GTGTGTAAGCAAGTGCGTTATGAAATTGTG. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2185 |
glt-4(ok2961) X. |
C. elegans |
T22E5.2. Homozygous. Outer Left Sequence: GCCTCATTGGATTCTGGAAC. Outer Right Sequence: TTTTATCGGATTACGGCGAG. Inner Left Sequence: GCAGGAAGATTAGGAATGGTG. Inner Right Sequence: GCCAAAAAGCTCAAAATTGG. Inner Primer PCR Length: 1130 bp. Deletion Size: 343 bp. Deletion left flank: ATCGGATGGGTCATTATGTAATATTGAAAT. Deletion right flank: TTAATCTTGACTCGAATCGAGAATGATAGG. Insertion Sequence: TTAATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2186 |
H25K10.5(ok2962) IV. |
C. elegans |
H25K10.5. Homozygous. Outer Left Sequence: TGGGCCCTAACGCATACTAC. Outer Right Sequence: CCGGTTGTACAGCCCTACTC. Inner Left Sequence: CGGTTATCTAGGTGTGGCCT. Inner Right Sequence: AGGCGAAACTCACTACATCCA. Inner Primer PCR Length: 1227 bp. Deletion Size: 570 bp. Deletion left flank: TGATAAAACTCACTTCCACACTTTCGAGCC. Deletion right flank: TGTCACATAGAAAACGAAAGTATAATCCTT. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2187 |
lgc-47(ok2963) X. |
C. elegans |
F47A4.1. Homozygous. Outer Left Sequence: GCCCGAAGAAGATTACCAAA. Outer Right Sequence: ACGACCCAACGAACAGAAAC. Inner Left Sequence: TCCTTTCATTCTTTTGCTCACA. Inner Right Sequence: AAGCGGAAAGTGTTTCTCCTC. Inner Primer PCR Length: 1179 bp. Deletion Size: 521 bp. Deletion left flank: GTCATATAGGTTGGAATGTAACCTTGCAAG. Deletion right flank: TACTAAAGTTTGTCATTGTGAAATCAGGTA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2188 |
flp-20(ok2964) X. |
C. elegans |
E01H11.3 Homozygous. Outer Left Sequence: ccgattgccaaaacgattac. Outer Right Sequence: agcccgcttccttcatagtt. Inner Left Sequence: tcatgaagctatcggaagatca. Inner Right Sequence: tcctccatcaccagacaaca. Inner Primer PCR Length: 1194. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2189 |
Y41E3.3(ok2969) IV. |
C. elegans |
Y41E3.3 Homozygous. Outer Left Sequence: ctcggcacatatttcggttt. Outer Right Sequence: atatgcccagtcaactccca. Inner Left Sequence: gaaattttcccgaactttcaa. Inner Right Sequence: aaaaagtttcccaaaaaccg. Inner Primer PCR Length: 1098. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2191 |
C35D10.11(ok2971) III. |
C. elegans |
C35D10.11 Homozygous. Outer Left Sequence: ttacatgggtgcaaatgtcg. Outer Right Sequence: ataccccaacataatgccca. Inner Left Sequence: ttcagcttctccgccactac. Inner Right Sequence: caactgaacacgtcattgtgg. Inner Primer PCR Length: 1257. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2192 |
grd-10(ok2972) IV. |
C. elegans |
F09D12.1 Homozygous. Outer Left Sequence: tcgtcatctttttgtcgctg. Outer Right Sequence: attgaaccaatagttgcggg. Inner Left Sequence: ttcttgtgttccaaaagggc. Inner Right Sequence: ttgagatagggtaaaagaagatcg. Inner Primer PCR Length: 1202. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2193 |
F44G3.2(ok2973) V. |
C. elegans |
F44G3.2 Homozygous. Outer Left Sequence: tgcacagattggtcttcgac. Outer Right Sequence: aggtccaaatgatgtcagcc. Inner Left Sequence: tttcaactctgtgtcttggca. Inner Right Sequence: ccgcattattcgttaagggt. Inner Primer PCR Length: 1144. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2194 |
math-33(ok2974) V. |
C. elegans |
H19N07.2 Homozygous. Outer Left Sequence: gaaagttcgcggactgaatc. Outer Right Sequence: cttgtcggtcattgtgtcgt. Inner Left Sequence: cgtgcattcgaagcttacac. Inner Right Sequence: cgaaaaatagaaggtcccct. Inner Primer PCR Length: 1180. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2195 |
C16E9.2(ok2975) X. |
C. elegans |
C16E9.2 Homozygous. Outer Left Sequence: tgttgctgaagcaattcgac. Outer Right Sequence: ccccctttgaaaacaagaca. Inner Left Sequence: gttggcaacacagcaaggta. Inner Right Sequence: cagctcgttctcctcgtttc. Inner Primer PCR Length: 1373. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2196 |
K08D10.14(ok2976) IV. |
C. elegans |
K08D10.14 Homozygous. Outer Left Sequence: aatttagcgtacgccactcg. Outer Right Sequence: aggagaatgtggtaaggcga. Inner Left Sequence: agcacgcgctttgtgttt. Inner Right Sequence: agaccaaattctgtgggtgtg. Inner Primer PCR Length: 1275. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2197 |
srw-99(ok2977) V. |
C. elegans |
Y46H3C.2 Homozygous. Outer Left Sequence: tttcgtcgctgtagttcgtg. Outer Right Sequence: gggaattcctggccatttac. Inner Left Sequence: gctggcaagcgtcagatac. Inner Right Sequence: cagtggcgagcgttaacata. Inner Primer PCR Length: 1122. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2198 |
C27B7.7(ok2978) IV. |
C. elegans |
C27B7.7 Homozygous. Outer Left Sequence: catgacgtcggttacactgg. Outer Right Sequence: ctccgggtcctgaaacatta. Inner Left Sequence: gccaaatctgtttgaagaactg. Inner Right Sequence: gcatggattcgtgtcttcct. Inner Primer PCR Length: 1143. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2199 |
K06A4.3(ok2979) V. |
C. elegans |
K06A4.3 Homozygous. Outer Left Sequence: gccaccagagagtggaagac. Outer Right Sequence: gaaatacgatggttgtgggg. Inner Left Sequence: gaatcaagggaatggctcgt. Inner Right Sequence: gttctgcacggatcgaactt. Inner Primer PCR Length: 1119. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2200 |
gst-24(ok2980) II. |
C. elegans |
F37B1.1 Homozygous. Outer Left Sequence: gcgacgattcatggtctttt. Outer Right Sequence: ctctccctcccctcaatttc. Inner Left Sequence: caaactccccaggtgtgact. Inner Right Sequence: ggagattttcgaaacgactttg. Inner Primer PCR Length: 1156. Deletion size: about 600 bp. ttggtcagctcccattcctc [ 603 bp deletion] caagttatctaggcacgagg -- Wild type ttggtcagctcccattcctc ------------------ caagttatctaggcacgagg -- ok2980 Sequence shown is on the minus strand. Deletion starts in the second exon and removes the downstream part of that exon, the 3'-UTR, and approximately 0.1 kb of downstream flanking sequence. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2201 |
M60.6(ok2981) X. |
C. elegans |
M60.6 Homozygous. Outer Left Sequence: cacgtacgaaaccccaaagt. Outer Right Sequence: agttgcacaatccttttcgc. Inner Left Sequence: ttctcctgagaaagaatttggttt. Inner Right Sequence: gttatcggaaacaacgacgg. Inner Primer PCR Length: 1302. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2202 |
vit-4(ok2982) X. |
C. elegans |
F59D8.2 Homozygous. Outer Left Sequence: cagcgtgagcattttgagaa. Outer Right Sequence: caaagctgaggtcaacccat. Inner Left Sequence: cgaagacggtttcgaatgat. Inner Right Sequence: tcaaggctatcgagatagagca. Inner Primer PCR Length: 1165. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2203 |
F01G12.6(ok2983) X. |
C. elegans |
F01G12.6 Homozygous. Outer Left Sequence: ttgggacgagaaaatgaagg. Outer Right Sequence: ccaagttgagggtctcggta. Inner Left Sequence: ttgtgcatgggagaagttga. Inner Right Sequence: tgcaacattcataaaaatgcaa. Inner Primer PCR Length: 1279. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2204 |
W10G6.1(ok2984) X. |
C. elegans |
W10G6.1 Homozygous. Outer Left Sequence: tgcatgcaactggaaacatt. Outer Right Sequence: ttatcacgtcggaagaggct. Inner Left Sequence: tgtgaatcagcagaaatgtcaa. Inner Right Sequence: accttcaactgcaggacgat. Inner Primer PCR Length: 1190. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2205 |
hex-2(ok2985) V. |
C. elegans |
C14C11.3 Homozygous. Outer Left Sequence: acactcggttttcggctatg. Outer Right Sequence: tttcccaccaagcacctaac. Inner Left Sequence: atttccagaatccttgcgtg. Inner Right Sequence: agcgcatttttctgcatctc. Inner Primer PCR Length: 1120. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2206 |
T25D3.3(ok2986) II. |
C. elegans |
T25D3.3 Homozygous. Outer Left Sequence: caaaattggagccaaaggaa. Outer Right Sequence: tctcgaacgtcttcgtgatg. Inner Left Sequence: gacccgagagcgtgatttta. Inner Right Sequence: ttggtgacaaaatgttcgga. Inner Primer PCR Length: 1186. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2207 |
K08F8.1(ok2987) II. |
C. elegans |
K08F8.1 Homozygous. Outer Left Sequence: cagaatcacgccatgagcta. Outer Right Sequence: tcgtgtgggaacgcataata. Inner Left Sequence: tggtgattgggggttaagaa. Inner Right Sequence: agcgacacctttcatcgagt. Inner Primer PCR Length: 1298. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2208 |
H22K11.2(ok2990) X. |
C. elegans |
H22K11.2 Homozygous. Outer Left Sequence: cttggtggctcatcaggaat. Outer Right Sequence: gtaaagggcaccctgaacaa. Inner Left Sequence: ggaaagtaccggagcagtga. Inner Right Sequence: ttggcacgtttttaattttgg. Inner Primer PCR Length: 1266. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2209 |
ZK1240.2(ok2991) II. |
C. elegans |
ZK1240.2 Homozygous. Outer Left Sequence: tgtagtggttttgctctgcg. Outer Right Sequence: cttggcgatacagttggctt. Inner Left Sequence: aattgccagacgacaaatcc. Inner Right Sequence: tggccggaaattagcataaa. Inner Primer PCR Length: 1130. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2210 |
C04G2.8(ok2992) IV. |
C. elegans |
C04G2.8 Homozygous. Outer Left Sequence: tgtcctgggtaggttgggta. Outer Right Sequence: atcccgaatctgtccaatca. Inner Left Sequence: gaccttttcacgaggcaatc. Inner Right Sequence: ggtccttcgacaaccatagc. Inner Primer PCR Length: 1314. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2211 |
F44G3.2(ok2993) V. |
C. elegans |
F44G3.2 Homozygous. Outer Left Sequence: tgcacagattggtcttcgac. Outer Right Sequence: aggtccaaatgatgtcagcc. Inner Left Sequence: tttcaactctgtgtcttggca. Inner Right Sequence: ccgcattattcgttaagggt. Inner Primer PCR Length: 1144. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2212 |
M02D8.1(ok2994) X. |
C. elegans |
M02D8.1 Homozygous. Outer Left Sequence: gataaaccacttgccggaga. Outer Right Sequence: tgtgcatgggacacaaagtt. Inner Left Sequence: ccgatggagagaacagctcta. Inner Right Sequence: tcgaaaatcagaagcaacga. Inner Primer PCR Length: 1159. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2213 |
C09F9.2(ok2995) II. |
C. elegans |
C09F9.2 Homozygous. Outer Left Sequence: aatccactgctccaacaacc. Outer Right Sequence: gtgactccatcctcctggaa. Inner Left Sequence: aagtgtgaacggggatgtct. Inner Right Sequence: aggtgtagccttcgatggtg. Inner Primer PCR Length: 1257. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2214 |
C16E9.2(ok2996) X. |
C. elegans |
C16E9.2 Homozygous. Outer Left Sequence: tgttgctgaagcaattcgac. Outer Right Sequence: ccccctttgaaaacaagaca. Inner Left Sequence: gttggcaacacagcaaggta. Inner Right Sequence: cagctcgttctcctcgtttc. Inner Primer PCR Length: 1373. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2215 |
F40F9.2(ok2997) V. |
C. elegans |
F40F9.2 Homozygous. Outer Left Sequence: tcgctactttcccgcttaaa. Outer Right Sequence: tttcagtttgccatcacagc. Inner Left Sequence: tcgtaattatttgtgaaatgaaactt. Inner Right Sequence: cagaaccgtttcaggattgg. Inner Primer PCR Length: 1253. Deletion size: about 800bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2216 |
K07C6.4(ok2998) V. |
C. elegans |
K07C6.4 Homozygous. Outer Left Sequence: aattctctgctcgtcggaaa. Outer Right Sequence: tcaatatgcacacagcgaca. Inner Left Sequence: tcgaggccgaagataaggat. Inner Right Sequence: gctttttaggctttctcgtgg. Inner Primer PCR Length: 1143. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2217 |
R08C7.6(ok2999) IV. |
C. elegans |
R08C7.6 Homozygous. Outer Left Sequence: acggaacatttttcaaggca. Outer Right Sequence: accccaccaatcaacgataa. Inner Left Sequence: gcgacatttgcacaattaca. Inner Right Sequence: gagttggacgccactgattt. Inner Primer PCR Length: 1201. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2218 |
jac-1(ok3000) IV. |
C. elegans |
Y105C5B.21. Homozygous. Outer Left Sequence: ACATCTCACGGGTTCCACTC. Outer Right Sequence: TCGTAAGATTCAGCGCAATG. Inner Left Sequence: AAGTTCCCGATTCCTTGGAT. Inner Right Sequence: GCGTTCTACCAAAGCTACCG. Inner Primer PCR Length: 1249 bp. Deletion Size: 456 bp. Deletion left flank: CTCAAGGATCACAGGCTTCAACATATCCGC. Deletion right flank: AAACAAAGTTTTGAGCTTTTAACGTAAGTT. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2219 |
C28C12.9(ok3004) IV. |
C. elegans |
C28C12.9 Homozygous. Outer Left Sequence: tcgtcgatcaatcctgacaa. Outer Right Sequence: cgttaatacttcgtggccgt. Inner Left Sequence: caacgaagactctagggcgt. Inner Right Sequence: cccggccatattatttttga. Inner Primer PCR Length: 1333. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2220 |
R13H9.5(ok3005) IV. |
C. elegans |
R13H9.5 Homozygous. Outer Left Sequence: aatgaactcaaaacgggacg. Outer Right Sequence: tgtaatgacgcttgtcggaa. Inner Left Sequence: cggttccagtccagtctgat. Inner Right Sequence: agtctttgcaggtaaatacgagtt. Inner Primer PCR Length: 1218. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2221 |
Y113G7B.14(ok3006) V. |
C. elegans |
Y113G7B.14 Homozygous. Outer Left Sequence: ggacccctgacatgaacttg. Outer Right Sequence: gtctcgaaagtcgtcttggc. Inner Left Sequence: tgtccgacaatgagaatgga. Inner Right Sequence: tttcatcatcggaacaagca. Inner Primer PCR Length: 1147. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2222 |
fkb-2(ok3007) I. |
C. elegans |
Y18D10A.19 Homozygous. Outer Left Sequence: agtcgaagctcacgattgct. Outer Right Sequence: cggagatttcgacttcaagg. Inner Left Sequence: ccgtagccaggagaaaaatg. Inner Right Sequence: ttatggagaggttgcacacg. Inner Primer PCR Length: 1148. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2223 |
grd-10(ok3008) IV. |
C. elegans |
F09D12.1 Homozygous. Outer Left Sequence: tcgtcatctttttgtcgctg. Outer Right Sequence: attgaaccaatagttgcggg. Inner Left Sequence: ttcttgtgttccaaaagggc. Inner Right Sequence: ttgagatagggtaaaagaagatcg. Inner Primer PCR Length: 1202. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2224 |
F38B6.6(ok3009) X. |
C. elegans |
F38B6.6 Homozygous. Outer Left Sequence: aaacgtgtaccgagattcgc. Outer Right Sequence: tggtgaatggatttgaagca. Inner Left Sequence: aacaaaactgaagttggattcagaaacaaaactgaagttggattcaga. Inner Right Sequence: gggatgcatttcctccatta. Inner Primer PCR Length: 1214. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2225 |
col-179(ok3010) X. |
C. elegans |
C34F6.3 Homozygous. Outer Left Sequence: cctgccactaaagagaacgc. Outer Right Sequence: gcggaaacaaggattatgga. Inner Left Sequence: ggttgcaaagtgattgcaga. Inner Right Sequence: tggtaagaaacgttcacgca. Inner Primer PCR Length: 1291. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2226 |
ZC416.2(ok3011) IV. |
C. elegans |
ZC416.2 Homozygous. Outer Left Sequence: ctggggtcaaaagtcggtta. Outer Right Sequence: gttaaaattgtctgccgcgt. Inner Left Sequence: tcccaaactccaatttccag. Inner Right Sequence: gcatcggggtgactcttact. Inner Primer PCR Length: 1235. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2227 |
K06H6.3(ok3012) V. |
C. elegans |
K06H6.3 Homozygous. Outer Left Sequence: gcaaatactgaacccgcaat. Outer Right Sequence: ccgacgaatttttcagcatt. Inner Left Sequence: ttttatttcggattgccagg. Inner Right Sequence: ttttcaaagtagacgccttcaa. Inner Primer PCR Length: 1395. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2228 |
klp-20(ok3013) III. |
C. elegans |
Y50D7A.6 Homozygous. Outer Left Sequence: atcacaacgggaatctggag. Outer Right Sequence: ttcaacggcaaaaatgttca. Inner Left Sequence: gaatttggaatcctcccgat. Inner Right Sequence: tcatatttctcacctcaatttctca. Inner Primer PCR Length: 1132. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2229 |
cyn-7(ok3014) V. |
C. elegans |
Y75B12B.2 Homozygous. Outer Left Sequence: acttccggattgttgacctg. Outer Right Sequence: agctcatccgtgtgcttctt. Inner Left Sequence: gtgaagagctggcaacaatg. Inner Right Sequence: tgattcccgctctattaccg. Inner Primer PCR Length: 1175. Deletion size: about 600 bp. cyn-7 was formerly known as cyp-7. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2230 |
ZC395.10(ok3015) III. |
C. elegans |
ZC395.10 Homozygous. Outer Left Sequence: cttgcccatggaaactgatt. Outer Right Sequence: caatgccattcgcacttaaa. Inner Left Sequence: gaaaaacgaatgcgggataa. Inner Right Sequence: tcttgcttgttattgccgtg. Inner Primer PCR Length: 1195. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2231 |
F47A4.1(ok3016) X. |
C. elegans |
F47A4.1 Homozygous. Outer Left Sequence: gcccgaagaagattaccaaa. Outer Right Sequence: acgacccaacgaacagaaac. Inner Left Sequence: tcctttcattcttttgctcaca. Inner Right Sequence: aagcggaaagtgtttctcctc. Inner Primer PCR Length: 1179. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2232 |
grl-17(ok3017) V. |
C. elegans |
C56A3.1 Homozygous. Outer Left Sequence: tgattggcacatagtcggaa. Outer Right Sequence: ctacgttcaaagcggaggag. Inner Left Sequence: aaatgacagattgaagcggg. Inner Right Sequence: gaaaaacatggcaaccttcc. Inner Primer PCR Length: 1162. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2233 |
Y50D7A.10(ok3020) III. |
C. elegans |
Y50D7A.10. Homozygous. Outer Left Sequence: CCGCCCCTTTAATAGAAACC. Outer Right Sequence: GTACGAGGAGTCCGCACATT. Inner Left Sequence: TTTGTTTTCCGCCTGTTTTC. Inner Right Sequence: ATATTTGCCAAGAAAGGGGC. Inner Primer PCR Length: 1152 bp. Deletion Size: 741 bp. Deletion left flank: TTTTTTTGCGAAAATCTCGGCTTTTTCACC. Deletion right flank: TGTAGAGCTAAACTTAAACGAAAAATGGTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2234 |
E04A4.6(ok3021) IV. |
C. elegans |
E04A4.6. Homozygous. Outer Left Sequence: GAGACATGCGTCAGCAAAGA. Outer Right Sequence: GCAATTTCAGCATCCGATTT. Inner Left Sequence: GCTTGCGTCCTTCTTGACTT. Inner Right Sequence: TGGAACTCAAAATGTGATAACGA. Inner Primer PCR Length: 1379 bp. Deletion Size: 515 bp. Deletion left flank: AAGGAAGAACACAGGAGATGGTGCAATAGA. Deletion right flank: CTGTCATATTCCTTTTCGTTATCACATTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2235 |
cyp-35B1(ok3022) V. |
C. elegans |
K07C6.4. Homozygous. Outer Left Sequence: AATTCTCTGCTCGTCGGAAA. Outer Right Sequence: TCAATATGCACACAGCGACA. Inner Left Sequence: TCGAGGCCGAAGATAAGGAT. Inner Right Sequence: GCTTTTTAGGCTTTCTCGTGG. Inner Primer PCR Length: 1144 bp. Deletion Size: 480 bp. Deletion left flank: ATCTCTGGTTAGCTGGTCAAGATACCACTT. Deletion right flank: TTGGAAATCTTATCCTGCGATATGACATTA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2237 |
tub-2(ok3024) I. |
C. elegans |
Y71G12A.3. Homozygous. Outer Left Sequence: AGGCGACTTCTCTCCCTCTC. Outer Right Sequence: TCATCATTATCGCCGATTCA. Inner Left Sequence: GTGTGTGTGTGTGTGTGCGT. Inner Right Sequence: TCCTTTCCACCAACGGATTA. Inner Primer PCR Length: 1267 bp. Deletion Size: 522 bp. Deletion left flank: GGTGTTAGGCTTTTCCACTGGAACTATTCA. Deletion right flank: TAAGCTGCCGATTCCACTCAAGGAGATGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2238 |
C25F6.6(ok3025) X. |
C. elegans |
C25F6.6. Homozygous. Outer Left Sequence: AAAGACGATGGAGGCAAATG. Outer Right Sequence: CCCCTAGGTGGCTTGACTTT. Inner Left Sequence: CAACATCTTCACCGTCACCA. Inner Right Sequence: CAACGTCACAATTCACTTGC. Inner Primer PCR Length: 1278 bp. Deletion Size: 637 bp. Deletion left flank: ATGCGGGACTCAAACTTCTGAGTGAAAAGT. Deletion right flank: AAAAAAATAGAATGTTACTAAGGACAAGGA. Insertion Sequence: ATAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2239 |
W03G1.5(ok3026) IV. |
C. elegans |
W03G1.5. Homozygous. Outer Left Sequence: TCGAGATGTCTTCGCCTTTT. Outer Right Sequence: GTGGTGAAGCTGTACGCTGA. Inner Left Sequence: GGAGTCTGGTGGAAATTGGA. Inner Right Sequence: GGTGAGAAGGATCTGAAGGG. Inner Primer PCR Length: 1356 bp. Deletion Size: 612 bp. Deletion left flank: TCCATGGCGTCCTGGACAATGTGGTGGGCC. Deletion right flank: TCATTTTCGTCATCGCTGCTTTCCGATCCT. Insertion Sequence: TCG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2240 |
sams-1(ok3033) X. |
C. elegans |
C49F5.1. Homozygous. Outer Left Sequence: AGGACTTGCGAGAGTACGGA. Outer Right Sequence: CTTGAGAGCTTTTGGCTGCT. Inner Left Sequence: AGTGAATCTGTGTCCGAGGG. Inner Right Sequence: GGGAACTCAGAGTGACCGAA. Inner Primer PCR Length: 1248 bp. Deletion Size: 480 bp. Deletion left flank: ACTCCGCGTTCACACTGTTGTGGTCTCTAC. Deletion right flank: TAGATAGGAGAAATTTCATTGGTTTTTTAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2241 |
Y116A8C.5(ok3034) IV. |
C. elegans |
Y116A8C.5. Homozygous. Outer Left Sequence: ACGAATGTTGATCGGTGACA. Outer Right Sequence: AAATGTGGCTCTTTTGCAGC. Inner Left Sequence: GCTGCCAGGATTTATGCTTC. Inner Right Sequence: GCCGACACTTTTTGGGTTT. Inner Primer PCR Length: 1161 bp. Deletion Size: 672 bp. Deletion left flank: GGTAAGTTCCTAGCACTCTGGTTTCCAACT. Deletion right flank: TCTAGACGATTTGGCAGAGTATGTTAATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2242 |
bbs-2(ok3035) IV. |
C. elegans |
F20D12.3 Homozygous. Outer Left Sequence: gaatcggatcaaggacctca. Outer Right Sequence: tatgtggatcaacgttgcca. Inner Left Sequence: tggatgataatgtcgaacttgc. Inner Right Sequence: tttacacatctcaaaaatcagtgaa. Inner Primer PCR Length: 1215. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2243 |
lact-4(ok3036) II. |
C. elegans |
M05D6.4. Homozygous. Outer Left Sequence: ACTGTTGGGCCATACTCGAC. Outer Right Sequence: AGCAAAAATGCGCTTCATCT. Inner Left Sequence: CAATTGGAGAGAAGCCGAAG. Inner Right Sequence: AAAACAATGGCAAGATATAAACTGT. Inner Primer PCR Length: 1228 bp. Deletion Size: 539 bp. Deletion left flank: ATTGTGTTCAAATTCTTTAAGCATAAAACC. Deletion right flank: ATGCTCAATTGAAAACATTAAGTTTTTATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2244 |
grl-9(ok3038) V. |
C. elegans |
ZC487.4. Homozygous. Outer Left Sequence: CGATGTGATTTATTGCACGG. Outer Right Sequence: CTCTCCTGGCTTTTACGCAG. Inner Left Sequence: GTGAATGGAGGAAAGCGAAG. Inner Right Sequence: CCGAATGGACAAGTTGGAAG. Inner Primer PCR Length: 1291 bp. Deletion Size: 253 bp. Deletion left flank: GTGGAAGTTGAACCTGTTGCTGTTGCAGTT. Deletion right flank: AATTTTAGGCGAGTGAACACACAAAAGTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2245 |
C47D12.8(ok3039) II. |
C. elegans |
C47D12.8 Homozygous. Outer Left Sequence: ctcaacgccttccaagactc. Outer Right Sequence: caggatcccataaaggctca. Inner Left Sequence: tttgtaccgcgaaaagaagc. Inner Right Sequence: tgaaaatggcgagaaaaacc. Inner Primer PCR Length: 1181. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2246 |
T11F1.9(ok3040) II. |
C. elegans |
T11F1.9. Homozygous. Outer Left Sequence: ATTCCCGCTGTGATGAAAAG. Outer Right Sequence: CCGCAGATTTCAACAAGGAT. Inner Left Sequence: GAAGATGATGTACTCACTCCCAA. Inner Right Sequence: TGAAAGAACTCAAAGCGCAA. Inner Primer PCR Length: 1360 bp. Deletion Size: 675 bp. Deletion left flank: TATGAAATGATAAGGAGACTTACGGCAATC. Deletion right flank: TTCCAAGTTTTCCCCAAAATGATTCGAATG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2247 |
eat-17(ok3041) X. |
C. elegans |
T24D11.1. Homozygous. Outer Left Sequence: GGATTGAAGTGGCTTTCCAA. Outer Right Sequence: AGAGTCAAATGCCGAAAAGC. Inner Left Sequence: TTTTCAGGCAAAATGCAGC. Inner Right Sequence: AGGCTCAAGTAGGCTCAAGTG. Inner Primer PCR Length: 1237 bp. Deletion Size: 856 bp. Deletion left flank: AGATTGAGAGAAAATGGGAATGGATCGGAG. Deletion right flank: TGATAACGTTGAACAGAAGTGATTGGCCTC. Insertion Sequence: TGGGAATGGATCGGAGTGGATCGGAAATGGAATGGATCGGAAATGGGAATGGATCGGAG . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2248 |
gst-24(ok3042) II. |
C. elegans |
F37B1.1. Homozygous. Outer Left Sequence: GCGACGATTCATGGTCTTTT. Outer Right Sequence: CTCTCCCTCCCCTCAATTTC. Inner Left Sequence: CAAACTCCCCAGGTGTGACT. Inner Right Sequence: GGAGATTTTCGAAACGACTTTG. Inner Primer PCR Length: 1157 bp. Deletion Size: 555 bp. Deletion left flank: TCATTAACCTTCTCACGGAGCGCTGCAAGC. Deletion right flank: AGTTATACAAATACCACTAAAAATGTTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2249 |
F32H2.6(ok3043) I. |
C. elegans |
F32H2.6. Homozygous. Outer Left Sequence: GGAAGACGAGCTTCCAGATG. Outer Right Sequence: TCTCGACGGTTTCCGTTATC. Inner Left Sequence: GAGGAAGAAGCTCAGGGTCC. Inner Right Sequence: CATCTGTGCCGTGCAGTAAT. Inner Primer PCR Length: 1288 bp. Deletion Size: 380 bp. Deletion left flank: ATGCCACCGAACATTTTGACTTCTTTATTA. Deletion right flank: GACGACTATCCTTTGTGGCAAAAGAAGAGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2250 |
puf-6(ok3044) II. |
C. elegans |
F18A11.1. Homozygous. Outer Left Sequence: GCGAAATTTCACGTTTTTCC. Outer Right Sequence: AAAATCCGCAGCAATGAAAG. Inner Left Sequence: AATACGGTACCCGGGGTCT. Inner Right Sequence: TTGGTCTTTTTAGGCCTTGC. Inner Primer PCR Length: 1113 bp. Deletion Size: 722 bp. Deletion left flank: TTTAAAGGCGCACTTTTTTCGAATTTAACC. Deletion right flank: GAGAGGAAATGCACGAAAAAGGTCCACATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2251 |
cpg-8(ok3045) V. |
C. elegans |
K03B4.7. Homozygous. Outer Left Sequence: TCGAGGATCTCAAGGATTGG. Outer Right Sequence: CCAAATAGACCCGCAACATT. Inner Left Sequence: CTCGACTCGTTGACGACCTT. Inner Right Sequence: TTTGATCTACTCTTTTAGCCAGTTT. Inner Primer PCR Length: 1258 bp. Deletion Size: 979 bp. Deletion left flank: TGCTTTGAGCAAAAAAAATTGAAAGAACGT. Deletion right flank: GTGCGGGGAGAGTGACCAGAAACTGATGAG. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2252 |
nas-3(ok3046) V. |
C. elegans |
K06A4.1. Homozygous. Outer Left Sequence: CTTAAAGGTCGAAGCATGGC. Outer Right Sequence: TGTTGAAGCACAAAGATCGG. Inner Left Sequence: TTCACCCACTCCAACTTCTAA. Inner Right Sequence: CGGCGCTTTCTGAAATAAAA. Inner Primer PCR Length: 1162 bp. Deletion Size: 377 bp. Deletion left flank: CTCCGAACCACCAAAGGATGACGATATCGC. Deletion right flank: TGGCTCTTCGGAACTCGTGATGGAAAAGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2253 |
ZK896.9(ok3050) IV. |
C. elegans |
ZK896.9. Homozygous. Outer Left Sequence: GGCTCACAAAAGCAGAAACC. Outer Right Sequence: TGCCCATTTTCCACTTTTTC. Inner Left Sequence: TCAAATACTCATCACTGGTGGTTC. Inner Right Sequence: ACGGTCACTCGTCCATTTTC. Inner Primer PCR Length: 1146 bp. Deletion Size: 590 bp. Deletion left flank: TTGCCAAGTGAGATTATTAGCTTAAAATCC. Deletion right flank: ATCACGAATTCTTCGTCAACTGGAGGGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2254 |
scrm-8(ok3051) IV. |
C. elegans |
K08D10.7. Homozygous. Outer Left Sequence: GCAATTAGCTTAACGTCCGC. Outer Right Sequence: GTTTGCAAGTGAAATGGGCT. Inner Left Sequence: GTCACCTGAGGAGGTTGAGC. Inner Right Sequence: ACATCTCCTGCATGAATCCC. Inner Primer PCR Length: 1122 bp. Deletion Size: 407 bp. Deletion left flank: GACTGTAAGTCATTCTAGCTAATGGTGACC. Deletion right flank: CAGTAATAACTACAGTACTACATTAAACTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2255 |
ZC395.10(ok3052) III. |
C. elegans |
ZC395.10. Homozygous. Outer Left Sequence: CTTGCCCATGGAAACTGATT. Outer Right Sequence: CAATGCCATTCGCACTTAAA. Inner Left Sequence: GAAAAACGAATGCGGGATAA. Inner Right Sequence: TCTTGCTTGTTATTGCCGTG. Inner Primer PCR Length: 1196 bp. Deletion Size: 816 bp. Deletion left flank: AAGAATTAAATTAGAGAAATTCAAATTGTA. Deletion right flank: ATTCGAAAAGAGAACTAGACGGATACGAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2256 |
F55A4.1(ok3053) X. |
C. elegans |
F55A4.1. Homozygous. Outer Left Sequence: GCATTGGGACAGAGGAGGTA. Outer Right Sequence: TGCACTGACCAAAAGGAATG. Inner Left Sequence: ATGCACATCCCACAACACAT. Inner Right Sequence: GTGGCGACTGGCTTAAAAAT. Inner Primer PCR Length: 1221 bp. Deletion Size: 736 bp. Deletion left flank: TCCTTTCAATGCGTATTTCACCATCGTTTT. Deletion right flank: AAACACGCAATGAATACGGTATCCAATGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2257 |
apd-3(ok3058) II. |
C. elegans |
W09G10.4. Homozygous. Outer Left Sequence: CGGAAAATCGAAAAATGTCC. Outer Right Sequence: AAATCACCAATTTTCGCCAC. Inner Left Sequence: TCTCAATCTCCTGTTCCCTCA. Inner Right Sequence: ATTTTCCCCCAATTTTCCAG. Inner Primer PCR Length: 1120 bp. Deletion Size: 457 bp. Deletion left flank: GCTTTGAGCATTGATTCGAGCACACCTTGT. Deletion right flank: ACGGTTACATCTTGGATCTGGAAAATTGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2258 |
F17A2.3(ok3059) X. |
C. elegans |
F17A2.3. Homozygous. Outer Left Sequence: CGGGGCCTAAATATGAGGTT. Outer Right Sequence: ACCAGTGAAGGATTTGTGGC. Inner Left Sequence: GTACACGCCACGCAGTTTTA. Inner Right Sequence: GAACAACGTGAAAGTGGCAA. Inner Primer PCR Length: 1321 bp. Deletion Size: 578 bp. Deletion left flank: AAGCAAACAAACACGGTTGGAATAGGATCC. Deletion right flank: CACTAACGACAGCCTCGACACCACAGCATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2259 |
srh-16(ok3060) V. |
C. elegans |
F55C5.9 Homozygous. Outer Left Sequence: gcaggaaatgcattgtcaaa. Outer Right Sequence: cttcaagatgagccccaaaa. Inner Left Sequence: tctgattgtgataatcgccc. Inner Right Sequence: tccgtgaacgaatgtctgaa. Inner Primer PCR Length: 1173. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2260 |
alfa-1(ok3062) II. |
C. elegans |
F18A1.6. Homozygous. Outer Left Sequence: GTCGAGACCGAACACCGTAT. Outer Right Sequence: CCACATACGATGCGCTTAAA. Inner Left Sequence: GGCAATATTTTGTGCCTGGT. Inner Right Sequence: TGCCGCTGTTAAAAGACTGA. Inner Primer PCR Length: 1259 bp. Deletion Size: 486 bp. Deletion left flank: GTCATCATTCCAAATGCATCTTCATACTTT. Deletion right flank: GTACTTGTTGTAGCAGATTCAGTCATATAT. Insertion Sequence: CAATCATCCATTGTCAATGTTTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2262 |
acr-10(ok3064) X. |
C. elegans |
R02E12.8. Homozygous. Outer Left Sequence: GACATTTGACGGTTCCGTTT. Outer Right Sequence: GCGAAATTGTGCATTTCTTG. Inner Left Sequence: CGATCCGTAACTTGGAAACAA. Inner Right Sequence: GAATTAGGAGCACACGACCA. Inner Primer PCR Length: 1151 bp. Deletion Size: 386 bp. Deletion left flank: TACTCAAGAAGATGCATAGGTTAGTCCAGC. Deletion right flank: CGCAATGGCTTTAGACAGATTATGCTTACT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2263 |
Y23B4A.2(ok3065) X. |
C. elegans |
Y23B4A.2. Homozygous. Outer Left Sequence: TCGGCATTCTGTTAGGAAGC. Outer Right Sequence: ACGGAACAGATCTCCTCGAA. Inner Left Sequence: GACCGTAATCCCGTTCACAA. Inner Right Sequence: TGTATTTTGGTAACGCGTCG. Inner Primer PCR Length: 1292 bp. Deletion Size: 598 bp. Deletion left flank: TTCCTTTTCTGTCTTTTATTAATTTCCTTT. Deletion right flank: AAAATTTTGTTTTTCAGTAACAATTCCGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2264 |
C12C8.2(ok3066) I. |
C. elegans |
C12C8.2. Homozygous. Outer Left Sequence: GATGCGGAAATCCAACAACT. Outer Right Sequence: TCAAATGCAATCATTCCAGC. Inner Left Sequence: AATGAGATAGAAGGCGGTGC. Inner Right Sequence: GCATATTGATGCTGTGGGTG. Inner Primer PCR Length: 1191 bp. Deletion Size: 491 bp. Deletion left flank: GTTTTGGAGTTGAAATAACTTCTGTTGACG. Deletion right flank: AGTAAAAGACTTTAGTAAAAAGCTTCCAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2267 |
prk-2(ok3069) III. |
C. elegans |
F45H7.4. Homozygous. Outer Left Sequence: ACGCACGAATCATGTTCAAA. Outer Right Sequence: ACCGAGCATACTGGCTTGTT. Inner Left Sequence: TCTTACCGTATTCGAAGAACTCG. Inner Right Sequence: CTGATTGTGGGTTTCAAGCA. Inner Primer PCR Length: 1347 bp. Deletion Size: 617 bp. Deletion left flank: GAGTTTTGTGGAGCCGGTGACCAAGTCGAT. Deletion right flank: ATGAGCCTTAAATTTAAGCACAAAAATATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2268 |
cah-5(ok3070) X. |
C. elegans |
R173.1. Homozygous. Outer Left Sequence: ATTTTGCGTCTTCCATTTGC. Outer Right Sequence: CAACTTATTTGCGTGGGCTT. Inner Left Sequence: GCCTCCCCATCAAACACTAC. Inner Right Sequence: TTTGATTCCAAAACACAGGG. Inner Primer PCR Length: 1243 bp. Deletion Size: 320 bp. Deletion left flank: TAACATTGAAGATTACTGTCTATTCCTTCT. Deletion right flank: TCGCGAAGGTTTAACTCTAAAAGAAGCACT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2269 |
R09A1.5(ok3071) V. |
C. elegans |
R09A1.5. Homozygous. Outer Left Sequence: CCGTAATCGTTCCGCATTAT. Outer Right Sequence: GCCGAAATGGGACACTCTAA. Inner Left Sequence: CCAGGGAGTCTCTGTTCAGC. Inner Right Sequence: CTGTAGCAATAGTTTCAGCTGTG. Inner Primer PCR Length: 1333 bp. Deletion Size: 610 bp. Deletion left flank: CGGGCTATAGGCCTAGGCCAGGCTATAGGT. Deletion right flank: GTTCCTCGATGCACCATATCTTACGCGCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2270 |
nas-7(ok3080) II. |
C. elegans |
C07D10.4. Homozygous. Outer Left Sequence: AAATGTGTTACGGTGTGCGA. Outer Right Sequence: TCGCATTCGCATAGTTTCAG. Inner Left Sequence: CTCACATTTGACTTTCGGCA. Inner Right Sequence: CTTCTCCATGCTTTTGCCAT. Inner Primer PCR Length: 1205 bp. Deletion Size: 760 bp. Deletion left flank: TAATTGTTGCATATTCCATACATCCATTAT. Deletion right flank: TTAATGAATCTGTGCTATCTGATATAACAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2271 |
Y106G6H.14(ok3081) I. |
C. elegans |
Y106G6H.14. Homozygous. Outer Left Sequence: CAGCATCCGAGTCTGACAAA. Outer Right Sequence: GACCGTCTTCGTCCATCATT. Inner Left Sequence: TTCAGCATACTCTTCTTCATTCAC. Inner Right Sequence: GCGGACCGTTGACTTTCTAT. Inner Primer PCR Length: 1296 bp. Deletion Size: 333 bp. Deletion left flank: TCAACAACGTATCCACTGCTGGCGCGTGTC. Deletion right flank: TAAAAACTGTAAAACCATGTGAATTAATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2272 |
nimk-1(ok3082) II. |
C. elegans |
F49C5.4. Homozygous. Outer Left Sequence: ATGCCCCGACCCTATAAACT. Outer Right Sequence: AGTCCCCTAGGTGGCTTGAT. Inner Left Sequence: GGTTTTGCACGGTTAAGAGC. Inner Right Sequence: TCATCAATCGCCTTCTTTTC. Inner Primer PCR Length: 1154 bp. Deletion Size: 661 bp. Deletion left flank: CACAAGTTATGAAAAATTCCAGAAAAAGTA. Deletion right flank: TTAATTTTCAGAGATACATCCTACGCCGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2273 |
C49D10.10(ok3083) II. |
C. elegans |
C49D10.10. Homozygous. Outer Left Sequence: TTTGAAATCCACACTTGGCA. Outer Right Sequence: TTTTGGCGGGAGAGAATAAA. Inner Left Sequence: AGCTCCGCAAATGACAATTC. Inner Right Sequence: TTCTCCGTTTCAAGATTTAGCA. Inner Primer PCR Length: 1256 bp. Deletion Size: 248 bp. Deletion left flank: TCAGTAGGATAATCAGATGTGATCTGAAAA. Deletion right flank: GAGCAGGTTTAATTTCCACAAATGCATCTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2274 |
clec-106&Y18D10A.23(ok3084) I. |
C. elegans |
Y18D10A.12, Y18D10A.23. Homozygous. Outer Left Sequence: ACCACGACTGGGAAGTTCAG. Outer Right Sequence: GCCTAACATCTGCCTTCTCG. Inner Left Sequence: ACTGGATTCTAGGCCCACG. Inner Right Sequence: GTTGCTCCATGCTACGTGAA. Inner Primer PCR Length: 1318 bp. Deletion Size: 719 bp. Deletion left flank: TTCTTCCGCCAACCCATACCTCGGCTGTTC. Deletion right flank: AATGCTCCGCAACAATGCAACGATCCACCC. Insertion Sequence: GCTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2275 |
flp-16(ok3085) II. |
C. elegans |
F15D4.8. Homozygous. Outer Left Sequence: TTTTCGAAGCCTGTTAGCGT. Outer Right Sequence: TTTAAGTTTCCACAGGCGCT. Inner Left Sequence: AAAGTCCTGAAAAAGAAGCAGC. Inner Right Sequence: TTGAAAACAACGGTCTCGAA. Inner Primer PCR Length: 1201 bp. Deletion Size: 548 bp. Deletion left flank: CCTAAATTTGATGAATGAGTGTGGATCCGA. Deletion right flank: CCTATAGGCATCATCCATCAAAACCCCACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2276 |
nas-19(ok3086) V. |
C. elegans |
K03B8.5. Homozygous. Outer Left Sequence: TACGTCATGTCGAGACTGGG. Outer Right Sequence: GAAAAATTCCCCACCGATTT. Inner Left Sequence: TGCTCAAGAATGAAAGCACG. Inner Right Sequence: TATTCCCCTCGATTTTTCGT. Inner Primer PCR Length: 1212 bp. Deletion Size: 785 bp. Deletion left flank: AGCCATTAATTCGTATGAATCTTGTTGTCT. Deletion right flank: GCGTAGGAAAAGAGTAGAATAATAGCTCCA. Insertion Sequence: ATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2277 |
ser-5(ok3087) I. |
C. elegans |
F16D3.7. Homozygous. Outer Left Sequence: GGATAAGTACGGGCAACGAA. Outer Right Sequence: AATGCGGAACGTTTGAACTC. Inner Left Sequence: TGGAGAACAATTACCCCCTG. Inner Right Sequence: AGATGATGGGATTGAGCATTG. Inner Primer PCR Length: 1119 bp. Deletion Size: 410 bp. Deletion left flank: ATTGTCACGAAAACAAAAGTAATATCAGTG. Deletion right flank: GAAAGACAAACGGGATGGTGGAGCATCAGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2278 |
chhy-1(ok3088) II. |
C. elegans |
T22C8.2. Homozygous. Outer Left Sequence: TCCATTGCATTTTGGAAACA. Outer Right Sequence: AGAGGAAAAAGAGGCGAAGG. Inner Left Sequence: TATCCCCATTTTGCATTTGG. Inner Right Sequence: GCCTGCACCATTTTCAGATT. Inner Primer PCR Length: 1114 bp. Deletion Size: 377 bp. Deletion left flank: AATCTTGATAATGCAATATACAGGACGTCA. Deletion right flank: GCTGCTCTTAAATGCCGAGAAAACTTATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2279 |
pde-5(ok3102) I. |
C. elegans |
C32E12.2. Homozygous. Outer Left Sequence: GTGGCTTCAACTGGAGAAGG. Outer Right Sequence: CTATGTTCCTGCCGGTTGAT. Inner Left Sequence: TCGGAGTTGTTCAAATGGTG. Inner Right Sequence: CAAATGTGTTGTTATCCAAAATGA. Inner Primer PCR Length: 1115 bp. Deletion Size: 410 bp. Deletion left flank: GAGTTGCATTGGAAGTATTGGCATATCATA. Deletion right flank: CCAAATTGGAGGTTAGATTTCCAGATTTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2280 |
skp-1(ok3103) V. |
C. elegans |
T27F2.1. Homozygous. Outer Left Sequence: ACGAGATCCTTGGTTTGGTG. Outer Right Sequence: TATCATCGTCCATTGCTCCA. Inner Left Sequence: GGACCAGTTTTCGACCAAGA. Inner Right Sequence: TCGAAGAAGGAACTGAAACCT. Inner Primer PCR Length: 1179 bp. Deletion Size: 716 bp. Deletion left flank: CCACCGCCGTACGGAAAACGGACCAGTTTT. Deletion right flank: TCTCCAACAGACTCATATTAATGAAAACTT. Insertion Sequence: TCGACCAAGAGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2281 |
lrx-1(ok3104) V. |
C. elegans |
T04H1.6. Homozygous. Outer Left Sequence: TGGAGGCTACGTTCCAAATC. Outer Right Sequence: TGAGAAGAAGGGAGGCAGAA. Inner Left Sequence: CTGTTCAGCAGCCATATCCA. Inner Right Sequence: CCACACATGAAACACCTCCA. Inner Primer PCR Length: 1313 bp. Deletion Size: 432 bp. Deletion left flank: AAGCTATTTTTATTTGTATGCTATCAATAT. Deletion right flank: GCCTCAATCCTGTATCCATGTGAGCAAACG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2282 |
Y106G6E.4(ok3105) I. |
C. elegans |
Y106G6E.4 Homozygous. Outer Left Sequence: cacctcggaaggctagaatg. Outer Right Sequence: ccgatccctgacgatatcaa. Inner Left Sequence: tcacaaaaccatttgaggaatg. Inner Right Sequence: ggcaaaacatttccatgtgc. Inner Primer PCR Length: 1244. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2283 |
lys-4(ok3106) IV. |
C. elegans |
F58B3.1. Homozygous. Outer Left Sequence: TGTTCACAATTGCGGTTTGT. Outer Right Sequence: GGGGCCCTTATGATCACTTT. Inner Left Sequence: CGCAAGAAGTTGCATGTTGA. Inner Right Sequence: TGGAATAATCAGATCATAAGGATGA. Inner Primer PCR Length: 1175 bp. Deletion Size: 601 bp. Deletion left flank: TATCTGCTTTTTGAAATGTAAAGCCATTTT. Deletion right flank: CTGGCCAAGCGAGACGTTCAATGTCAAGCC. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2284 |
tgt-1(ok3107) IV. |
C. elegans |
ZK829.6. Homozygous. [NOTE: it has been reported that ok3107 disrupts the native locus, this strain appears to also carry at least a partial duplication of the tgt-1 locus.] Outer Left Sequence: GACATCCTACCGTTTCCTGG. Outer Right Sequence: CTCCTTTGCAACACGTACCA. Inner Left Sequence: TACGGTAGGCCCGATAATGA. Inner Right Sequence: CTTGGACATCGTCCCGGT. Inner Primer PCR Length: 1172 bp. Deletion Size: 684 bp. Deletion left flank: AAAAAAATTGTGTTCGAACGTTATTTTTAT. Deletion right flank: GTTGTCAATACATGAATTACATGATCCAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2285 |
asns-2(ok3108) X. |
C. elegans |
M02D8.4. Homozygous. Outer Left Sequence: TGGATCTTGGTTCTTTTGCC. Outer Right Sequence: AAACCCATTGCGATTCAGAG. Inner Left Sequence: CTCAGATGGGAACTGCTCGT. Inner Right Sequence: GCATTTGTTCTTTGTTGCGA. Inner Primer PCR Length: 1250 bp. Deletion Size: 375 bp. Deletion left flank: TCCGTGTTGAAAGCTGATCGGAGAACAAAC. Deletion right flank: AGGTTCTTGATACCTTCCTTAAAACATATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2287 |
C09E8.2(ok3110) II. |
C. elegans |
C09E8.2 Homozygous. Outer Left Sequence: tcttctggagcagggcttta. Outer Right Sequence: ccgttgcggaaatttttagt. Inner Left Sequence: tgaacaaagttatggtactttggaa. Inner Right Sequence: tgacaacttaccccgtttttc. Inner Primer PCR Length: 1219. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2288 |
gst-8(ok3111) II. |
C. elegans |
F11G11.1. Homozygous. Outer Left Sequence: CGAATCATCATGAAAAGGCA. Outer Right Sequence: CATTTCCCACGCTTGAGTCT. Inner Left Sequence: GCGCAGTGGGAAGAGTAAAT. Inner Right Sequence: CCTTCTGCCGCAATTTTACA. Inner Primer PCR Length: 1208 bp. Deletion Size: 482 bp. Deletion left flank: TCAGATGTTTTTTTAGTTGTCATTGGCTTC. Deletion right flank: TGATCCAGCTCTTCTCGAAGAATTCCCACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 [NOTE: (06/03/2021) A user reported the original stock of RB2288 received by the CGC was heterozygous. A homozygous line was isolated and verified by PCR.] |
| RB2289 |
wht-8(ok3112) III. |
C. elegans |
Y47D3A.11. Homozygous. Outer Left Sequence: TTCCAGGTCAAAGAGCACCT. Outer Right Sequence: CCTTTGTAGCTGGCAAGTCC. Inner Left Sequence: CATCCAGGCTAAACTCCGTC. Inner Right Sequence: CAAAAGTACGCAGAAACCGA. Inner Primer PCR Length: 1206 bp. Deletion Size: 414 bp. Deletion left flank: GAGTTGTGGGTATCAGGTTCCGGATCATAC. Deletion right flank: TTTTCATTGGAACACTGTTTTACGGACTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2290 |
Y54G2A.17(ok3113) IV. |
C. elegans |
Y54G2A.17. Homozygous. Outer Left Sequence: CCAAAATGGCTTGTGAGGAT. Outer Right Sequence: ATTCCAGAATCAATCGACGG. Inner Left Sequence: ATCTGACCGGCTTGTCAATG. Inner Right Sequence: ATGAACGGACAAGACTCGCT. Inner Primer PCR Length: 1165 bp. Deletion Size: 235 bp. Deletion left flank: AAAACGCAAGATAATCGCATTGTATACTCA. Deletion right flank: TGAATTCAAAGCAAAATCGCCCATAATTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2291 |
PDB1.1(ok3114) X. |
C. elegans |
PDB1.1 Homozygous. Outer Left Sequence: tgtgttcgtttcagtctcgc. Outer Right Sequence: atgaaaaccaaaatgcgctc. Inner Left Sequence: acggaatatgctccctgatg. Inner Right Sequence: gcccacaaagaagatatgcaa. Inner Primer PCR Length: 1113. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2292 |
Y69A2AR.28(ok3115) IV. |
C. elegans |
Y69A2AR.28 Homozygous. Outer Left Sequence: gtcgtcctccatcttgaacg. Outer Right Sequence: tgttgattgttctttgggca. Inner Left Sequence: gatcgtcgagtgctgcttg. Inner Right Sequence: tgagcgtttgaaccagaaag. Inner Primer PCR Length: 1124. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2293 |
ZK632.9(ok3116) III. |
C. elegans |
ZK632.9 Homozygous. Outer Left Sequence: cgaacatttcgtcatctcca. Outer Right Sequence: cgtctgctgttgattcgcta. Inner Left Sequence: ccaataaatcctagcggacg. Inner Right Sequence: aaagaaatctctacgccacaca. Inner Primer PCR Length: 1179. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2294 |
acr-6(ok3117) I. |
C. elegans |
ZK973.5 Homozygous. Outer Left Sequence: cagcgtgagtcatagccaaa. Outer Right Sequence: aattgagtttggcaaatcgg. Inner Left Sequence: cgttcccatctggtgagttc. Inner Right Sequence: ccgatttgccgaattgttta. Inner Primer PCR Length: 1131. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2296 |
R09F10.1(ok3119) X. |
C. elegans |
R09F10.1 Homozygous. Outer Left Sequence: agcgccaccgtatttaatga. Outer Right Sequence: gttcgggaaactgggatttt. Inner Left Sequence: ccgtgtaaggctgttgatga. Inner Right Sequence: gtatttgcaagaccgcagc. Inner Primer PCR Length: 1290. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2297 |
C29F7.2(ok3120) X. |
C. elegans |
C29F7.2 Homozygous. Outer Left Sequence: ctcgatagtgctggtgcaga. Outer Right Sequence: catcttttgaaggactcgcc. Inner Left Sequence: tgactgaaactgaccactctgc. Inner Right Sequence: aagaactggagaattggccc. Inner Primer PCR Length: 1242. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2298 |
K02B9.1(ok3121) X. |
C. elegans |
K02B9.1 Homozygous. Outer Left Sequence: agagcatcggcttcagtgtt. Outer Right Sequence: aggatatcaccgacgtgagc. Inner Left Sequence: gggagcgtcacctaaaatga. Inner Right Sequence: ggaatgagaatcgggaatca. Inner Primer PCR Length: 1247. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2299 |
Y18D10A.12(ok3122) I. |
C. elegans |
Y18D10A.12 Homozygous. Outer Left Sequence: accacgactgggaagttcag. Outer Right Sequence: gcctaacatctgccttctcg. Inner Left Sequence: actggattctaggcccacg. Inner Right Sequence: gttgctccatgctacgtgaa. Inner Primer PCR Length: 1317. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2300 |
Y18D10A.12(ok3123) I. |
C. elegans |
Y18D10A.12 Homozygous. Outer Left Sequence: accacgactgggaagttcag. Outer Right Sequence: gcctaacatctgccttctcg. Inner Left Sequence: actggattctaggcccacg. Inner Right Sequence: gttgctccatgctacgtgaa. Inner Primer PCR Length: 1317. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2301 |
F32E10.2(ok3124) IV. |
C. elegans |
F32E10.2 Homozygous. Outer Left Sequence: caattaaaatgccagtgcga. Outer Right Sequence: aggtacactgcctggtggtc. Inner Left Sequence: tgtgcacgtctattcgattca. Inner Right Sequence: tttaggatgcattatggggc. Inner Primer PCR Length: 1127. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2302 |
daf-7(ok3125) III. |
C. elegans |
B0412.2 Homozygous. Maintain at 15C. Outer Left Sequence: cttccttctttccctcccac. Outer Right Sequence: ttgtgacaatcggaagtgga. Inner Left Sequence: gcttatccggatttgacgaa. Inner Right Sequence: catttcttggcgatcattcc. Inner Primer PCR Length: 1162. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2303 |
F58A6.11(ok3126) II. |
C. elegans |
F58A6.11 Homozygous. Outer Left Sequence: tgtggctggtctgggttaat. Outer Right Sequence: ttttgcaccactgctttgag. Inner Left Sequence: aagggagaagaaaacccgac. Inner Right Sequence: atgttcaatccgtgctgtca. Inner Primer PCR Length: 1200. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2304 |
arg-1(ok3127) X. |
C. elegans |
F31A9.3 Homozygous. Outer Left Sequence: acatctggttttagtgggcg. Outer Right Sequence: tacagagcatctcattgccg. Inner Left Sequence: ccattttcctgtgctccatc. Inner Right Sequence: attcccgtggataccgatct. Inner Primer PCR Length: 1120. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2305 |
F20D1.1(ok3128) X. |
C. elegans |
F20D1.1 Homozygous. Outer Left Sequence: tgcacaactcggaaatgaaa. Outer Right Sequence: aatccaaagcttatcgcgtg. Inner Left Sequence: gcttaagtgagaggaggggg. Inner Right Sequence: gcaattctcaacggttttctc. Inner Primer PCR Length: 1207. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2306 |
Y105C5A.1(ok3129) IV. |
C. elegans |
Y105C5A.1 Homozygous. Outer Left Sequence: cgctttctcctgtaactgcc. Outer Right Sequence: cgtcctgctccaacacctat. Inner Left Sequence: cgtcgtcttcttatcctgcaa. Inner Right Sequence: atggaagagcaaaagccaaa. Inner Primer PCR Length: 1224. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2307 |
D2023.6(ok3130) V. |
C. elegans |
D2023.6 Homozygous. Outer Left Sequence: tgtcaacggaggtgttttca. Outer Right Sequence: actatctgaacggcgaatgg. Inner Left Sequence: aacacatttcgggaatggaa. Inner Right Sequence: aaaaacggcagaaagaccaa. Inner Primer PCR Length: 1204. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2308 |
C29F3.5(ok3131) V. |
C. elegans |
C29F3.5 Homozygous. Outer Left Sequence: cgttcaactcaccagatcca. Outer Right Sequence: ttcgcgccaagtctaatttt. Inner Left Sequence: ctgcccagtcaaaatcacatt. Inner Right Sequence: aggagtgatggaccaattttt. Inner Primer PCR Length: 1298. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2309 |
C18D1.4(ok3134) II. |
C. elegans |
C18D1.4 Homozygous. Outer Left Sequence: tgacacgtggaatgagtggt. Outer Right Sequence: agaaaccaattgtgcatccc. Inner Left Sequence: aaaaggagaaccggctgaat. Inner Right Sequence: ggttcttcaacaaatcattggc. Inner Primer PCR Length: 1313. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2310 |
T16G12.1(ok3142) III. |
C. elegans |
T16G12.1 Homozygous. Outer Left Sequence: caacccaacttttgccaact. Outer Right Sequence: tgcttatttggatgccatga. Inner Left Sequence: ctttttgggctcagacttcg. Inner Right Sequence: ggacaactctcgactttgatga. Inner Primer PCR Length: 1326. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2311 |
R03G8.6(ok3143) X. |
C. elegans |
R03G8.6 Homozygous. Outer Left Sequence: tgacatacgactcgacccaa. Outer Right Sequence: cggttttcaattgcgttttt. Inner Left Sequence: cggtccctagtaagctccaa. Inner Right Sequence: tgttgattttgcaaccgaaa. Inner Primer PCR Length: 1289. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2312 |
F40B5.1(ok3144) X. |
C. elegans |
F40B5.1 Homozygous. Outer Left Sequence: taaatttcgagagccggatg. Outer Right Sequence: acgctttgtgcaagagtgtg. Inner Left Sequence: atggaggataacgcaaggaa. Inner Right Sequence: gaaagaggtgagcctggaga. Inner Primer PCR Length: 1192. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2313 |
F40B5.1(ok3145) X. |
C. elegans |
F40B5.1 Homozygous. Outer Left Sequence: taaatttcgagagccggatg. Outer Right Sequence: acgctttgtgcaagagtgtg. Inner Left Sequence: atggaggataacgcaaggaa. Inner Right Sequence: gaaagaggtgagcctggaga. Inner Primer PCR Length: 1192. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2314 |
Y42H9AR.1(ok3146) IV. |
C. elegans |
Y42H9AR.1 Homozygous. Outer Left Sequence: tcagtaaatcgcaggcagtg. Outer Right Sequence: gttggtgctgaagttgcaga. Inner Left Sequence: ttgtgccatctcaaaattgg. Inner Right Sequence: cgtaggatacgacggtggag. Inner Primer PCR Length: 1166. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2315 |
T27A8.1(ok3147) X. |
C. elegans |
T27A8.1 Homozygous. Outer Left Sequence: atgctaatccggcacttcac. Outer Right Sequence: atctttattgcgttggtcgg. Inner Left Sequence: aaagaaggagaagtctcgacca. Inner Right Sequence: atgccccctaattttatgcc. Inner Primer PCR Length: 1177. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2316 |
str-2(ok3148) V. |
C. elegans |
C50C10.7 Homozygous. Outer Left Sequence: tcgacctgtcaaacatcgaa. Outer Right Sequence: cgcatttgtgaacctgtttg. Inner Left Sequence: aaatcctcgtcgataacttttga . Inner Right Sequence: gcacacatatgggtctgcttt. Inner Primer PCR Length: 1212. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2317 |
T13C5.5(ok3149) X. |
C. elegans |
T13C5.5 Homozygous. Outer Left Sequence: gcgctatggttcttgaaagc. Outer Right Sequence: ccggtttgcaaggtttagtc. Inner Left Sequence: ttgtaacaaaaattgccccc. Inner Right Sequence: gatttgaatggcgatcttgag. Inner Primer PCR Length: 1279. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2318 |
Y43F8B.2(ok3150) V. |
C. elegans |
Y43F8B.2 Homozygous. Outer Left Sequence: tcacaacccggtgactgata. Outer Right Sequence: ctgtgacctttcggaccatt. Inner Left Sequence: gggtcaatagctggtgtgct. Inner Right Sequence: cacttctcctgttccccaaa. Inner Primer PCR Length: 1176. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2320 |
F07A11.4(ok3152) II. |
C. elegans |
F07A11.4. Homozygous. Outer Left Sequence: GCAGACCGAGAAGAGAAGGA. Outer Right Sequence: CAAAAATTTCATCCGGCCTA. Inner Left Sequence: CAAGGAATGGATGCAAAAGG. Inner Right Sequence: TTTCCATGCTTCATTCGACA. Inner Primer PCR Length: 1095 bp. Deletion Size: 681 bp. Deletion left flank: ACGCGCAGACCGAGAAGAGAAGGATCGAGA. Deletion right flank: CAAGGCTACACTGGTCTCCGAAACATTGGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2321 |
K02F3.6(ok3153) III. |
C. elegans |
K02F3.6 Homozygous. Outer Left Sequence: aattttgaaatttgccgcac. Outer Right Sequence: gttcaacgatgcgagatcaa. Inner Left Sequence: gttcaacgatgcgagatcaa. Inner Right Sequence: tatccatttcaacgagggga. Inner Primer PCR Length: 1282. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2322 |
K05F1.6(ok3154) II. |
C. elegans |
K05F1.6 Homozygous. Outer Left Sequence: atcaatgctcggagtgttcc. Outer Right Sequence: tccggtagtggcttctcact. Inner Left Sequence: tgtgcatggaaatcacaggt. Inner Right Sequence: ttctggtaatacgaacaccaaca. Inner Primer PCR Length: 1188. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2324 |
T05C12.1(ok3156) II. |
C. elegans |
T05C12.1 Homozygous. Outer Left Sequence: ttcccgagtatagtcccgtg. Outer Right Sequence: catgtggattgattgtccca. Inner Left Sequence: caagcaaaacggtcatcaga. Inner Right Sequence: tgctcatcttgtttctttcatttt. Inner Primer PCR Length: 1143. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2325 |
Y74C9A.5(ok3157) I. |
C. elegans |
Y74C9A.5 Homozygous. Outer Left Sequence: cgaatccttaaatcctggca. Outer Right Sequence: aattctgccaactccaatgc. Inner Left Sequence: gtggatagcaagctgccagt. Inner Right Sequence: gccgtcggaataatgtcaat. Inner Primer PCR Length: 1202. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2326 |
clec-230(ok3158) V. |
C. elegans |
C29F3.5. Homozygous. Outer Left Sequence: CGTTCAACTCACCAGATCCA. Outer Right Sequence: TTCGCGCCAAGTCTAATTTT. Inner Left Sequence: CTGCCCAGTCAAAATCACATT. Inner Right Sequence: AGGAGTGATGGACCAATTTTT. Inner Primer PCR Length: 1299 bp. Deletion Size: 367 bp. Deletion left flank: GTCAGCGGCCTTTAAGATTTCTAGCATTTG. Deletion right flank: TTGTCATTGGAGACACCGTTTTGCCAGACG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2327 |
cex-1(ok3163) II. |
C. elegans |
F56D1.6. Homozygous. Outer Left Sequence: AGCTCCTACCCCGTTCTGAC. Outer Right Sequence: ATGCTCAAGCACATCTGGTG. Inner Left Sequence: TCAGAATTTCTTGGGTTCATCA. Inner Right Sequence: TGGAAAGTGAAGGGTTTTCAG. Inner Primer PCR Length: 1173 bp. Deletion Size: 678 bp. Deletion left flank: CGCAAGGAGGAGCTATGATCATCACAAAAG. Deletion right flank: TATACCGATGGAATGAGTACATATGGATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2328 |
set-8(ok3164) X. |
C. elegans |
F02D10.7. Homozygous. Outer Left Sequence: ACGATGGATGCATGATGTGT. Outer Right Sequence: TCTCTTCCACGATTGCTGTG. Inner Left Sequence: TGTTTTACGGAAGGATTTGAAAG. Inner Right Sequence: CAATTGGGCTCACAAGACG. Inner Primer PCR Length: 1299 bp. Deletion Size: 487 bp. Deletion left flank: CACAATCAAGGAGCTCCTTTGTCATGACGA. Deletion right flank: TATGTAACAGACATTTTTATGGATACTAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2329 |
D2092.5(ok3165) I. |
C. elegans |
D2092.5. Homozygous. Outer Left Sequence: TGGCAGAATGTTGATGTGGT. Outer Right Sequence: TGGTGATAAAAAGAACGGGC. Inner Left Sequence: CAGAAGCAGTCTGAAACGGA. Inner Right Sequence: AACGAAAGGACGAGCGAATA. Inner Primer PCR Length: 1264 bp. Deletion Size: 972 bp. Deletion left flank: TGAACTCGTCGCTCCAATGATTTGATAGTG. Deletion right flank: CTGTTTCTGTTGTTTTTGTGAATTATTATT. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2330 |
PDB1.1(ok3166) X. |
C. elegans |
PDB1.1. Homozygous. Outer Left Sequence: TGTGTTCGTTTCAGTCTCGC. Outer Right Sequence: ATGAAAACCAAAATGCGCTC. Inner Left Sequence: ACGGAATATGCTCCCTGATG. Inner Right Sequence: GCCCACAAAGAAGATATGCAA. Inner Primer PCR Length: 1114 bp. Deletion Size: 343 bp. Deletion left flank: TTCGCTGAAATATCATTCATTTAGAATGTA. Deletion right flank: GATGTTACCGTAAACGCGCTATCAGAATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2331 |
bre-4(ok3167) I. |
C. elegans |
Y73E7A.7. Homozygous. Outer Left Sequence: CTCTGTCCCCCATTTTCTCA. Outer Right Sequence: TTCCATATTCGGCGATCTTC. Inner Left Sequence: AGAACCCTCCGAAAAATCGT. Inner Right Sequence: CGGAATCAGTGCACTAACAAA. Inner Primer PCR Length: 1315 bp. Deletion Size: 496 bp. Deletion left flank: TTTTTTTCAAAAATCAATAAAAGTCATCGA. Deletion right flank: AATCATTTTATATCGTGCAATTTGTGTCGG. Insertion Sequence: AGTCATCGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2332 |
try-4(ok3168) V. |
C. elegans |
F31D4.6. Homozygous. Outer Left Sequence: GGACTAACGGTTCGGACAAA. Outer Right Sequence: TTTCTCCACTGGCGCTATTC. Inner Left Sequence: CAATGGGCTCAAATGAACAA. Inner Right Sequence: TGAGTCGGGATTCCTTCTTT. Inner Primer PCR Length: 1248 bp. Deletion Size: 666 bp. Deletion left flank: CTTAATGTGTAATAGAAAAAGTGTAATATT. Deletion right flank: ACATGTTAGGGCGTGGAAGACAAATTGGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2333 |
Y106G6H.14(ok3169) I. |
C. elegans |
Y106G6H.14. Homozygous. Outer Left Sequence: CAGCATCCGAGTCTGACAAA. Outer Right Sequence: GACCGTCTTCGTCCATCATT. Inner Left Sequence: TTCAGCATACTCTTCTTCATTCAC. Inner Right Sequence: GCGGACCGTTGACTTTCTAT. Inner Primer PCR Length: 1296 bp. Deletion Size: 381 bp. Deletion left flank: GCTGTAAGTATTCACCATAATTAGCTGGAA. Deletion right flank: CCGTTTATTAGCTATTTGACAGAGAAATTT. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2334 |
T03D8.6(ok3170) V. |
C. elegans |
T03D8.6. Homozygous. Outer Left Sequence: TTTTTCGACGATTGAGCCTT. Outer Right Sequence: TACGCGCAGAAGAATTTGTG. Inner Left Sequence: CAGTCATTCTATCAATAACCCATTG. Inner Right Sequence: CGAAAATTGGAGGGTAAGCA. Inner Primer PCR Length: 1214 bp. Deletion Size: 689 bp. Deletion left flank: CTCCGTGATAGAAAAGTTGAACTGGGTTTG. Deletion right flank: AATAAACACACAGCAATTAGCTGAAAAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2335 |
ivns-1(ok3171) X. |
C. elegans |
R09A8.3. Homozygous. Outer Left Sequence: CAAAGCAACACCAAAGCAAA. Outer Right Sequence: AAAAGACGTGGCGAAAGCTA. Inner Left Sequence: GCCATTGAGACGAAGGACTG. Inner Right Sequence: GCGTCTCGTCTTCCAAACAT. Inner Primer PCR Length: 1120 bp. Deletion Size: 643 bp. Deletion left flank: GCCATGCATTGGTTTTTGGATCGAATGCTT. Deletion right flank: CTCGTTGTCCGTAAGCTGAAGGCTAAGCAC. Insertion Sequence: GA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2336 |
F13H8.9(ok3172) II. |
C. elegans |
F13H8.9. Homozygous. Outer Left Sequence: TCTCAATCGGTGATGATGGA. Outer Right Sequence: AAGGCTGCTGATGCAATTCT. Inner Left Sequence: TCTTCTTAAGACGGGGAGCA. Inner Right Sequence: GAAGCAAGAAGTCATCTCGGA. Inner Primer PCR Length: 1198 bp. Deletion Size: 754 bp. Deletion left flank: CCACACTTGATGTATTTGGAAGTCTCTGGG. Deletion right flank: GAAGTTTTGAAACTTTCTTAGCATTTCTTA. Insertion Sequence: TGCTCGATATTTGTAGTGATAATATGTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2337 |
nas-18(ok3173) V. |
C. elegans |
K03B8.3. Homozygous. Outer Left Sequence: GGAGGAGCCAACTACCGAGT. Outer Right Sequence: CAGCCGAACAATAACTGCAA. Inner Left Sequence: TTGCTTTGATTCTTCATTCAGTAA. Inner Right Sequence: CCAATGGCAATCCAGTATCC. Inner Primer PCR Length: 1190 bp. Deletion Size: 724 bp. Deletion left flank: AAGTTCTATTATATTTTGAAGTAGTGAAAT. Deletion right flank: GCATAATTATGCAATTTTCAACCAATCTAC. Insertion Sequence: TGAAGTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2338 |
T23G5.6(ok3174) III. |
C. elegans |
T23G5.6. Homozygous. Outer Left Sequence: AGAAATGGATGGAAGCAACG. Outer Right Sequence: TAGGTGAGGGAAGTGCTGCT. Inner Left Sequence: AAACATTGCCCTGCAAAAAG. Inner Right Sequence: GCGATGCGATTTAGAGCAAT. Inner Primer PCR Length: 1281 bp. Deletion Size: 891 bp. Deletion left flank: ACGTGATAAAAAGGAACAAAATGGATATGG. Deletion right flank: GATGACAAAAATATTCTACATGAGCAAAAT. Insertion Sequence: ATATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2339 |
F53H8.3(ok3175) X. |
C. elegans |
F53H8.3. Homozygous. Outer Left Sequence: GCGGTACCAGTTTCGTTCTT. Outer Right Sequence: CTCCTCCACGTCCAATCAAT. Inner Left Sequence: GCAATCAACCAGTACAAAAGTAGAA. Inner Right Sequence: GGAAATGGCGAAATTGAAAA. Inner Primer PCR Length: 1370 bp. Deletion Size: 622 bp. Deletion left flank: GAAAGGAGCAAGCACCTCACATGTTTGAGT. Deletion right flank: TGCAGAATTACGAAAATGTGAGTTTTGAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2341 |
ubc-16(ok3177) I. |
C. elegans |
Y54E5B.4. Homozygous. Outer Left Sequence: AAGTTGTCGGAATTGGTTGG. Outer Right Sequence: TTGCGATTCGAAGAGAGCTT. Inner Left Sequence: CATTGTTCAATATGCACCCAA. Inner Right Sequence: TGGCCACAAAGAAGAAAAGG. Inner Primer PCR Length: 1138 bp. Deletion Size: 551 bp. Deletion left flank: TAAACACAATTTTTTTTCAGACGACAGTGT. Deletion right flank: GTGGGCGGCAAACGATTTTCCCGGAAAAAC. Insertion Sequence: ACAGTACCCACATTTGATAATATTTCGATACAAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2342 |
adm-2(ok3178) X. |
C. elegans |
C04A11.4. Homozygous. Outer Left Sequence: GGGAGATCAAATTTCGGTGA. Outer Right Sequence: CGATTGGCGGAAATTCTAAA. Inner Left Sequence: TCCAGATTCAAAAGAGACGTTG. Inner Right Sequence: CCACTGAGCGTAGTCCACCT. Inner Primer PCR Length: 1253 bp. Deletion Size: 989 bp. Deletion left flank: CTTGATGACGTGGGTGTTCCTATACAAAAA. Deletion right flank: TTTGTATAAAAATAGAGAAAAATATCAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2343 |
try-13(ok3179) V. |
C. elegans |
F25E5.7. Homozygous. Outer Left Sequence: TTCGGCAATATGCCCTTAAC. Outer Right Sequence: CGCGGCTGAAGACTTTAGTT. Inner Left Sequence: CCTTTCCTCCAACGAAGAATC. Inner Right Sequence: TGACATTGCATACCAGGAGAA. Inner Primer PCR Length: 1222 bp. Deletion Size: 631 bp. Deletion left flank: TTTCAGTATTACGTTCAAAAAGATGGGAAA. Deletion right flank: GAACATGAACTGCAATGCGAATCCACAGAA. Insertion Sequence: AAAAAAACATTTTGATTAATTTCAGAATTTTGATAAATTTCAAAACATTTGATTAATTT CAGTATGACTCCGGAGGTAGTGCAATAAGCAACGTTTCCGGACAAAATACCGTTCTTGG AGTGTATGTAACAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2344 |
C49C3(ok3180) IV. |
C. elegans |
C49C3. Homozygous. Outer Left Sequence: TCCCTTAAAACGTGCAATGA. Outer Right Sequence: CCAAATTCCTCCTGTTTGGA. Inner Left Sequence: TCAATTCAGTGCATGCTTCA. Inner Right Sequence: CTTCTTCAGCAAACGAAGCC. Inner Primer PCR Length: 1310 bp. Deletion Size: 281 bp. Deletion left flank: AAAAAAGAAAAAGAAAGTTCGAAAATGTGT. Deletion right flank: AAAGAGTAATTTTTTCGAAATTTGAAATCG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2345 |
clec-29(ok3181) V. |
C. elegans |
T25E12.9. Homozygous. Outer Left Sequence: CTGGAGGGAGACCAAATTGA. Outer Right Sequence: ATTTTCTAGCAAGGCAGCCA. Inner Left Sequence: TGCAAATGAACCAACTCCTG. Inner Right Sequence: CTGCAAACCATGACAACTTCA. Inner Primer PCR Length: 1140 bp. Deletion Size: 549 bp. Deletion left flank: AGAGTGTCAGCACGAATCGGTTCTCGTTTC. Deletion right flank: GTGTAGATCCACCGAGGTTCATGCAAGCCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2346 |
prkl-1(ok3182) IV. |
C. elegans |
ZK381.5. Homozygous. Outer Left Sequence: TCGGGATACCCAGTAAGCAG. Outer Right Sequence: CCTCCAATTGTGCTTCTTCG. Inner Left Sequence: AATAGTCTCCCAGGGCCAAG. Inner Right Sequence: CACGTTCACAATTGTAATTCTCGT. Inner Primer PCR Length: 1264 bp. Deletion Size: 649 bp. Deletion left flank: TCCATAATAACAAGAGTTGAAAAAGCAAAT. Deletion right flank: TTTCGGGTTTAAATTGTATACCTCTGCATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2347 |
idh-2(ok3183) X. |
C. elegans |
C34F6.8. Homozygous. Outer Left Sequence: TTCAAGTTTGCAGGTCACCA. Outer Right Sequence: GGTTCCCTTCTTGGTTCCAT. Inner Left Sequence: CCCATGCAATTCTTGAGCAC. Inner Right Sequence: TTTTTCCCTCCTCGACAGTG. Inner Primer PCR Length: 1324 bp. Deletion Size: 597 bp. Deletion left flank: GAACTACGACGGAGATGTGCAAAGTGACAT. Deletion right flank: GCATTGACACTGTCGAGGAGGGAAAAATGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2348 |
idh-2(ok3184) X. |
C. elegans |
C34F6.8. Homozygous. Outer Left Sequence: TTCAAGTTTGCAGGTCACCA. Outer Right Sequence: GGTTCCCTTCTTGGTTCCAT. Inner Left Sequence: CCCATGCAATTCTTGAGCAC. Inner Right Sequence: TTTTTCCCTCCTCGACAGTG. Inner Primer PCR Length: 1324 bp. Deletion Size: 716 bp. Deletion left flank: TCCAATACGCATTGATGAAGCAATGGCCAC. Deletion right flank: CTGTGGGCAACTTTCACAACAATTAAACAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2349 |
pgp-3(ok3187) X. |
C. elegans |
ZK455.7. Homozygous. Outer Left Sequence: GCGAATGCTCTTATGGAAGG. Outer Right Sequence: TTGCAAATGAACTCGTGAGC. Inner Left Sequence: CGTTATGCGAACGACGACTA. Inner Right Sequence: ATTCGGATGTTTTCAGCGAC. Inner Primer PCR Length: 1151 bp. Deletion Size: 573 bp. Deletion left flank: CCGGTGGAATGGCAAATGAAGTAATTGCTG. Deletion right flank: CAAGCATTGGACTTTTGATGAGATTTTATA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2350 |
clec-43(ok3188) II. |
C. elegans |
R07C3.1. Homozygous. Outer Left Sequence: ATGCAAGTTATGTGTGCGGA. Outer Right Sequence: GTTATTTGGAGAGGCTGCCA. Inner Left Sequence: TTTTGTGGGCCTGAGTTTTT. Inner Right Sequence: GCCGCATTATACATTCGGATA. Inner Primer PCR Length: 1270 bp. Deletion Size: 706 bp. Deletion left flank: TCCTCAGATGGAGATTATTCCTACTACAGC. Deletion right flank: ATAAGATCTATAACTCTACTACAAATGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2352 |
C29F3.5(ok3190) V. |
C. elegans |
C29F3.5 Homozygous. Outer Left Sequence: cgttcaactcaccagatcca. Outer Right Sequence: ttcgcgccaagtctaatttt. Inner Left Sequence: ctgcccagtcaaaatcacatt. Inner Right Sequence: aggagtgatggaccaattttt. Inner Primer PCR Length: 1298. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2353 |
Y110A7A.20(ok3191) I. |
C. elegans |
Y110A7A.20 Homozygous. Outer Left Sequence: gaatcaacaaatgcagtgcg. Outer Right Sequence: tgaaaacagaaccatcgtcg. Inner Left Sequence: tccaaccaaaaattgcttca. Inner Right Sequence: aaatgctcaaaagaatcccg. Inner Primer PCR Length: 1223. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2354 |
F15D4.4(ok3200) II. |
C. elegans |
F15D4.4 Homozygous. Outer Left Sequence: ggtagatttaaagcgcgtcg. Outer Right Sequence: ttccggaaatatgcaggaag. Inner Left Sequence: agcgcgaaaaattcaatgag. Inner Right Sequence: gttcaattccggcagtttg. Inner Primer PCR Length: 1171. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2355 |
lev-1(ok3201) IV. |
C. elegans |
F09E8.7 Homozygous. Outer Left Sequence: atcgattgctcgttgagctt. Outer Right Sequence: gctcgactttctcacttcgg. Inner Left Sequence: gctcatcatccagctcatca. Inner Right Sequence: ccgtgtcgatttttcggaat. Inner Primer PCR Length: 1300. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2356 |
C24B9.9(ok3202) V. |
C. elegans |
C24B9.9 Homozygous. Outer Left Sequence: ttatttctgggctcgcattc. Outer Right Sequence: agtagttgcggctgagttcc. Inner Left Sequence: ggtcgaagtgatacctgtgga. Inner Right Sequence: tgacattttgaagcaaatcaatg. Inner Primer PCR Length: 1238. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2357 |
F41H10.6(ok3203) IV. |
C. elegans |
F41H10.6 Homozygous. Outer Left Sequence: ggggtgatttcgggtctaat. Outer Right Sequence: tccaacactcatcggattca. Inner Left Sequence: agtgaagtccgagacggaaa. Inner Right Sequence: agtatgcccaacacatccg. Inner Primer PCR Length: 1139. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2358 |
Y54G2A.25(ok3204) IV. |
C. elegans |
Y54G2A.25 Homozygous. Outer Left Sequence: gcatcgcaaacgagacataa. Outer Right Sequence: cttaggcattaggcaggcag. Inner Left Sequence: atgcgcactgtagttggtga. Inner Right Sequence: acaagtcaagcgtgtaggca. Inner Primer PCR Length: 1151. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2359 |
Y54G2A.25(ok3205) IV. |
C. elegans |
Y54G2A.25 Homozygous. Outer Left Sequence: gcatcgcaaacgagacataa. Outer Right Sequence: cttaggcattaggcaggcag. Inner Left Sequence: atgcgcactgtagttggtga. Inner Right Sequence: acaagtcaagcgtgtaggca. Inner Primer PCR Length: 1151. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2360 |
ZC477.2(ok3206) IV. |
C. elegans |
ZC477.2 Homozygous. Outer Left Sequence: agtgaatgaaggagcggaaa. Outer Right Sequence: cttgtaggcatgaaggggaa. Inner Left Sequence: tcctcgatcgattgaatgc. Inner Right Sequence: acgccggaacttctgactct. Inner Primer PCR Length: 1236. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2361 |
nas-24(ok3207) V. |
C. elegans |
F20G2.4 Homozygous. Outer Left Sequence: ggagtggttcagctggagag. Outer Right Sequence: aaaacgattgcagaaaacgg. Inner Left Sequence: atggagactggatggtgtgc. Inner Right Sequence: caatgatggttgggttgtga. Inner Primer PCR Length: 1114. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2362 |
abf-5(ok3208) X. |
C. elegans |
T22H6.5 Homozygous. Outer Left Sequence: gagatgagtcaggaccgagc. Outer Right Sequence: atcccattgcctcaccaata. Inner Left Sequence: ctgccactattgtcacaaaatct. Inner Right Sequence: gccaactctttctcagcacc. Inner Primer PCR Length: 1198. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2363 |
Y51H4A.13(ok3209) IV. |
C. elegans |
Y51H4A.13 Homozygous. Outer Left Sequence: aagccagtagatgtcgggtg. Outer Right Sequence: gccagaaccctgtgaatgat. Inner Left Sequence: tacagcgtccgacatctcac. Inner Right Sequence: tcgaattttcgacaaatcaataa. Inner Primer PCR Length: 1264. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2364 |
D2023.6(ok3210) V. |
C. elegans |
D2023.6 Homozygous. Outer Left Sequence: tgtcaacggaggtgttttca. Outer Right Sequence: actatctgaacggcgaatgg. Inner Left Sequence: aacacatttcgggaatggaa. Inner Right Sequence: aaaaacggcagaaagaccaa. Inner Primer PCR Length: 1204. Deletion size: about 700bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2365 |
vit-2(ok3211) X. |
C. elegans |
C42D8.2 Homozygous. Outer Left Sequence: atggagcacgctcttgctat. Outer Right Sequence: tgggatctttccagagatgg. Inner Left Sequence: tcacatggaaaacgaggaca. Inner Right Sequence: gctcttggttgagaagacgg. Inner Primer PCR Length: 1222. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2366 |
T12B3.4(ok3212) IV. |
C. elegans |
T12B3.4 Homozygous. Outer Left Sequence: gatggctccagaagacgttc. Outer Right Sequence: cactgaaaaatgtgcgtggt. Inner Left Sequence: tttttgttgggtccttcttttt. Inner Right Sequence: tgatatcttggcatttggga. Inner Primer PCR Length: 1166. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2367 |
srh-49(ok3217) I. |
C. elegans |
C10G11.4 Homozygous. Outer Left Sequence: caatgtccttcccaacatca. Outer Right Sequence: ttaatttttgaattcgcccg. Inner Left Sequence: caagattattatgctacaaactacacg. Inner Right Sequence: gttccagcatctctcctcgt. Inner Primer PCR Length: 1357. Deletion size: about 500bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2368 |
R03G8.6(ok3218) X. |
C. elegans |
R03G8.6 Homozygous. Outer Left Sequence: tgacatacgactcgacccaa. Outer Right Sequence: cggttttcaattgcgttttt. Inner Left Sequence: cggtccctagtaagctccaa. Inner Right Sequence: tgttgattttgcaaccgaaa. Inner Primer PCR Length: 1289. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2369 |
haf-6(ok3219) I. |
C. elegans |
Y48G8AL.11 Homozygous. Outer Left Sequence: tttgacaccacacggaaaaa. Outer Right Sequence: tcacgttaagtattcccggc. Inner Left Sequence: aaaaacctcggccaccac. Inner Right Sequence: ttcgtgtcgagaccgaacta. Inner Primer PCR Length: 1195. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2370 |
T21B6.5(ok3220) X. |
C. elegans |
T21B6.5 Homozygous. Outer Left Sequence: tgagcaatggattacaaccg. Outer Right Sequence: atgtccggagcttaatggtg. Inner Left Sequence: tgcgcggtaattggaaat. Inner Right Sequence: gagcactatcagtgggggaa. Inner Primer PCR Length: 1365. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2371 |
nhl-3(ok3223) II. |
C. elegans |
W04H10.3 Homozygous. Outer Left Sequence: cacgtagcttcgggtcattt. Outer Right Sequence: aagaaatttgcattggagcg. Inner Left Sequence: agtctagcagatccacatggc. Inner Right Sequence: gtgacgccagcacattctta. Inner Primer PCR Length: 1246. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2372 |
K06A1.5(ok3224) II. |
C. elegans |
K06A1.5 Homozygous. Outer Left Sequence: ccgcagatccagatatgaca. Outer Right Sequence: tttctcgtacgcattgcatc. Inner Left Sequence: ccgtatggccagaaaacgta. Inner Right Sequence: ttgcaagacatgtgcaatagg. Inner Primer PCR Length: 1190. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2374 |
cnc-2(ok3226) V. |
C. elegans |
R09B5.3 Homozygous. Outer Left Sequence: accactcctttggtctcgaa. Outer Right Sequence: tcgacgtcatcatttggttc. Inner Left Sequence: ttttggaagtcgaccgaaac. Inner Right Sequence: catatcagttgtgagtatcaatggaa. Inner Primer PCR Length: 1164. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2375 |
lmp-1(ok3228) X. |
C. elegans |
C03B1.12 Homozygous. Outer Left Sequence: caattttggttggagaggga. Outer Right Sequence: tcacattcaactcgcgtagc. Inner Left Sequence: cgtaaagtcatcgtacgggc. Inner Right Sequence: gctctgctctcgtagcacaa. Inner Primer PCR Length: 1217. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2376 |
R06C7.4(ok3229) I. |
C. elegans |
R06C7.4 Homozygous. Outer Left Sequence: ttcagtttgatctaccccgc. Outer Right Sequence: tggaactgatccgaatgtca. Inner Left Sequence: cacaatcgcattccaacaaa. Inner Right Sequence: tcgagaacacgacggttatg. Inner Primer PCR Length: 1239. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2377 |
R07B7.11(ok3230) V. |
C. elegans |
R07B7.11 Homozygous. Outer Left Sequence: ttggtcggaaatggaaagag. Outer Right Sequence: tctccgaaatcaaatcgtcc. Inner Left Sequence: cagtggaatgaaggctttgg. Inner Right Sequence: ttgagactgttctctttcaaattca. Inner Primer PCR Length: 1197. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2378 |
msh-6(ok3231) I. |
C. elegans |
Y47G6A.11 Homozygous. Outer Left Sequence: accgctaggattttcggatt. Outer Right Sequence: gcccctgagttgcaaaatta. Inner Left Sequence: tggtattcggtatcaggagca. Inner Right Sequence: gcctctttcctgtgcacttt. Inner Primer PCR Length: 1282. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2379 |
F55B11.1(ok3234) IV. |
C. elegans |
F55B11.1 Homozygous. Outer Left Sequence: acttgcgcacaaacattcag. Outer Right Sequence: ccaaaaagtcaatgcagggt. Inner Left Sequence: gcattgtttcatcgtttcca. Inner Right Sequence: cagtttcacgcaattgatttt. Inner Primer PCR Length: 1211. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2380 |
Y48E1B.1(ok3235) II. |
C. elegans |
Y48E1B.1 Homozygous. Outer Left Sequence: aaatttgggaaaagcccaat. Outer Right Sequence: cgggaatgttaggggaaaat. Inner Left Sequence: tgaatttccgtcatttgaagc. Inner Right Sequence: tcctttggaaaatttcgttaaaa. Inner Primer PCR Length: 1192. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2381 |
Y87G2A.12(ok3238) I. |
C. elegans |
Y87G2A.12 Homozygous. Outer Left Sequence: tggaccctctacccctttct. Outer Right Sequence: tttgctttgctcgaatgatg. Inner Left Sequence: tgaagaacaactgcacccag. Inner Right Sequence: atgtgcttcagcatcattcg. Inner Primer PCR Length: 1242. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2382 |
vit-5(ok3239) X. |
C. elegans |
C04F6.1 Homozygous. Outer Left Sequence: cattgaaaccacattggctg. Outer Right Sequence: ggttgttggaattctgcgtt. Inner Left Sequence: gctggaaccaagaacaccat. Inner Right Sequence: gaagctcgaacttggagtcg. Inner Primer PCR Length: 1272. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2383 |
F53H8.3(ok3241) X. |
C. elegans |
F53H8.3 Homozygous. Outer Left Sequence: gcggtaccagtttcgttctt. Outer Right Sequence: ctcctccacgtccaatcaat. Inner Left Sequence: gcaatcaaccagtacaaaagtagaa. Inner Right Sequence: ggaaatggcgaaattgaaaa. Inner Primer PCR Length: 1369. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2384 |
Y34B4A.8(ok3242) X. |
C. elegans |
Y34B4A.8 Homozygous. Outer Left Sequence: ttatgggggatgaagctttg. Outer Right Sequence: tggagtaccccttgatgagc. Inner Left Sequence: aaatttcagtcatttggccg. Inner Right Sequence: cgattcaaaaagaaagaatatccg. Inner Primer PCR Length: 1147. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2385 |
E03H4.8(ok3244) I. |
C. elegans |
E03H4.8 Homozygous. Outer Left Sequence: aattgtactgtgtgcggcaa. Outer Right Sequence: gccagacgggattttgtcta. Inner Left Sequence: tttcgaaatttgccgagc. Inner Right Sequence: ttttcaaactttccggtcaaa. Inner Primer PCR Length: 1283. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2386 |
C37H5.3(ok3245) V. |
C. elegans |
C37H5.3 Homozygous. Outer Left Sequence: gtagatcatctcgccccaaa. Outer Right Sequence: atatttctcgccctgccttc. Inner Left Sequence: catcagacccagaaactgcc. Inner Right Sequence: aatttgctggccaggtgtat. Inner Primer PCR Length: 1379. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2387 |
R05H5.7(ok3246) II. |
C. elegans |
R05H5.7 Homozygous. Outer Left Sequence: cgaagttttgagcttttggc. Outer Right Sequence: tcgaaaagaccgaattgctt. Inner Left Sequence: tttgattttaattgtggtaactacgg. Inner Right Sequence: ggtcacaggtgtgttgtgct. Inner Primer PCR Length: 1120. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2388 |
W04G3.1(ok3253) X. |
C. elegans |
W04G3.1 Homozygous. Outer Left Sequence: aacgcattgaaccccactta. Outer Right Sequence: agctaacccaattctcgcct. Inner Left Sequence: caccgtgccctaattactca. Inner Right Sequence: actagtgcgccctacaggag. Inner Primer PCR Length: 1191. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2389 |
grd-14(ok3254) X. |
C. elegans |
T01B10.2 Homozygous. Outer Left Sequence: tctgccacagtatttgctgc. Outer Right Sequence: gcgaatccaatgagaaggag. Inner Left Sequence: tatgatgacctcccaaagcc. Inner Right Sequence: cgctgctgaatacacaccat. Inner Primer PCR Length: 1246. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2391 |
grl-29(ok3261) V. |
C. elegans |
T24A6.18 Homozygous. Outer Left Sequence: aaggtctattcactggcgga. Outer Right Sequence: ccggccaattctaaacaaag. Inner Left Sequence: gaattgaattaggcaacgacaa. Inner Right Sequence: tgctcaataatcggaaacca. Inner Primer PCR Length: 1189. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2392 |
F39B2.1(ok3262) I. |
C. elegans |
F39B2.1 Homozygous. Outer Left Sequence: gatccatcacgccaactttt. Outer Right Sequence: aaattcggtagatttgggca. Inner Left Sequence: gcaaggacgagttcgttgat. Inner Right Sequence: tctttggatcgtcttgaatgc. Inner Primer PCR Length: 1132. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2393 |
ptr-20(ok3263) II. |
C. elegans |
Y53F4B.28 Homozygous. Outer Left Sequence: acctaagccaagccctaagc. Outer Right Sequence: gacctgagaaaatgcaaggc. Inner Left Sequence: gcctaagcctgtgcctaaaa. Inner Right Sequence: tttggacagctttaattccga. Inner Primer PCR Length: 1185. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2394 |
F39E9.4(ok3264) II. |
C. elegans |
F39E9.4 Homozygous. Outer Left Sequence: agaatcgacaccaggaaacg. Outer Right Sequence: gatgggattcaacagcgagt. Inner Left Sequence: aacattcggaagattggctc. Inner Right Sequence: tcggttgacctttgtcatca. Inner Primer PCR Length: 1335. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2395 |
F09A5.4(ok3273) X. |
C. elegans |
F09A5.4 Homozygous. Outer Left Sequence: gagttgtagaaacggggacg. Outer Right Sequence: ttagccgatgcacaaaactg. Inner Left Sequence: cagacaaattactgtttgcattga. Inner Right Sequence: acaacgcattccaaatgatg. Inner Primer PCR Length: 1276. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2396 |
F53G2.1(ok3274) II. |
C. elegans |
F53G2.1 Homozygous. Outer Left Sequence: agagaattggaacggggaat. Outer Right Sequence: tcggcttcctgacaactttt. Inner Left Sequence: agaagtctggcattgaaacga. Inner Right Sequence: tcgtcgtttcgaattgttttt. Inner Primer PCR Length: 1119. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2398 |
T01D3.2(ok3276) V. |
C. elegans |
T01D3.2 Homozygous. Outer Left Sequence: gcatcgagggaaaatgttgt. Outer Right Sequence: aaccgtcaaaatcacaagcc. Inner Left Sequence: tgaggaaacaaatgtgatcgag. Inner Right Sequence: ggcaagagcaatttctggac. Inner Primer PCR Length: 1199. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2399 |
grl-25(ok3279) III. |
C. elegans |
ZK643.8 Homozygous. Outer Left Sequence: gaggatcgtcttattccggc. Outer Right Sequence: gagaccttgctctccacagg. Inner Left Sequence: gaggagaagcatcatcgtca. Inner Right Sequence: cgagatttgacacgttgagc. Inner Primer PCR Length: 1236. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2400 |
cyn-2(ok3280) III. |
C. elegans |
ZK520.5 Homozygous. Outer Left Sequence: atggaaaatttgaacgtcgg. Outer Right Sequence: atggaaagttagttcggggg. Inner Left Sequence: tgcgaaaagaatcgatcagc. Inner Right Sequence: attccacaaacttgcatccc. Inner Primer PCR Length: 1235. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2401 |
R02E4.1(ok3286) X. |
C. elegans |
R02E4.1 Homozygous. Outer Left Sequence: ttattcagatgggtttcggc. Outer Right Sequence: ttcgcaaagttcgactcctt. Inner Left Sequence: cgctgccaaataacaacctt. Inner Right Sequence: ttcttggttgatcaaatacctttt. Inner Primer PCR Length: 1103. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2402 |
snt-5(ok3287) V. |
C. elegans |
R12A1.2 Homozygous. Outer Left Sequence: gcagtcggactatctttgcc. Outer Right Sequence: gatgcattatgagctggggt. Inner Left Sequence: gcacactaacctatcccagtcc. Inner Right Sequence: gtaattcgcgccaacaatct. Inner Primer PCR Length: 1139. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2403 |
R03G8.4(ok3288) X. |
C. elegans |
R03G8.4. Homozygous. Outer Left Sequence: tgaggattttctggacctgg. Outer Right Sequence: cagagcggtaacgagctagg. Inner Left Sequence: gcattgaatcctcatttaggc. Inner Right Sequence: ctcacggtgcaattggaaat. Inner Primer PCR Length: 1169. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2404 |
str-220(ok3289) IV. |
C. elegans |
C42D4.9 Homozygous. Outer Left Sequence: tgtaacacggcaggttcaaa. Outer Right Sequence: acattccgttttccatttgc. Inner Left Sequence: ttggcgccacttcttcttta. Inner Right Sequence: ccagactgtccaaaatccaga. Inner Primer PCR Length: 1146. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2405 |
F42D1.3(ok3290) X. |
C. elegans |
F42D1.3 Homozygous. Outer Left Sequence: tgcctctgacacaattcgac. Outer Right Sequence: aattcagttgactgccgctt. Inner Left Sequence: agtttatgggcaggtttgtga. Inner Right Sequence: ttcaaagcccaatttcaagc. Inner Primer PCR Length: 1210. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2406 |
R11E3.4(ok3291) IV. |
C. elegans |
R11E3.4 Homozygous. Outer Left Sequence: gatgtttgaaaggcttggga. Outer Right Sequence: cggtgaaactcacaggacaa. Inner Left Sequence: tcattaacatgagctactcgtcg. Inner Right Sequence: gctttccttgtgcctacacc. Inner Primer PCR Length: 1178. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2407 |
cng-1(ok3292) V. |
C. elegans |
F14H8.6 Homozygous. Outer Left Sequence: caggagggtatccccaattt. Outer Right Sequence: gctcgtcgagaaacttttgg. Inner Left Sequence: ccagagtcagtgcagaccag. Inner Right Sequence: tgttcaggcacttcgaggat. Inner Primer PCR Length: 1263. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2408 |
F18A12.6(ok3293) II. |
C. elegans |
F18A12.6 Homozygous. Outer Left Sequence: catccggcaacaaacctact. Outer Right Sequence: gttcaacttttccgtcgcat. Inner Left Sequence: gcgaagttctgggcaattta. Inner Right Sequence: tggtttccagtgcttttcag. Inner Primer PCR Length: 1237. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2409 |
F54D5.14(ok3294) II. |
C. elegans |
F54D5.14 Homozygous. Outer Left Sequence: gctgcaatcaatttgggtct. Outer Right Sequence: tggatcgatcaacgtgatgt. Inner Left Sequence: atcgaggaaacacggtgaag. Inner Right Sequence: tgtgtgagccgaatctgaaa. Inner Primer PCR Length: 1283. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2410 |
K09F5.1(ok3295) X. |
C. elegans |
K09F5.1 Homozygous. Outer Left Sequence: ctccgtcatgggaactgaat. Outer Right Sequence: catttcgccaaaagaggtgt. Inner Left Sequence: cttgacggcaggctataagg. Inner Right Sequence: agtgagccagtgtgctttga. Inner Primer PCR Length: 1324. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2412 |
ins-35(ok3297) V. |
C. elegans |
K02E2.4 Homozygous. Outer Left Sequence: tgcctcctcgcaataatctt. Outer Right Sequence: ttgccgaaaattaccgattc. Inner Left Sequence: ccaactggaaaacaccacaa. Inner Right Sequence: caatttgtccatttgccgat. Inner Primer PCR Length: 1208. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2413 |
F47G4.6(ok3298) I. |
C. elegans |
F47G4.6 Homozygous. Outer Left Sequence: ttttgcggaatcctcagttt. Outer Right Sequence: ggggtacttaccaggggtgt. Inner Left Sequence: aaacttgaaattttcggttcca. Inner Right Sequence: tcaatatttgccgagcacag. Inner Primer PCR Length: 1199. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2414 |
C56E6.6(ok3309) II. |
C. elegans |
C56E6.6 Homozygous. Outer Left Sequence: tctaattgatttcccgccag. Outer Right Sequence: cgatgttctgcgttccaata. Inner Left Sequence: aggtgttgcaatttcggaag. Inner Right Sequence: tgtcgttctaatgctggcaa. Inner Primer PCR Length: 1117. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2415 |
C44E4.6(ok3310) I. |
C. elegans |
C44E4.6 Homozygous. Outer Left Sequence: gccaaaggctaagcgtactg. Outer Right Sequence: gtttcagtcgcttcgagacc. Inner Left Sequence: ccgccgagtaatttcatctt. Inner Right Sequence: aacaattgctggcgattagg. Inner Primer PCR Length: 1354. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2416 |
hda-10(ok3311) II. |
C. elegans |
Y51H1A.5 Homozygous. Outer Left Sequence: cgccgaaaatacggtatcac. Outer Right Sequence: tttcttctggaaaatgcgct. Inner Left Sequence: gggtctcgacacgaaaattg. Inner Right Sequence: gatcttgaatgcgtggtgtg. Inner Primer PCR Length: 1312. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2417 |
F14H12.6(ok3312) X. |
C. elegans |
F14H12.6 Homozygous. Outer Left Sequence: ggaaatgccaaggcagatta. Outer Right Sequence: tccaacacgaaaatgtgagc. Inner Left Sequence: tttccgtgttttaagataagaacaaa. Inner Right Sequence: ctaaccttctgcatcctcgc. Inner Primer PCR Length: 1196. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2418 |
mec-5(ok3313) X. |
C. elegans |
E03G2.3 Homozygous. Outer Left Sequence: tagttttcgagatacgggcg. Outer Right Sequence: aaataaaaacgtgcaagcgg. Inner Left Sequence: ttgtcaaaaacggactcacg. Inner Right Sequence: tgttcccaatctccatcaca. Inner Primer PCR Length: 1126. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2419 |
Y44A6D.3(ok3314) V. |
C. elegans |
Y44A6D.3 Homozygous. Outer Left Sequence: tggacaacccgtagacacaa. Outer Right Sequence: gaaatgcatggttacggctc. Inner Left Sequence: aggtgttccaccagcacaat. Inner Right Sequence: gtcggttttcaaaatttccg. Inner Primer PCR Length: 1323. Deletion size: about 200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2420 |
C06E7.3(ok3315) IV. |
C. elegans |
C06E7.3 Homozygous. Outer Left Sequence: gtgggggctactgattttga. Outer Right Sequence: gttctcgtccgaaacgtcat. Inner Left Sequence: agctggtccttgtgatttgg. Inner Right Sequence: acgatgattcctcgaaaggt. Inner Primer PCR Length: 1141. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2421 |
R11A8.5(ok3316) IV. |
C. elegans |
R11A8.5 Homozygous. Outer Left Sequence: gccaccattcagcaattttt. Outer Right Sequence: accgatccgttgtgtttttc. Inner Left Sequence: tgaacgctgagcatccatag. Inner Right Sequence: cgcccgttttcttttaatg. Inner Primer PCR Length: 1218. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2422 |
F53A3.2(ok3317) III. |
C. elegans |
F53A3.2 Homozygous. Outer Left Sequence: acatctccgattggcgtaag. Outer Right Sequence: gaatactcagccaagcagcc. Inner Left Sequence: atttttgggcgaatttttcc. Inner Right Sequence: cgattgcagtgcactttagg. Inner Primer PCR Length: 1237. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2423 |
try-15(ok3329) I. |
C. elegans |
T21E12.3 Homozygous. Outer Left Sequence: ataccgtaatcgggtgttcg. Outer Right Sequence: catgcaacactggctcattt. Inner Left Sequence: gattcgtaacgctcgatgtg. Inner Right Sequence: tgatcagcaattgccctaga. Inner Primer PCR Length: 1340. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2424 |
Y47D3A.1(ok3330) III. |
C. elegans |
Y47D3A.1 Homozygous. Outer Left Sequence: ccactttcctgattcccaga. Outer Right Sequence: agccaacgttcgaaacaaac. Inner Left Sequence: gacgttgatggctccatttt. Inner Right Sequence: cccactttacatggtttggg. Inner Primer PCR Length: 1248. Deletion size: about 250 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2425 |
K08E4.2(ok3331) IV. |
C. elegans |
K08E4.2 Homozygous. Outer Left Sequence: aactccaatgaaaccgcaac. Outer Right Sequence: ttttctctgtgccctccagt. Inner Left Sequence: ctgcaaaatgcatagcgaaa. Inner Right Sequence: tgtttgttctgatacatggcaa. Inner Primer PCR Length: 1164. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2426 |
K09C8.2(ok3332) X. |
C. elegans |
K09C8.2 Homozygous. Outer Left Sequence: acacgaggcccactgtaatc. Outer Right Sequence: cgttcaaacacaaccacctg. Inner Left Sequence: cgtaaggaacgagggatcaa. Inner Right Sequence: cggtctccctatcttcacca. Inner Primer PCR Length: 1171. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2427 |
F13H8.11(ok3333) II. |
C. elegans |
F13H8.11 Homozygous. Outer Left Sequence: aaccaggagagcttgcaaaa. Outer Right Sequence: cttcttgaaaatggcacggt. Inner Left Sequence: ctgaaggaactcggagaaatc. Inner Right Sequence: gcgtttatggattcaatggg. Inner Primer PCR Length: 1272. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2428 |
T02C1.1(ok3334) III. |
C. elegans |
T02C1.1 Homozygous. Outer Left Sequence: tgttcttctttccctcccct. Outer Right Sequence: tcgagaatcattcaacgcaa. Inner Left Sequence: cctttcgttcttaccttccg. Inner Right Sequence: ggtaaacaaaaagtggacaatgg. Inner Primer PCR Length: 1166. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2429 |
sao-1(ok3335) V. |
C. elegans |
R10D12.14 Homozygous. Outer Left Sequence: aagagcgagatgacgaggaa. Outer Right Sequence: accatttgtccgagcaactc. Inner Left Sequence: gacatcaaaataccgacggc. Inner Right Sequence: gaacacgagaagcctgttcc. Inner Primer PCR Length: 1196. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2430 |
tig-2(ok3336) V. |
C. elegans |
F39G3.8 Homozygous. Outer Left Sequence: gagttgtggaggcggatcta. Outer Right Sequence: agtgtttccagacaggccac. Inner Left Sequence: tcagagctttagcggcaaat. Inner Right Sequence: aacaaatccgcgagctctt. Inner Primer PCR Length: 1207. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2431 |
T23G11.7(ok3337) I. |
C. elegans |
T23G11.7 Homozygous. Outer Left Sequence: aatgtctgcgaatctcccac. Outer Right Sequence: aaaagcatacggacactggg. Inner Left Sequence: atctcattttccccgctttt. Inner Right Sequence: aaaaggattgatggaataaatcaga. Inner Primer PCR Length: 1184. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2432 |
nas-21(ok3342) V. |
C. elegans |
T11F9.5 Homozygous. Outer Left Sequence: ccactttgcataatctcgca. Outer Right Sequence: catatagcccgcatccaaat. Inner Left Sequence: tccaatcagagctacgagca. Inner Right Sequence: tgattctacaatgacagctggttt. Inner Primer PCR Length: 1244. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2433 |
ZK353.8(ok3343) III. |
C. elegans |
ZK353.8 Homozygous. Outer Left Sequence: tggcccatcgtttttcttag. Outer Right Sequence: agatggccagattttcgatg. Inner Left Sequence: tcgagtcttgttgttttccg. Inner Right Sequence: ggcaacatatcgattcgtca. Inner Primer PCR Length: 1251. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2434 |
asg-2(ok3344) X. |
C. elegans |
C53B7.4 Homozygous. Outer Left Sequence: tccagaccggaggatacaag. Outer Right Sequence: atggcaaacttttgggtgac. Inner Left Sequence: tttgagcattagagtgagtttttg. Inner Right Sequence: ccagtaggcatagtggggtg. Inner Primer PCR Length: 1276. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2435 |
C24G6.3(ok3345) V. |
C. elegans |
C24G6.3 Homozygous. Outer Left Sequence: aaaattggattttggagggg. Outer Right Sequence: gccattattgccgattttct. Inner Left Sequence: tctttgacggtttttctgaatg. Inner Right Sequence: tttgaaaagttaaaaacatacagatgc. Inner Primer PCR Length: 1193. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2436 |
F59A7.9(ok3359) V. |
C. elegans |
F59A7.9 Homozygous. Outer Left Sequence: cctacacctgcctacttgcc. Outer Right Sequence: ccctacagtactccggcaga. Inner Left Sequence: ctaccaaagacgccttaccg. Inner Right Sequence: ttctccaatcaactacctccaa. Inner Primer PCR Length: 1194. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2437 |
T13B5.8(ok3360) II. |
C. elegans |
T13B5.8 Homozygous. Outer Left Sequence: tgcaaatcagctctaatgcg. Outer Right Sequence: ggtggccgagtctaaagtca. Inner Left Sequence: aagtgtttcaagtgcgctcc. Inner Right Sequence: ccagttttccgtcgattttc. Inner Primer PCR Length: 1164. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2438 |
ZK270.2(ok3361) I. |
C. elegans |
ZK270.2 Homozygous. Outer Left Sequence: catatgcaaaggtgtccacg. Outer Right Sequence: tcttcagcaaggcatctcct. Inner Left Sequence: gaagtgatgtattcctgtttcgt. Inner Right Sequence: agccttcagagaaatcgtcg. Inner Primer PCR Length: 1225. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2439 |
F13D2.2(ok3362) X. |
C. elegans |
F13D2.2 Homozygous. Outer Left Sequence: aagcgggattcgaaggtatt. Outer Right Sequence: tcaaaacgttgcttgcattc. Inner Left Sequence: tgtcacagatagggaccgaa. Inner Right Sequence: ctagttgacggtagcaacgc. Inner Primer PCR Length: 1136. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2440 |
C01B12.3(ok3363) II. |
C. elegans |
C01B12.3 Homozygous. Outer Left Sequence: aaccatttccctcatttcca. Outer Right Sequence: tcatcatcctctcccaaagg. Inner Left Sequence: tcactcgatgttgcttcttctt. Inner Right Sequence: gagaagcacttcggcaactt. Inner Primer PCR Length: 1105. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2441 |
uba-5(ok3364) I. |
C. elegans |
T03F1.1 Homozygous. Outer Left Sequence: tttaaaccgccttggaaatg. Outer Right Sequence: agtgtgatggaaggcgagag. Inner Left Sequence: gaaagaccaccctctggagtc. Inner Right Sequence: gctccgactcatttaccagc. Inner Primer PCR Length: 1112. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2442 |
C08E3.13(ok3365) II. |
C. elegans |
C08E3.13 Homozygous. Outer Left Sequence: gtcgaaaagttgccgaagtt. Outer Right Sequence: tcttcaaattaccaaggccg. Inner Left Sequence: acagccctggtgcagaacta. Inner Right Sequence: ggaaatgcgaatcccaacta. Inner Primer PCR Length: 1267. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2443 |
abf-3(ok3366) V. |
C. elegans |
F54B8.5 Homozygous. Outer Left Sequence: tgcgaaacattccacagaaa. Outer Right Sequence: agatggcagacacgaagaca. Inner Left Sequence: agtttccagaagtcatgccc. Inner Right Sequence: cacagagtacgcttgcaaaa. Inner Primer PCR Length: 1126. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2444 |
Y47G6A.3(ok3367) I. |
C. elegans |
Y47G6A.3 Homozygous. Outer Left Sequence: tggtcaagaacgtgctgaag. Outer Right Sequence: cagatcggcaattcggtaat. Inner Left Sequence: atcaaaccgtaacgggacag. Inner Right Sequence: tcagcagttatccaactccaaa. Inner Primer PCR Length: 1196. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2445 |
tmd-2(ok3368) V. |
C. elegans |
C08D8.2Homozygous. Outer Left Sequence: ttacagaggcaatgcacgag. Outer Right Sequence: aaccggggatatcatcacaa. Inner Left Sequence: ccgaattgtttcttgggatg. Inner Right Sequence: tacaatccgttgcgtcaaaa. Inner Primer PCR Length: 1182. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2446 |
C49C8.5(ok3369) IV. |
C. elegans |
C49C8.5 Homozygous. Outer Left Sequence: ttttgtgcctacccgtatcc. Outer Right Sequence: tatggccaattttcagaccc. Inner Left Sequence: gccgttgtcatcatcgtaaa. Inner Right Sequence: ttttgttactgttccagggctt. Inner Primer PCR Length: 1200. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2447 |
str-220(ok3374) IV. |
C. elegans |
C42D4.9 Homozygous. Outer Left Sequence: tgtaacacggcaggttcaaa. Outer Right Sequence: acattccgttttccatttgc. Inner Left Sequence: ttggcgccacttcttcttta. Inner Right Sequence:ccagactgtccaaaatccaga . Inner Primer PCR Length: 1146. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2448 |
ZC84.3(ok3375) III. |
C. elegans |
ZC84.3 Homozygous. Outer Left Sequence: cttgggaaaccttgtcgtgt. Outer Right Sequence: caaacatttccctttttggc. Inner Left Sequence: caaagaaagacccgtttcca. Inner Right Sequence: tgcaaatatgttccaatcaataca. Inner Primer PCR Length: 1312. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2449 |
Y58A7A.3(ok3376) V. |
C. elegans |
Y58A7A.3 Homozygous. Outer Left Sequence: gagtttgcccaagttgcatt. Outer Right Sequence: tttggaagttcggcataagg. Inner Left Sequence: ccggccatagaatttttcag. Inner Right Sequence: tggatcgaatcgaagcatct. Inner Primer PCR Length: 1240. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2450 |
T24C12.3(ok3377) X. |
C. elegans |
T24C12.3 Homozygous. Outer Left Sequence: cttatgccataccccctcaa. Outer Right Sequence: cgcaaagtgcttgatttgaa. Inner Left Sequence: tatcgcatcagaaattgcca. Inner Right Sequence: gctattggcgatgacaacaa. Inner Primer PCR Length: 1135. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2451 |
C34D1.1(ok3378) V. |
C. elegans |
C34D1.1 Homozygous. Outer Left Sequence: ctgtctgctgagcattgagc. Outer Right Sequence: gagacatgcacactagccga. Inner Left Sequence: gtctggcttgtcaccactga. Inner Right Sequence: gagagaagcaaaagggggag. Inner Primer PCR Length: 1136. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2452 |
F11A3.1(ok3391) V. |
C. elegans |
F11A3.1 Homozygous. Outer Left Sequence: tgatccaaattgggactgct. Outer Right Sequence: ggattttgtggaaagcaagc. Inner Left Sequence: gaaagctctcttgtttcttcca. Inner Right Sequence: tttgtcaaactgtgccgatt. Inner Primer PCR Length: 1276. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2453 |
cwp-2(ok3392) V. |
C. elegans |
C37H5.11 Homozygous. Outer Left Sequence: agattttgatgagcccgatg. Outer Right Sequence: acggagacgttttgtatggg. Inner Left Sequence: ctccgtttggctcatcagtt. Inner Right Sequence: atcctgccggattcattgta. Inner Primer PCR Length: 1127. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2454 |
F08C6.6(ok3393) X. |
C. elegans |
F08C6.6 Homozygous. Outer Left Sequence: cacaaattggaaagcagcaa. Outer Right Sequence: aagcaaatgcaatttgggac. Inner Left Sequence: attctccgatcctactcgca. Inner Right Sequence: ttcttttcgggtttgtgacc. Inner Primer PCR Length: 1136. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2455 |
F44D12.3(ok3394) IV. |
C. elegans |
F44D12.3 Homozygous. Outer Left Sequence: acaaataattctgcgggacg. Outer Right Sequence: acctcttccacgtcttctcg. Inner Left Sequence: tcttcaaaaactcgctgtgg. Inner Right Sequence: cacgaaaggtcactggttca. Inner Primer PCR Length: 1142. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2456 |
grd-7(ok3395) X. |
C. elegans |
F46H5.6 Homozygous. Outer Left Sequence: tccgcgaaatctgataatcc. Outer Right Sequence: cctctcccccatcttttctc. Inner Left Sequence: ttatcctgaaggtcgttcgc. Inner Right Sequence: tgccgctgaagagtacaaaa. Inner Primer PCR Length: 1138. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2457 |
F57B9.7(ok3396) III. |
C. elegans |
F57B9.7 Homozygous. Outer Left Sequence: ccggttctttgcattctcat. Outer Right Sequence: aatcgaaaattcgttgtcgg. Inner Left Sequence: gctcgtctaacgcgttttct. Inner Right Sequence: attagtaatgctcccccacg. Inner Primer PCR Length: 1227. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2458 |
C10F3.1(ok3397) V. |
C. elegans |
C10F3.1 Homozygous. Outer Left Sequence: tgtcaagacgctcgatcaac. Outer Right Sequence: tgccaaatccctttcaagac. Inner Left Sequence: cgcgttgtgtaaactcgaaa. Inner Right Sequence: gctatgcagatcccccatatt. Inner Primer PCR Length: 1266. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2459 |
F12A10.4(ok3398) II. |
C. elegans |
F12A10.4 Homozygous. Outer Left Sequence: tgtgcaatgggaaaaactga. Outer Right Sequence: attttggacgcgatagttgc. Inner Left Sequence: acgattgaggtaggcagtgg. Inner Right Sequence: tggaaggtttgcagacatga. Inner Primer PCR Length: 1278. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2460 |
srx-95(ok3399) II. |
C. elegans |
F41G3.11 Homozygous. Outer Left Sequence: tgttttgccacgtcattgtt. Outer Right Sequence: aatatcagccacgccttcat. Inner Left Sequence: cattgcccttattcttccca. Inner Right Sequence: gcacaaaatcgttttgcttca. Inner Primer PCR Length: 1301. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2461 |
nas-13(ok3400) X. |
C. elegans |
F39D8.4 Homozygous. Outer Left Sequence: ttttgggaagtggagcaatc. Outer Right Sequence: ttgtgtctgcctactgctgg. Inner Left Sequence: tgaatgcagttggagcgtag. Inner Right Sequence: ccttctccacccttcctctt. Inner Primer PCR Length: 1128. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2462 |
oct-1(ok3401) I. |
C. elegans |
F52F12.1 Homozygous. Outer Left Sequence: catatgcctcgtcctggaac. Outer Right Sequence: ggccatgttcatcagaaggt. Inner Left Sequence: tttctttaccacgaagtaagcg. Inner Right Sequence: tctgaatgtttgaaagtcgca. Inner Primer PCR Length: 1353. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2463 |
T25B6.2(ok3402) X. |
C. elegans |
T25B6.2 Homozygous. Outer Left Sequence: tgcatggatcttctcactgc. Outer Right Sequence: tctgggtacattgggctacc. Inner Left Sequence: gccatacggaactggatacg. Inner Right Sequence: aacctggttggttctgcatt. Inner Primer PCR Length: 1196. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2464 |
tax-2(ok3403) I. |
C. elegans |
F36F2.5 Homozygous. Outer Left Sequence: cgccaagaagtgaagattcc. Outer Right Sequence: acgcttgtaatgccgaaagt. Inner Left Sequence: gcaaatgcttcaaaagagcc. Inner Right Sequence: gagtccgagcaattctgaaaa. Inner Primer PCR Length: 1121. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2465 |
nas-16(ok3405) V. |
C. elegans |
K03B8.1 Homozygous. Outer Left Sequence: catatgtccagcgttccaaa. Outer Right Sequence: ggtcactttgtttttcccga. Inner Left Sequence: ggaacccgtcagaaaagaca. Inner Right Sequence: ttggatgggtccacttgatt. Inner Primer PCR Length: 1184. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2466 |
F28D1.2(ok3406) IV. |
C. elegans |
F28D1.2 Homozygous. Outer Left Sequence: cctcttctccctcctcatca. Outer Right Sequence: tcatttcactcgcacaggtc. Inner Left Sequence: ttcaacctcgtagttctcctcc. Inner Right Sequence: cgactggttgtcaccctttt. Inner Primer PCR Length: 1189. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2467 |
nas-38(ok3407) X. |
C. elegans |
F57C12.1 Homozygous. Outer Left Sequence: aaagccagaaccaaccactg. Outer Right Sequence: actcaatggcaaaagatgcc. Inner Left Sequence: caactacatatacaacggcaattc. Inner Right Sequence: ttaattcctttttccctgcatt. Inner Primer PCR Length: 1213. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2468 |
ZK909.3(ok3408) I. |
C. elegans |
ZK909.3 Homozygous. Outer Left Sequence: gtttcctttccctttttggc. Outer Right Sequence: tagggcatgaaagcttggtt. Inner Left Sequence: cttctcctctgccagcattc. Inner Right Sequence: aatttatgcagggtcccca. Inner Primer PCR Length: 1252. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2469 |
R08C7.12(ok3409) IV. |
C. elegans |
R08C7.12 Homozygous. Outer Left Sequence: aaacttccggcaaattgatg. Outer Right Sequence: aggcttaggcttaggcttgg. Inner Left Sequence: acggcagagttggcaattt. Inner Right Sequence: cagtcattctttgcgcttca. Inner Primer PCR Length: 1119. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2470 |
pde-6(ok3410) I. |
C. elegans |
Y95B8A.10 Homozygous. Outer Left Sequence: actcctcaacaatccgatgc. Outer Right Sequence: tacaaaaacacggccacaaa. Inner Left Sequence: gctgacacaatccccactct. Inner Right Sequence: cttaaagatctcggccacca. Inner Primer PCR Length: 1161. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2471 |
dsl-3(ok3411) IV. |
C. elegans |
Y41D4B.10 Homozygous. Outer Left Sequence: gcaaattcggcaaatctctt. Outer Right Sequence: atacccctttccaaaaaccg. Inner Left Sequence: ttgccgtgcttaacaaactc. Inner Right Sequence: atgaagtcacaggtgacaaaaa. Inner Primer PCR Length: 1353. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2472 |
ZK970.1(ok3412) II. |
C. elegans |
ZK970.1 Homozygous. Outer Left Sequence: acgaatcgaatggaatctgc. Outer Right Sequence: attgttttgggcaggagttg. Inner Left Sequence: ttatgtgctggaaccgaaatc. Inner Right Sequence: gcaacttcctatccttctggc. Inner Primer PCR Length: 1112. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2473 |
cpr-4(ok3413) V. |
C. elegans |
F44C4.3 Homozygous. Outer Left Sequence: agataacgagcactcccgaa. Outer Right Sequence: tcattgaagcaaaatgcgaa. Inner Left Sequence: aaaagaccatcgcaatgaag. Inner Right Sequence: ttcatgatcctatcagtccacg. Inner Primer PCR Length: 1247. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2474 |
M28.2(ok3414) II. |
C. elegans |
M28.2 Homozygous. Outer Left Sequence: actgccctggttttggtaaa. Outer Right Sequence: atcttcaattcccggttgtg. Inner Left Sequence: tccttcacctcgattgcttt. Inner Right Sequence: ccaaagttttgtaattttcttccaa. Inner Primer PCR Length: 1146. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2475 |
srx-95(ok3415) II. |
C. elegans |
F41G3.11 Homozygous. Outer Left Sequence: tgttttgccacgtcattgtt. Outer Right Sequence: aatatcagccacgccttcat. Inner Left Sequence: cattgcccttattcttccca. Inner Right Sequence: gcacaaaatcgttttgcttca. Inner Primer PCR Length: 1301. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2476 |
tig-2(ok3416) V. |
C. elegans |
F39G3.8 Homozygous. Outer Left Sequence: gagttgtggaggcggatcta. Outer Right Sequence: agtgtttccagacaggccac. Inner Left Sequence: tcagagctttagcggcaaat. Inner Right Sequence: aacaaatccgcgagctctt. Inner Primer PCR Length: 1207. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2477 |
tmd-2(ok3417) V. |
C. elegans |
C08D8.2 Homozygous. Outer Left Sequence: ttacagaggcaatgcacgag. Outer Right Sequence: aaccggggatatcatcacaa. Inner Left Sequence: ccgaattgtttcttgggatg. Inner Right Sequence: tacaatccgttgcgtcaaaa. Inner Primer PCR Length: 1182. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2478 |
F35E12.5(ok3418) V. |
C. elegans |
F35E12.5 Homozygous. Outer Left Sequence: tccatcgcaaatgattgtgt. Outer Right Sequence: taatgccgataaaagtgggc. Inner Left Sequence: tgcatcagcattatcatggaa. Inner Right Sequence: ataaaaggagcgacggacac. Inner Primer PCR Length: 1149. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2479 |
F57F5.1(ok3419) V. |
C. elegans |
F57F5.1 Homozygous. Outer Left Sequence: ccggagctagtagcgaaatg. Outer Right Sequence: caattttggaattcctccga. Inner Left Sequence: ctcttcttgtcggccttgtc. Inner Right Sequence: cctcaattccgcactcgtta. Inner Primer PCR Length: 1100. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2480 |
T02G5.3(ok3420) II. |
C. elegans |
T02G5.3 Homozygous. Outer Left Sequence: ccgaatgcctgaatatcaca. Outer Right Sequence: tcgtcctcttccacttttgg. Inner Left Sequence: tctaactatgctcggccacc. Inner Right Sequence: tccgagaccggctaccttat. Inner Primer PCR Length: 1158. Deletion size: about 500bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2481 |
Y46G5A.19(ok3421) II. |
C. elegans |
Y46G5A.19 Homozygous. Outer Left Sequence: taaaccaaattttgccgtcc. Outer Right Sequence: atgcgcctttaatgacttgc. Inner Left Sequence: tcgagttgaaaacgcgagat. Inner Right Sequence: ttgacttttgtttgctcttcttt. Inner Primer PCR Length: 1271. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2482 |
W02C12.1(ok3422) IV. |
C. elegans |
W02C12.1 Homozygous. Outer Left Sequence: gaaaacctctgcgcatcttc. Outer Right Sequence: gtcttggactgccaggtgat. Inner Left Sequence: gtgttcacggactgtgcatc. Inner Right Sequence: atgcaaagaaaagaatgccg. Inner Primer PCR Length: 1156. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2483 |
Y48A6B.8(ok3423) III. |
C. elegans |
Y48A6B.8 Homozygous. Outer Left Sequence: cggagacatcatgctcattg. Outer Right Sequence: gggacagcacagacagatca. Inner Left Sequence: gaccggttgcactgtaatga. Inner Right Sequence: aaatgggcaacgttgtgaag. Inner Primer PCR Length: 1237. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2484 |
rab-28(ok3424) IV. |
C. elegans |
Y11D7A.4 Homozygous. Outer Left Sequence: tatgaggcgtctgattgctg. Outer Right Sequence: ggccatggatggagagtaaa. Inner Left Sequence: cgatgaactgaccttaggctg. Inner Right Sequence: ggagatggagcaagtggaaa. Inner Primer PCR Length: 1145. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2485 |
Y9C9A.16(ok3440) IV. |
C. elegans |
Y9C9A.16 Homozygous. Outer Left Sequence: gtcgacagttttcaagtgcg. Outer Right Sequence: ctcgaaaacttccaagtggc. Inner Left Sequence: tgatgcagctgtttttgcat. Inner Right Sequence: tgtcggtggaggtctaatga. Inner Primer PCR Length: 1187. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2486 |
srw-100(ok3441) V. |
C. elegans |
Y46H3C.1 Homozygous. Outer Left Sequence: ggaattgagcatgtcaagca. Outer Right Sequence: gggaattcaccgaaaatcaa. Inner Left Sequence: tgccgacatacaacaagttca. Inner Right Sequence: caaatcggcaaatcggtaat. Inner Primer PCR Length: 1117. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2487 |
cca-1(ok3442) X. |
C. elegans |
C54D2.5 Homozygous. Outer Left Sequence: tgaacaactgaacaccgagg. Outer Right Sequence: tcaacggtatggctcaaaca. Inner Left Sequence: tgtgcagcaaatcagaacaa. Inner Right Sequence: gcaaggaagaagaaaagcga. Inner Primer PCR Length: 1264. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2488 |
F58G6.1(ok3443) IV. |
C. elegans |
F58G6.1 Homozygous. Outer Left Sequence: tttgataaacgctgttggca. Outer Right Sequence: ttcattgcacttttcccctc. Inner Left Sequence: cgaagaatgtgatacgactgtca. Inner Right Sequence: cgcattttcttcattcggtt. Inner Primer PCR Length: 1279. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2489 |
ins-15(ok3444) II. |
C. elegans |
F41G3.17 Homozygous. Outer Left Sequence: catccggctttcaatcattt. Outer Right Sequence: gcacatctcactgctccaaa. Inner Left Sequence: gaacggtatccttttcatcca. Inner Right Sequence: atgttctgcaccctgaaacc. Inner Primer PCR Length: 1364. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2490 |
F55D10.5(ok3450) X. |
C. elegans |
F55D10.5 Homozygous. Outer Left Sequence: aaatcaaacgcaaacgctct. Outer Right Sequence: tcggcacttcgatatgaaca. Inner Left Sequence: tttcagcggttcctgaaaat. Inner Right Sequence: cttgaatccgtgcaaataca. Inner Primer PCR Length: 1264. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2491 |
ubc-24(ok3451) II. |
C. elegans |
F49E12.4 Homozygous. Outer Left Sequence: ttttcagagcagcaggatga. Outer Right Sequence: cggtggactttttcacgaat. Inner Left Sequence: caaggatgaaaggaatttggaa. Inner Right Sequence: tgaatgtgcaaaaacccaaa. Inner Primer PCR Length: 1212. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2492 |
Y32H12A.7(ok3452) III. |
C. elegans |
Y32H12A.7 Homozygous. Outer Left Sequence: atattggagggaatcccgaa. Outer Right Sequence: aaaaatcaacgatgatgggc. Inner Left Sequence: cgttcgattttatttttagtaacca. Inner Right Sequence: tgttcaggtgagcaattttctg. Inner Primer PCR Length: 1307. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2493 |
skr-9(ok3453) IV. |
C. elegans |
C52D10.7 Homozygous. Outer Left Sequence: cgattgttgaacggcttttt. Outer Right Sequence: aagtcgaagagcacgtcgtt. Inner Left Sequence: acaactccatcgctcgaaat. Inner Right Sequence: gaagttggtatcccattcgg. Inner Primer PCR Length: 1354. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2494 |
F37C4.5(ok3454) IV. |
C. elegans |
F37C4.5 Homozygous. Outer Left Sequence: tctgtggatcttggcaactg. Outer Right Sequence: ttttcagaacctcccattcg. Inner Left Sequence: atggtgagaagcaccgagtt. Inner Right Sequence: tctcgcaattaaggcgatct. Inner Primer PCR Length: 1166. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2495 |
grl-15(ok3455) III. |
C. elegans |
Y75B8A.20 Homozygous. Outer Left Sequence: aagccgtcaaagtggtgaaa. Outer Right Sequence: agcgaaagtctcgagaaacg. Inner Left Sequence: cacctttttcatgattgcca. Inner Right Sequence: ccacaaagaggcggagtcta. Inner Primer PCR Length: 1296. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2496 |
cdr-1(ok3456) V. |
C. elegans |
F35E8.11 Homozygous. Outer Left Sequence: gaactgtccgaacttgtccc. Outer Right Sequence: tgctcgcgaattgaagtatg. Inner Left Sequence: tttctgcatgaaaatcgaga. Inner Right Sequence: aaaacgtaaaacaccacgtaaaa. Inner Primer PCR Length: 1210. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2497 |
srw-100(ok3460) V. |
C. elegans |
Y46H3C.1 Homozygous. Outer Left Sequence: ggaattgagcatgtcaagca. Outer Right Sequence: gggaattcaccgaaaatcaa. Inner Left Sequence: tgccgacatacaacaagttca. Inner Right Sequence: caaatcggcaaatcggtaat. Inner Primer PCR Length: 1117. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2498 |
nlp-17(ok3461) IV. |
C. elegans |
Y45F10A.5 Homozygous. Outer Left Sequence: agcttccggtcaggttcttt. Outer Right Sequence: aaaaggtgaacgatgaacgg. Inner Left Sequence: aaccaccacatttttggtaaaga. Inner Right Sequence: agggggtgacgtttttgagt. Inner Primer PCR Length: 1236. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2499 |
T27F2.4(ok3462) V. |
C. elegans |
T27F2.4 Homozygous. Outer Left Sequence: gactcccgtggagaatcaaa. Outer Right Sequence: tgagatcgagtttttgtgcg. Inner Left Sequence: ggtctcgacgcgactaattt. Inner Right Sequence: tgttccactcaacccatcaa. Inner Primer PCR Length: 1172. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2500 |
Y54G2A.11(ok3463) IV. |
C. elegans |
Y54G2A.11 Homozygous. Outer Left Sequence: gctgaaaattgctctcaccc. Outer Right Sequence: aactttttagctccgcctcc. Inner Left Sequence: catttgatagccgcctcaat. Inner Right Sequence: ttttctcaacacggtttctcaa. Inner Primer PCR Length: 1129. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2501 |
ZK858.6(ok3464) I. |
C. elegans |
ZK858.6 Homozygous. Outer Left Sequence: agttcgatgaacatggctcc. Outer Right Sequence: cgacaatttgccagttgcta. Inner Left Sequence: ctccagcgatgagtgaactg. Inner Right Sequence: ctgttatcaatccagcgcaa. Inner Primer PCR Length: 1327. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2502 |
F13D2.2(ok3465) X. |
C. elegans |
F13D2.2 Homozygous. Outer Left Sequence: aagcgggattcgaaggtatt. Outer Right Sequence: tcaaaacgttgcttgcattc. Inner Left Sequence: tgtcacagatagggaccgaa. Inner Right Sequence: ctagttgacggtagcaacgc. Inner Primer PCR Length: 1136. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2503 |
K02E7.11(ok3466) II. |
C. elegans |
K02E7.11 Homozygous. Outer Left Sequence: cacatatcagggcggaaatc. Outer Right Sequence: tccgtcgggtctgaaagtag. Inner Left Sequence: cgagatgaaccagagaaagttg. Inner Right Sequence: cgctttgaatcagaagactcc. Inner Primer PCR Length: 1238. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2504 |
F54A5.1(ok3467) I. |
C. elegans |
F54A5.1 Homozygous. Outer Left Sequence: atccgatcagttgctcaagg. Outer Right Sequence: gattagcagtcgatgacgca. Inner Left Sequence: tttcggcgagctggaagt. Inner Right Sequence: gaaacgacttgagggctgac. Inner Primer PCR Length: 1127. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2505 |
F21F8.6(ok3468) V. |
C. elegans |
F21F8.6 Homozygous. Outer Left Sequence: caagaatccaggaaggtcca. Outer Right Sequence: gagaagtggagaatgggcaa. Inner Left Sequence: tccaaaatccattgggaaga. Inner Right Sequence: accgtaatccttggcagcta. Inner Primer PCR Length: 1299. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2506 |
Y67D8C.8(ok3469) IV. |
C. elegans |
Y67D8C.8 Homozygous. Outer Left Sequence: acgtgtcgtcatagtgtccg. Outer Right Sequence: ttttgtcgcaaattgaccag. Inner Left Sequence: tatttggcacgcttttcaga. Inner Right Sequence: cgaaagtcagaattgacaacattt. Inner Primer PCR Length: 1283. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2507 |
herd-1(ok3470) III. |
C. elegans |
Y111B2A.3 Homozygous. Outer Left Sequence: accagccaccactcttatgg. Outer Right Sequence: gcatcttggtccagtgtcct. Inner Left Sequence: ctcaatgcctcaagaacttcg. Inner Right Sequence: tcctcaaacgccttcttcat. Inner Primer PCR Length: 1128. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2508 |
ZC328.3(ok3471) I. |
C. elegans |
ZC328.3 Homozygous. Outer Left Sequence: caattggcagctgaacttga. Outer Right Sequence: agttccatttctccacgcac. Inner Left Sequence: tgaaatccatgcagaatcca. Inner Right Sequence: gcttctactttgaaaaataacaacga. Inner Primer PCR Length: 1164. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2509 |
C38D4.8(ok3472) III. |
C. elegans |
C38D4.8 Homozygous. Outer Left Sequence: atatccgaagcagtcatcgc. Outer Right Sequence: aactcttgccgaaaaggtca. Inner Left Sequence: agggagacacgtatgcagga. Inner Right Sequence: cacttattgacacccaaaatcg. Inner Primer PCR Length: 1213. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2510 |
W08D2.5(ok3473) IV. |
C. elegans |
W08D2.5 Homozygous. Outer Left Sequence: cttaaaatttcgcggctgag. Outer Right Sequence: taaggccttccaaaagagca. Inner Left Sequence: ttttcggcttagaaaacagca. Inner Right Sequence: tggtgagctcgatgaatacg. Inner Primer PCR Length: 1324. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2511 |
F58H1.7(ok3474) V. |
C. elegans |
F58H1.7 Homozygous. Outer Left Sequence: aaagagatggtcgcactcgt. Outer Right Sequence: gagggtttatgctcacgtcg. Inner Left Sequence: caatgcagatgtgaatgcaa. Inner Right Sequence: actcgcctccacgactttc. Inner Primer PCR Length: 1194. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2512 |
T28B4.4(ok3475) X. |
C. elegans |
T28B4.4 Homozygous. Outer Left Sequence: tggaacatcaaaattgcgaa. Outer Right Sequence: tttttacgaatccgagtggg. Inner Left Sequence: tcgggtaactcagtccttcg. Inner Right Sequence: gctcaggatgcctacgattt. Inner Primer PCR Length: 1234. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2513 |
C26C6.6(ok3481) I. |
C. elegans |
C26C6.6 Homozygous. Outer Left Sequence: gcatgaaaggcggacagtat. Outer Right Sequence: ccgtagctcttctcccacag. Inner Left Sequence: tggcttattttgccctagaaa. Inner Right Sequence: tgaaagaacagaaggatgctca. Inner Primer PCR Length: 1301. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2514 |
C06A6.3(ok3482) IV. |
C. elegans |
C06A6.3 Homozygous. Outer Left Sequence: tttttgtttccgctcaaggt. Outer Right Sequence: ggtctcgacacgaccaactt. Inner Left Sequence: tatttgtcatttgaccgccc. Inner Right Sequence: ctaagtaggcatgcgccttt. Inner Primer PCR Length: 1233. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2515 |
D1054.1(ok3487) V. |
C. elegans |
D1054.1 Homozygous. Outer Left Sequence: ctcaggcagcaaactgttga. Outer Right Sequence: gcttacaatttcggagcagc. Inner Left Sequence: tgcatcactaatacccatctcg. Inner Right Sequence: ggtgcatctgcaggaagttt. Inner Primer PCR Length: 1111. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2516 |
nas-10(ok3488) X. |
C. elegans |
K09C8.3 Homozygous. Outer Left Sequence: ccacaaatgcatcgtactgc. Outer Right Sequence: aatggttgccaaaagttcca. Inner Left Sequence: aaagtgcagaatttaggcgg. Inner Right Sequence: ttagcaacttctaaaaatcaatgaaa. Inner Primer PCR Length: 1256. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2517 |
F13B12.4(ok3489) IV. |
C. elegans |
F13B12.4 Homozygous. Outer Left Sequence: gcgtcgactggtcaattttt. Outer Right Sequence: tcttcgcaatgcaaaagcta. Inner Left Sequence: agcaagcacaaaactcatgc. Inner Right Sequence: cgacaaaaaccacggattcta. Inner Primer PCR Length: 1126. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2518 |
T04D3.5(ok3494) I. |
C. elegans |
T04D3.5 Homozygous. Outer Left Sequence: gtagttgacggcaaaaccgt. Outer Right Sequence: ttcacacactctctcgctgg. Inner Left Sequence: cgttttcaatttgtttcccc. Inner Right Sequence: agagacagagaaacggagcg. Inner Primer PCR Length: 1343. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2519 |
drh-1(ok3495) IV. |
C. elegans |
F15B10.2 Homozygous. Outer Left Sequence: tcaccgatccagttgcatta. Outer Right Sequence: aacccaacagtatccctcca. Inner Left Sequence: taatgcttgttgctcatccg. Inner Right Sequence: acacgcaacgcagttttatt. Inner Primer PCR Length: 1136. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2520 |
snt-6(ok3496) II. |
C. elegans |
C08G5.4 Homozygous. Outer Left Sequence: gagaaatagacaggtgcggc. Outer Right Sequence: gttgtggcactacaaggggt. Inner Left Sequence: aaaaatcaccattttgggca. Inner Right Sequence: ccgtgcaaatttctcactca. Inner Primer PCR Length: 1165. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2521 |
Y69H2.11(ok3497) V. |
C. elegans |
Y69H2.11 Homozygous. Outer Left Sequence: tttaggattttcgtggtggg. Outer Right Sequence: catgcgaagtcagtggagaa. Inner Left Sequence: tttggattcatgattggcct. Inner Right Sequence: ctgacaccacgtgccttcta. Inner Primer PCR Length: 1182. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2522 |
Y39B6A.2(ok3498) V. |
C. elegans |
Y39B6A.2 Homozygous. Outer Left Sequence: accggaaattgtcccaaaat. Outer Right Sequence: tttatcttccagccgtggac. Inner Left Sequence: aacagatgacattgtggcga. Inner Right Sequence: attgcggcttcaaacttctg. Inner Primer PCR Length: 1129. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2523 |
Y34B4A.4(ok3499) X. |
C. elegans |
Y34B4A.4 Homozygous. Outer Left Sequence: ggtcttgccacgatttcagt. Outer Right Sequence: taaaaaccgctcaacctcca. Inner Left Sequence: agctgctgttcttgaagctg. Inner Right Sequence: gctcacattgcatcgtgtaaa. Inner Primer PCR Length: 1120. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2524 |
F53B3.5(ok3500) X. |
C. elegans |
F53B3.5 Homozygous. Outer Left Sequence: gtcgacatgatgacacaggg. Outer Right Sequence: cttcagcaaaatgggctctc. Inner Left Sequence: ggatggcatgcctacgtaat. Inner Right Sequence: gtgcatctggagcaacgagt. Inner Primer PCR Length: 1314. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2525 |
C01G10.8(ok3501) V. |
C. elegans |
C01G10.8 Homozygous. Outer Left Sequence: attctgaatgtccggtttgg. Outer Right Sequence: attggtgggtctcgattgaa. Inner Left Sequence: atccagcatttgatgtcacg. Inner Right Sequence: catagctttgagctgaataagtatgtt. Inner Primer PCR Length: 1334. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2526 |
K10B4.4(ok3502) II. |
C. elegans |
K10B4.4 Homozygous. Outer Left Sequence: cggcttctgttgaggaagag. Outer Right Sequence: attcagtttggcggtttcag. Inner Left Sequence: tgtcaaacacgcttcgaact. Inner Right Sequence: cgcaaaatgttttagggctc. Inner Primer PCR Length: 1149. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2527 |
Y39E4A.2(ok3503) III. |
C. elegans |
Y39E4A.2 Homozygous. Outer Left Sequence: cccgccaaaaattattcaga. Outer Right Sequence: accgtaatgggacagacagc. Inner Left Sequence: atttccggccaaaaattgat. Inner Right Sequence: tcagaattcagtgttaccgca. Inner Primer PCR Length: 1229. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2528 |
lys-8(ok3504) II. |
C. elegans |
C17G10.5 Homozygous. Outer Left Sequence: ctccacgagttccaccaaat. Outer Right Sequence: tcaaaatggaaaagggaacg. Inner Left Sequence: cagcttcagtgcctcaaaca. Inner Right Sequence: aaattagagccaagctcgca. Inner Primer PCR Length: 1326. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2529 |
C30F12.2(ok3505) I. |
C. elegans |
C30F12.2 Homozygous. Outer Left Sequence: cgagaactgaatcgtgggat. Outer Right Sequence: ccccaattcgctcaaaatta. Inner Left Sequence: tcattagctgcagattgtttgaa. Inner Right Sequence: tctgcaagttcaacggttttt. Inner Primer PCR Length: 1111. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2530 |
ZK455.8(ok3506) X. |
C. elegans |
ZK455.8 Homozygous. Outer Left Sequence: tttccgcagagcttggttac. Outer Right Sequence: tccctaccttcctggtgatg. Inner Left Sequence: ttgggatcaagttctcaactca. Inner Right Sequence: gacaatgcaataaccattccg. Inner Primer PCR Length: 1219. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2531 |
F59E12.3(ok3507) II. |
C. elegans |
F59E12.3 Homozygous. Outer Left Sequence: tgtttttgtgcttttcggtg. Outer Right Sequence: gttcagctcgattgtgggat. Inner Left Sequence: tgggccccaactataacatt. Inner Right Sequence: ccgaaattggcatcttgttc. Inner Primer PCR Length: 1219. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2532 |
B0252.3(ok3511) II. |
C. elegans |
B0252.3 Homozygous. Outer Left Sequence: gcatgaacagcagtctggaa. Outer Right Sequence: ctgtttccttgggcttcttg. Inner Left Sequence: ggtgaaagcattcctccaaa. Inner Right Sequence: tctcatgttctgcatttccg. Inner Primer PCR Length: 1275. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2533 |
F49B2.3(ok3512) I. |
C. elegans |
F49B2.3 Homozygous. Outer Left Sequence: ctttctcgaccaagtcgtcc. Outer Right Sequence: tacgacccgaatgctgtgta. Inner Left Sequence: aggttgggagtgggagagag. Inner Right Sequence: agaaaatcgttgatacgcgg. Inner Primer PCR Length: 1257. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2534 |
F39E9.6(ok3515) II. |
C. elegans |
F39E9.6 Homozygous. Outer Left Sequence: ggttggttctgcgattagga. Outer Right Sequence: gatgattcaagcgatgacga. Inner Left Sequence: ggttgcctcggtaaaacttg. Inner Right Sequence: tttttggcatgttgagaggc. Inner Primer PCR Length: 1220. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2535 |
K10H10.2(ok3516) II. |
C. elegans |
K10H10.2 Homozygous. Outer Left Sequence: ttactttcgaggttggaggc. Outer Right Sequence: tcgtttactcatctcgcacg. Inner Left Sequence: cccatgaaagccctacattt. Inner Right Sequence: cgctttttgttgaaaagttcg. Inner Primer PCR Length: 1235. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2536 |
F14B8.2(ok3517) X. |
C. elegans |
F14B8.2 Homozygous. Outer Left Sequence: gaagcatggggaagaaatga. Outer Right Sequence: ttgctggcagaagttgtacg. Inner Left Sequence: tttgctcattttatgctcatttt. Inner Right Sequence: gccacatttcatgtatcgca. Inner Primer PCR Length: 1113. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2537 |
T02C12.4(ok3518) III. |
C. elegans |
T02C12.4 Homozygous. Outer Left Sequence: gcgaaaggagcattcttcag. Outer Right Sequence: gaggaggaaaacgtggtgaa. Inner Left Sequence: aatttcttgatttcagccagc. Inner Right Sequence: caatggatcgaatggaacaa. Inner Primer PCR Length: 1189. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2538 |
Y44E3A.3(ok3519) I. |
C. elegans |
Y44E3A.3 Homozygous. Outer Left Sequence: tatcgctgccacaattcaaa. Outer Right Sequence: acgcgaacgctaaaattctg. Inner Left Sequence: ccgtaaatcgacacaagtgc. Inner Right Sequence: gcgtattgagcaaaagacgaa. Inner Primer PCR Length: 1206. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2539 |
puf-4(ok3520) IV. |
C. elegans |
M4.2 Homozygous. Outer Left Sequence: ttggtcctgaaggaatcgac. Outer Right Sequence: cgagtattctgagcatgcga. Inner Left Sequence: aggttacggtatctgccacg. Inner Right Sequence: caccgaacattgaaacatgg. Inner Primer PCR Length: 1306. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2540 |
C34B7.1(ok3522) I. |
C. elegans |
C34B7.1 Homozygous. Outer Left Sequence: agaatttgtagagcgtcgcc. Outer Right Sequence: caagaattccgggaagttga. Inner Left Sequence: ttcgaaaatcatgtctaattgagc. Inner Right Sequence: tggaattgcattcattggtt. Inner Primer PCR Length: 1232. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2541 |
Y39H10A.3(ok3523) V. |
C. elegans |
Y39H10A.3 Homozygous. Outer Left Sequence: agcgagaaattcacgatgct. Outer Right Sequence: ttcaaatttttcgcagtgga. Inner Left Sequence: gtgtgctccgaacgaaaagt. Inner Right Sequence: cccgtttttcgggatttt. Inner Primer PCR Length: 1157. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2542 |
ptr-18(ok3532) II. |
C. elegans |
Y38F1A.3 Homozygous. Outer Left Sequence: atttgccgaagttgcatagg. Outer Right Sequence: ttcacaaaatgcgaccatct. Inner Left Sequence: aaatcacatttttcggagctt. Inner Right Sequence: tgaagaattctggcaaatatcg. Inner Primer PCR Length: 1129. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2543 |
efa-6(ok3533) IV. |
C. elegans |
Y55D9A.1 Homozygous. Outer Left Sequence: tttgccgtcgagtttttagc. Outer Right Sequence: tggacgcaaaggatatgtca. Inner Left Sequence: tttgtagtgaaatcgcattatctttt. Inner Right Sequence: agcaaagtttcaggtcaccg. Inner Primer PCR Length: 1305. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2544 |
ins-4(ok3534) II. |
C. elegans |
ZK75.1 Homozygous. Outer Left Sequence: ccggtaccgacttggaacta. Outer Right Sequence: agaaagctgggtcgtgagac. Inner Left Sequence: caaaagcgttcactctagaaaat. Inner Right Sequence: aaaaagacaaccgtccctcc. Inner Primer PCR Length: 1111. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2545 |
Y18D10A.22(ok3535) I. |
C. elegans |
Y18D10A.22 Homozygous. Outer Left Sequence: atagttggaacgcacaaggc. Outer Right Sequence: gcaggcgcttgtaaagaaaa. Inner Left Sequence: tcgattcagttggaaaagca. Inner Right Sequence: cgatgttcatcagcttctcg. Inner Primer PCR Length: 1316. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2546 |
F56E3.3(ok3537) X. |
C. elegans |
F56E3.3 Homozygous. Outer Left Sequence: gttgactggacataccgcct. Outer Right Sequence: caatgtgatggtcacggaag. Inner Left Sequence: cctgctcgtcgtgagatgta. Inner Right Sequence: ttgaagtatggggacacagaa. Inner Primer PCR Length: 1262. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2547 |
pink-1(ok3538) II. |
C. elegans |
EEED8.9 Homozygous. Outer Left Sequence: cgcaatagactggcatgaaa. Outer Right Sequence: ttccagatatccagatgccc. Inner Left Sequence: aattccattgattccatccg. Inner Right Sequence: cacactgcacgttggtatga. Inner Primer PCR Length: 1126. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2548 |
exo-3(ok3539) I. |
C. elegans |
R09B3.1 Homozygous. Outer Left Sequence: tgaaaaatttcaattccccg. Outer Right Sequence: cgaaaagcagaagaagcacc. Inner Left Sequence: cagcttccagacgagacctt. Inner Right Sequence: ctcgcctcgatcttcacaa. Inner Primer PCR Length: 1158. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2549 |
sms-3(ok3540) III. |
C. elegans |
Y22D7AL.8 Homozygous. Outer Left Sequence: aaaatcgataaatcgccacg. Outer Right Sequence: ttttcagcctttctcccaga. Inner Left Sequence: ttgtatttatcgattttcgcca. Inner Right Sequence: cagtaccccgaggaaattca. Inner Primer PCR Length: 1211. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2550 |
ugt-23(ok3541) X. |
C. elegans |
C17G1.3 Homozygous. Outer Left Sequence: cgtgacgctttagcatttca. Outer Right Sequence: tcattgatgccgatgaagaa. Inner Left Sequence: ttgatcagcgaatattggga. Inner Right Sequence: atgcacattctcatcttgcg. Inner Primer PCR Length: 1197. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2551 |
K12D12.5(ok3542) II. |
C. elegans |
K12D12.5 Homozygous. Outer Left Sequence: aaacgaaggtggaccagttg. Outer Right Sequence: ttcttcgtgcaccttgagtg. Inner Left Sequence: aaacctctttgcgagctgaa. Inner Right Sequence: tgattcgaaattttgcagaaga. Inner Primer PCR Length: 1349. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2552 |
ins-31(ok3543) II. |
C. elegans |
T10D4.4 Homozygous. Outer Left Sequence: catgcgtgcctgctctaata. Outer Right Sequence: ccattaccatgaagatgccc. Inner Left Sequence: taaatcggccaacaggaatc. Inner Right Sequence: gatcttgctgcttctcgtca. Inner Primer PCR Length: 1206. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2553 |
ZK669.2(ok3558) II. |
C. elegans |
ZK669.2 Homozygous. Outer Left Sequence: catcgagccatgctgaaata. Outer Right Sequence: ccatccgaacttccgaacta. Inner Left Sequence: tgcaactgatcattccttga. Inner Right Sequence: tccgactgaatcagacatcg. Inner Primer PCR Length: 1347. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2554 |
exo-3(ok3559) I. |
C. elegans |
R09B3.1 Homozygous. Outer Left Sequence: tgaaaaatttcaattccccg. Outer Right Sequence: cgaaaagcagaagaagcacc. Inner Left Sequence: cagcttccagacgagacctt. Inner Right Sequence: ctcgcctcgatcttcacaa. Inner Primer PCR Length: 1158. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2555 |
R07G3.6(ok3560) II. |
C. elegans |
R07G3.6 Homozygous. Outer Left Sequence: aattggatcaattgaaggcg. Outer Right Sequence: acccaattgcccatgaacta. Inner Left Sequence: cgcaacgaggtacgtatgaa. Inner Right Sequence: gcagcgatatcaacgacaag. Inner Primer PCR Length: 1185. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2556 |
F08G12.2(ok3561) X. |
C. elegans |
F08G12.2 Homozygous. Outer Left Sequence: ccacacgagagcactgaaaa. Outer Right Sequence: caccgcattgcatttacaac. Inner Left Sequence: tgataggttcctttgggtgg. Inner Right Sequence: tccagtggaacccaacattt. Inner Primer PCR Length: 1253. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2557 |
glrx-22(ok3562) IV. |
C. elegans |
C07G1.8 Homozygous. Outer Left Sequence: acggcggaagagtgagaata. Outer Right Sequence: caccatcaacagcaacaacc. Inner Left Sequence: cgatggaaaaggacaaaagtc. Inner Right Sequence: aaattgccgaacaaccactt. Inner Primer PCR Length: 1398. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2558 |
Y18D10A.8(ok3563) I. |
C. elegans |
Y18D10A.8 Homozygous. Outer Left Sequence: ttgcagtcaaccaatttcca. Outer Right Sequence: cgcgagaaaacgtgaatttt. Inner Left Sequence: atgtcgattccacctccaaa. Inner Right Sequence: gcgtcgcattctctgaattt. Inner Primer PCR Length: 1307. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2559 |
F38E9.5(ok3564) X. |
C. elegans |
F38E9.5 Homozygous. Outer Left Sequence: gctttggactagcatccgtt. Outer Right Sequence: gtgacagacgcggaagtttt. Inner Left Sequence: tcctcctttgtaccgtaacga. Inner Right Sequence: aggtgtatcgtggcttgtca. Inner Primer PCR Length: 1132. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2560 |
F31B12.2(ok3568) X. |
C. elegans |
F31B12.2 Homozygous. Outer Left Sequence: gcggcaattattgggattta. Outer Right Sequence: tcagtggtcaaattggtgga. Inner Left Sequence: caaccgaacatcaaattctcaa. Inner Right Sequence: agttttgtggagggttgcag. Inner Primer PCR Length: 1328. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2561 |
F42H10.7(ok3569) III. |
C. elegans |
F42H10.7 Homozygous. Outer Left Sequence: gctccttcagctgctctcat. Outer Right Sequence: aaattgagcgccaagttgtt. Inner Left Sequence: gtctctatatttggccgcga. Inner Right Sequence: cccgaggagaagtacattgc. Inner Primer PCR Length: 1232. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2562 |
Y71A12B.17(ok3570) I. |
C. elegans |
Y71A12B.17 Homozygous. Outer Left Sequence: cccagactcaaaagcagagg. Outer Right Sequence: accatcggggctaaaagtct. Inner Left Sequence: tagcaaacattgctgctgct. Inner Right Sequence: caatagcctctatcacatgcttta. Inner Primer PCR Length: 1212. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2563 |
qui-1(ok3571) IV. |
C. elegans |
Y45F10B.10 Homozygous. Outer Left Sequence: gcagcaggcataaagtaggc. Outer Right Sequence: aatagccaacgtgctaaccg. Inner Left Sequence: tctcgcagggtataaaacgg. Inner Right Sequence: gagccatcaatcctcccat. Inner Primer PCR Length: 1127. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2564 |
nas-20(ok3572) V. |
C. elegans |
T11F9.3 Homozygous. Outer Left Sequence: cctgatgcatcccattcttt. Outer Right Sequence: tcattgtccatgcgtaaagc. Inner Left Sequence: tgctgatcgcataattgacc. Inner Right Sequence: tgcaaatgcgacgaataaaa. Inner Primer PCR Length: 1156. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2565 |
srbc-58(ok3573) V. |
C. elegans |
R09E12.2 Homozygous. Outer Left Sequence: ttgctggaatcgaattttcc. Outer Right Sequence: gtgtcgttctgctcatcgaa. Inner Left Sequence: caaactgccggagttgaaat. Inner Right Sequence: ggcacaacttgcttgctattc. Inner Primer PCR Length: 1189. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2566 |
T02G5.7(ok3574) II. |
C. elegans |
T02G5.7 Homozygous. Outer Left Sequence: cagtctatcgcaatgtcgga. Outer Right Sequence: ggagttgacgattcggagac. Inner Left Sequence: ccgaggatctttcgctaactt. Inner Right Sequence: tttccgaaaacgctcactg. Inner Primer PCR Length: 1134. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2567 |
Y59C2A.2(ok3575) II. |
C. elegans |
Y59C2A.2 Homozygous. Outer Left Sequence: tgacacccagatcgaccata. Outer Right Sequence: tcacgatccacttgaagcag. Inner Left Sequence: tagctttttcacatgcgtcg. Inner Right Sequence: ctcatgccgcctattttgag. Inner Primer PCR Length: 1320. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2568 |
C25G4.6(ok3576) IV. |
C. elegans |
C25G4.6 Homozygous. Outer Left Sequence: gtcttttgaatcgccaaagc. Outer Right Sequence: ggtggagcaaagcaagttgt. Inner Left Sequence: gaaccacttggtgcaactcc. Inner Right Sequence: agaggctcagtgttgtgggt. Inner Primer PCR Length: 1285. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2569 |
R02F2.4(ok3577) III. |
C. elegans |
R02F2.4 Homozygous. Outer Left Sequence: gcgagagtctcaaagatggc. Outer Right Sequence: agtttcatccgtttcgcatc. Inner Left Sequence: tctactcctccggcacttg. Inner Right Sequence: aacttgaacggcccgatac. Inner Primer PCR Length: 1176. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2570 |
aqp-11(ok3578) III. |
C. elegans |
ZK525.2 Homozygous. Outer Left Sequence: cagttttgcgtccgaatttt. Outer Right Sequence: aaaattgagcccacgacatc. Inner Left Sequence: atggaaatctcgggtcctct. Inner Right Sequence: gtgcctggtctccaacaaat. Inner Primer PCR Length: 1147. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2571 |
T22C1.6(ok3579) I. |
C. elegans |
T22C1.6 Homozygous. Outer Left Sequence: aagccaagagcaaattggaa. Outer Right Sequence: attttcttgtccgatgtggc. Inner Left Sequence: cagaggacttcaaaaggcga. Inner Right Sequence: cggcatattcttgatttgtca. Inner Primer PCR Length: 1229. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2572 |
Y38F1A.6(ok3580) II. |
C. elegans |
Y38F1A.6 Homozygous. Outer Left Sequence: gtttgcgtgtcgcgtagtaa. Outer Right Sequence: tgttggtggaggatctgtga. Inner Left Sequence: aagccggcaatatttaaacg. Inner Right Sequence: tcgacacgacgaaggctg. Inner Primer PCR Length: 1331. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2573 |
ZK6.7(ok3581) V. |
C. elegans |
ZK6.7 Homozygous. Outer Left Sequence: ccaaatggcaagagacctgt. Outer Right Sequence: ctcaaggtgtgaaggtgcaa. Inner Left Sequence: cttcatgcaacacggcct. Inner Right Sequence: agcttgatagccggacgata. Inner Primer PCR Length: 1147. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2574 |
C09G5.8(ok3582) II. |
C. elegans |
C09G5.8 Homozygous. Outer Left Sequence: ttgtttgcaacttccgtgag. Outer Right Sequence: agggtttgcggcttctattt. Inner Left Sequence: tataaccagggatttcggca. Inner Right Sequence: tttgtgtcaaaacatgaaaagc. Inner Primer PCR Length: 1282. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2575 |
flp-17(ok3587) IV. |
C. elegans |
C52D10.11 Homozygous. Outer Left Sequence: ggaaaattcacgaactggga. Outer Right Sequence: gtgccgactgaaagaagagc. Inner Left Sequence: cagggggttgtgaatttttg. Inner Right Sequence: ttttgcaagatggtgagtcg. Inner Primer PCR Length: 1301. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2576 |
K02E11.7(ok3588) V. |
C. elegans |
K02E11.7 Homozygous. Outer Left Sequence: atcgggacccacaaactaca. Outer Right Sequence: gcaaacttttcggtgcaaac. Inner Left Sequence: gcttggtgatcaattgtttgg. Inner Right Sequence: tgttgagtcagtcggaatctg. Inner Primer PCR Length: 1209. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2577 |
nft-1(ok3589) III. |
C. elegans |
Y56A3A.13 Homozygous. Outer Left Sequence: cgacttgagctacgtggaca. Outer Right Sequence: catcgcatctcttgtagcca. Inner Left Sequence: tcttcgtgaaatgcaaccag. Inner Right Sequence: tgcgaaattttgggattttg. Inner Primer PCR Length: 1134. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2578 |
pqn-41(ok3590) III. |
C. elegans |
F53A3.6 Homozygous. Outer Left Sequence: agtacccaaaaaccaagggg. Outer Right Sequence: cgtacctcgggaaattcaaa. Inner Left Sequence: gtgacggggaatttgaaaaa. Inner Right Sequence: taggggtaaaattacgcggg. Inner Primer PCR Length: 1288. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2579 |
Y53F4B.20(ok3591) II. |
C. elegans |
Y53F4B.20 Homozygous. Outer Left Sequence: aatcgatatccagcaaaccg. Outer Right Sequence: cggcaaatcggtaaacagtc. Inner Left Sequence: tccggaaaattgtggttttg. Inner Right Sequence: ggaattgaaaatttccggc. Inner Primer PCR Length: 1252. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2580 |
wdfy-2(ok3592) II. |
C. elegans |
D2013.2 Homozygous. Outer Left Sequence: atgatagatccgttcgcctg. Outer Right Sequence: cgagagtttcctggagatgc. Inner Left Sequence: tcatttcatgccagttgctc. Inner Right Sequence: tgtggaattgcaagtggagt. Inner Primer PCR Length: 1294. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2581 |
Y56A3A.29(ok3593) III. |
C. elegans |
Y56A3A.29 Homozygous. Outer Left Sequence: aatcgtctctggctctctgg. Outer Right Sequence: cggtttgcctgcaaataact. Inner Left Sequence: gagcaaacccctgaattttt. Inner Right Sequence: cgaataatttcccatttttgtga. Inner Primer PCR Length: 1166. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2582 |
tsp-1(ok3594) III. |
C. elegans |
C02F5.8 Homozygous. Outer Left Sequence: ccagcattgcaagactcaaa. Outer Right Sequence: aaggactacgccagcttgaa. Inner Left Sequence: ccttgacgtcattccgatct. Inner Right Sequence: tcaaaagtgttagcattaacgaaa. Inner Primer PCR Length: 1252. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2583 |
Y65B4BL.2(ok3595) I. |
C. elegans |
Y65B4BL.2 Homozygous. Outer Left Sequence: taaccaagattcggagacgg. Outer Right Sequence: ctgaagttcgaacagcacga. Inner Left Sequence: atgtacgtgaattccctccg. Inner Right Sequence: ttcggcctgaaaattgaaag. Inner Primer PCR Length: 1363. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2584 |
F11A6.2(ok3596) I. |
C. elegans |
F11A6.2 Homozygous. Outer Left Sequence: actaacaaatggggcagcac. Outer Right Sequence: gcgagctttgaacttttgct. Inner Left Sequence: caaaaatgttgctcccatca. Inner Right Sequence: ttttctttcagttcagcccc. Inner Primer PCR Length: 1196. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2585 |
ZK757.2(ok3597) III. |
C. elegans |
ZK757.2 Homozygous. Outer Left Sequence: acacacacacacacacacgg. Outer Right Sequence: ccaacgggaccatttatcac. Inner Left Sequence: cacaagcaaatcacttccga. Inner Right Sequence: gggggtggaatggagagtag. Inner Primer PCR Length: 1293. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2586 |
srg-4(ok3598) III. |
C. elegans |
T12A2.12 Homozygous. Outer Left Sequence: tcacaaatccggaggaaatc. Outer Right Sequence: tccaaagcattcgacagttg. Inner Left Sequence: atgctgtggcaacgcaga. Inner Right Sequence: tgcatgctggatttttgttc. Inner Primer PCR Length: 1313. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2587 |
ZK353.7(ok3608) III. |
C. elegans |
ZK353.7 Homozygous. Outer Left Sequence: gcgtgtttgcatacattcgt. Outer Right Sequence: tacaactcggagggctcact. Inner Left Sequence: aaccctcacaatcccgtaga. Inner Right Sequence: ccgtcggatttgtgtctattc. Inner Primer PCR Length: 1143. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2588 |
efk-1(ok3609) III. |
C. elegans |
F42A10.4 Homozygous. Outer Left Sequence: cctcgaattccattttcctg. Outer Right Sequence: gccaaattatgggctgaaga. Inner Left Sequence: ccaaacccattaggaaacaga. Inner Right Sequence: gcagctcgtcttacaccaca. Inner Primer PCR Length: 1206. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2589 |
daf-3(ok3610) X. |
C. elegans |
F25E2.5 Homozygous. Outer Left Sequence: ctaattgccggaatcgaaaa. Outer Right Sequence: gacacttgatggccggttac. Inner Left Sequence: cgatttgctgaatttgtgga. Inner Right Sequence: gatctttcaacgaacctacgc. Inner Primer PCR Length: 1315. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2590 |
F55H2.5(ok3611) III. |
C. elegans |
F55H2.5 Homozygous. Outer Left Sequence: cggatttcatgttcctgtca. Outer Right Sequence: tgaattccaaccctgaatcc. Inner Left Sequence: aaacacaaaaacaacaaagaattga. Inner Right Sequence: ttgttgcggaatttacatcg. Inner Primer PCR Length: 1148. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2591 |
C27D6.11(ok3612) II. |
C. elegans |
C27D6.11 Homozygous. Outer Left Sequence: aatccgtctgattggctcac. Outer Right Sequence: ctgaagagttgagcccgaag. Inner Left Sequence: ctgttgtggctatggattttg. Inner Right Sequence: tggctttcgaacgaagtctc. Inner Primer PCR Length: 1230. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2592 |
flp-17(ok3614) IV. |
C. elegans |
C52D10.11 Homozygous. Outer Left Sequence: ggaaaattcacgaactggga. Outer Right Sequence: gtgccgactgaaagaagagc. Inner Left Sequence: cagggggttgtgaatttttg. Inner Right Sequence: ttttgcaagatggtgagtcg. Inner Primer PCR Length: 1301. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2593 |
F47G4.2(ok3615) I. |
C. elegans |
F47G4.2 Homozygous. Outer Left Sequence: ggaattgagacacccgaaaa. Outer Right Sequence: gggcacaaatcaattttcca. Inner Left Sequence: ttttcggcaaattgtggttt. Inner Right Sequence: gactgcgatgtaaaggcg. Inner Primer PCR Length: 1243. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2594 |
ins-22(ok3616) III. |
C. elegans |
M04D8.2 Homozygous. Outer Left Sequence: cggccggaatctaatttttc. Outer Right Sequence: aaacgacttccaattttgcg. Inner Left Sequence: cacaatcgtcagtagggaaaaa. Inner Right Sequence: cgacacggtcagtgagaaag. Inner Primer PCR Length: 1274. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2595 |
C44B7.4(ok3617) II. |
C. elegans |
C44B7.4 Homozygous. Outer Left Sequence: cagcaagttgagacgcatgt. Outer Right Sequence: ggctgtggaaatggttatgg. Inner Left Sequence: gccattcaaaaccctcaaaa. Inner Right Sequence: cgaacaataatagaacgacgg. Inner Primer PCR Length: 1237. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2596 |
C15H11.2(ok3618) V. |
C. elegans |
C15H11.2 Homozygous. Outer Left Sequence: tcgtttcgagaccgagtacc. Outer Right Sequence: caccatttggagtgacgttg. Inner Left Sequence: tgggtccaaaattgccagt. Inner Right Sequence: atctatgagcgaatcgtcgg. Inner Primer PCR Length: 1231. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2597 |
F11A6.2(ok3619) I. |
C. elegans |
F11A6.2 Homozygous. Outer Left Sequence: actaacaaatggggcagcac. Outer Right Sequence: gcgagctttgaacttttgct. Inner Left Sequence: caaaaatgttgctcccatca. Inner Right Sequence: ttttctttcagttcagcccc. Inner Primer PCR Length: 1196. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2598 |
F46H5.3(ok3620) X. |
C. elegans |
F46H5.3 Homozygous. Outer Left Sequence: ggctcagcactttgtttgtg. Outer Right Sequence: cttcaagccactcttcgacc. Inner Left Sequence: gagaaagtaggtatacacaggagcg. Inner Right Sequence: tccaggtatcgatttgcctc. Inner Primer PCR Length: 1362. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2599 |
C08E3.4(ok3621) II. |
C. elegans |
C08E3.4 Homozygous. Outer Left Sequence: caacttgagacatggtgcgt. Outer Right Sequence: atgtctgttgctctttgcca. Inner Left Sequence: gccaagaccacattgagaca. Inner Right Sequence: tctctacgaagttctcgacaaaaa. Inner Primer PCR Length: 1155. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2600 |
hsp-12.1(ok3622) I. |
C. elegans |
T22A3.2 Homozygous. Outer Left Sequence: ttgaaaatgtttcttcgggg. Outer Right Sequence: aattacaactgactcggcgg. Inner Left Sequence: tgccagaaacttccagttca. Inner Right Sequence: gccccttcagcataacgat. Inner Primer PCR Length: 1319. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2601 |
M01G12.14(ok3623) I. |
C. elegans |
M01G12.14 Homozygous. Outer Left Sequence: aaccgattcctcatccctct. Outer Right Sequence: aggggtcacacacagacaca. Inner Left Sequence: ccacctggatctttcaccat. Inner Right Sequence: ttgattgaacgctgtgaagg. Inner Primer PCR Length: 1305. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2602 |
F01G10.1(ok3624) IV. |
C. elegans |
F01G10.1 Homozygous. Outer Left Sequence: gtggacatcccacgtcttct. Outer Right Sequence: ttgctcctgggatagtacgg. Inner Left Sequence: aagtacgatgtcgcagagcc. Inner Right Sequence: caattgagactccgacgtga. Inner Primer PCR Length: 1147. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2603 |
ftn-1(ok3625) V. |
C. elegans |
C54F6.14 Homozygous. Outer Left Sequence: atgtgtctcagatttccgcc. Outer Right Sequence: gaaccctttcgttgccaata. Inner Left Sequence: ggttgaacctttttaggaactgc. Inner Right Sequence: acagtcccggacacgtaatc. Inner Primer PCR Length: 1178. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2604 |
W02G9.4(ok3626) V. |
C. elegans |
W02G9.4 Homozygous. Outer Left Sequence: taccctgacattatccccca. Outer Right Sequence: ctaggtttcagatcgcctgc. Inner Left Sequence: ccaacccaattcctcttcaa. Inner Right Sequence: ccttagtccgctttaggtcg. Inner Primer PCR Length: 1094. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2605 |
grl-13(ok3627) V. |
C. elegans |
F32D1.4 Homozygous. Outer Left Sequence: atatgccaagcaaatctggc. Outer Right Sequence: gaaatttgtcggattcaccg. Inner Left Sequence: aaatcgaattggctgcagat. Inner Right Sequence: ccagtttcagtcgttcccat. Inner Primer PCR Length: 1107. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2606 |
T12E12.6(ok3632) IV. |
C. elegans |
T12E12.6 Homozygous. Outer Left Sequence: agatgagaaacggagagcca. Outer Right Sequence: ggggatttcttcgaatcaga. Inner Left Sequence: cgtacaacttgagcaaaaagtga. Inner Right Sequence: tgttttacccacgtaaaatgga. Inner Primer PCR Length: 1203. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2607 |
ugt-49(ok3633) V. |
C. elegans |
AC3.2 Homozygous. Outer Left Sequence: cgtgtgatggtgacaagacc. Outer Right Sequence: agaacagcaacgaacacgaa. Inner Left Sequence: acgtggcattcagtgaacaa. Inner Right Sequence: ggacaaaagcaataacatcaaga. Inner Primer PCR Length: 1279. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2608 |
M03C11.3(ok3634) III. |
C. elegans |
M03C11.3 Homozygous. Outer Left Sequence: aggtgctgttgagtcctgct. Outer Right Sequence: ttctctcctcgtccacgact. Inner Left Sequence: aaattccacaaaatccgctg. Inner Right Sequence: ccgggaacatccaaactg. Inner Primer PCR Length: 1090. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2609 |
lsm-3(ok3635) IV. |
C. elegans |
Y62E10A.12 Homozygous. Outer Left Sequence: actatgtgagccctgaacgg. Outer Right Sequence: gagatttttcaaacggcgaa. Inner Left Sequence: ggctggaaagtgaattgagc. Inner Right Sequence: cagccatgtgtcgatttatga. Inner Primer PCR Length: 1360. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2610 |
F40F12.5(ok3637) III. |
C. elegans |
F40F12.5 Homozygous. Outer Left Sequence: aaacgattccatccttgcag. Outer Right Sequence: aactggatgaggatgttccg. Inner Left Sequence: tcggacatatttccacattctc. Inner Right Sequence: gaagcacaatcattcgggat. Inner Primer PCR Length: 1234. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2612 |
hsp-12.2(ok3638) III. |
C. elegans |
C14B9.1 Homozygous. Outer Left Sequence: tttcaggtccacaacaccaa. Outer Right Sequence: aaaatcatccctcgatgtgc. Inner Left Sequence: agttcgaggtcggacttgac. Inner Right Sequence: cattattcgtgcgttgatgc. Inner Primer PCR Length: 1096. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2613 |
H06O01.2(ok2798) I. |
C. elegans |
H06O01.2 Homozygous. Outer Left Sequence: gggaagattggggaaaagaa. Outer Right Sequence: tgcacaaaaagcttgaacca. Inner Left Sequence: catcgaaaactttcggaatga. Inner Right Sequence: ggctcaccagaagcagtttt. Inner Primer PCR Length: 1197. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2614 |
Y55B1BR.2(ok3639) III. |
C. elegans |
Y55B1BR.2 Homozygous. Outer Left Sequence: gtggcgtcagagtgtctcaa. Outer Right Sequence: taatcctaaggcaaagccca. Inner Left Sequence: ggtggagagacgcagagttc. Inner Right Sequence: ccaaagcctaagcctgagc. Inner Primer PCR Length: 1323. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2615 |
syg-1(ok3640) X. |
C. elegans |
K02E10.8 Homozygous. Outer Left Sequence: gcatcacatggaagccctat. Outer Right Sequence: tcccgaagatgaccacaaat. Inner Left Sequence: tccgcaagtttccagaaaag. Inner Right Sequence: atacgcgccacaaatcaact. Inner Primer PCR Length: 1249. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2616 |
srh-174(ok3641) V. |
C. elegans |
F40D4.1 Homozygous. Outer Left Sequence: gcaattcattccgctctttc. Outer Right Sequence: tagtcgagcacatgagtggc. Inner Left Sequence: cggacagcagaagctcactt. Inner Right Sequence: acgatacggtgtatgcacga. Inner Primer PCR Length: 1133. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2617 |
Y106G6G.2(ok2830) I. |
C. elegans |
Y106G6G.2 Homozygous. Outer Left Sequence: cccatacgtactcggagcat. Outer Right Sequence: aatagctctgcaccggaaga. Inner Left Sequence: cttccagcacgaagaagcat. Inner Right Sequence: tgcaacgagaagatcgagtg. Inner Primer PCR Length: 1136. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2618 |
T27E9.4(ok3642) III. |
C. elegans |
T27E9.4 Homozygous. Outer Left Sequence: gaatgttcgcatctgacgtg. Outer Right Sequence: cgcagcgacatacacttgtt. Inner Left Sequence: attgcgaaaatccccctcta. Inner Right Sequence: aatctttaaaggcgcacacg. Inner Primer PCR Length: 1148. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2619 |
K01A2.11(ok3646) II. |
C. elegans |
K01A2.11 Homozygous. Outer Left Sequence: ccgtccaaatcgaattccta. Outer Right Sequence: agacgaagagttcggggaat. Inner Left Sequence: tcccagctatgggagcttta. Inner Right Sequence: taccatgtcacgcgatgttt. Inner Primer PCR Length: 1123. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2620 |
daf-14(ok3647) IV. |
C. elegans |
F01G10.8 Homozygous. Outer Left Sequence:ccaaccgacttccttgttgt . Outer Right Sequence: attcgttcatcagccacctc. Inner Left Sequence: ggctgcggggaattatatgt. Inner Right Sequence: tccgagagccaatgttttct. Inner Primer PCR Length: 1192. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2622 |
gcy-27(ok3653) IV. |
C. elegans |
C06A12.4 Homozygous. Outer Left Sequence: tcgccttgtttactgcctct. Outer Right Sequence: cgctactgcgaacgagtttt. Inner Left Sequence: ctggttggcagttttccagt. Inner Right Sequence: aaacgtttttgttccctttgaa. Inner Primer PCR Length: 1277. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2623 |
F39B2.7(ok3674) I. |
C. elegans |
F39B2.7 Homozygous. Outer Left Sequence: acgttttgacagaaatcggg. Outer Right Sequence: tgacgtcattgaggcagaag. Inner Left Sequence: ggcactggaaaagagacaaga. Inner Right Sequence: acgtgctcaaaaacgaatcc. Inner Primer PCR Length: 1228. Estimated Deletion Size: about 200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2624 |
Y105C5B.12(ok3675) IV. |
C. elegans |
Y105C5B.12 Homozygous. Outer Left Sequence: cattgtgtccaaagtgtccg. Outer Right Sequence: ctgatttctggctctacggg. Inner Left Sequence: gcggttggttcataaattgg. Inner Right Sequence: ggtgagatcacctcgaaagc. Inner Primer PCR Length: 1118. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2625 |
F40F12.7(ok3684) III. |
C. elegans |
F40F12.7 Homozygous. Outer Left Sequence: aggcaaaccataagcctgaa. Outer Right Sequence: catctttgattttcccgcat. Inner Left Sequence: tggtttttgcattttcaacc. Inner Right Sequence: aaaacactggatccgcattg. Inner Primer PCR Length: 1232. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2626 |
R03A10.6(ok3685) X. |
C. elegans |
R03A10.6 Homozygous. Outer Left Sequence: gtcggacgcacagctaagtt. Outer Right Sequence: ggccccaaactacaaacaaa. Inner Left Sequence: gtccgacaatttttgggttc. Inner Right Sequence: aagcatgctccttcttctcg. Inner Primer PCR Length: 1179. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2627 |
srg-69(ok3686) II. |
C. elegans |
F09E5.4 Homozygous. Outer Left Sequence: acatgttgtgcagcattggt. Outer Right Sequence: gcaaagatatcgtggctggt. Inner Left Sequence: gcgacctacggcaaaattag. Inner Right Sequence: gcaacagaaaccattctagcac. Inner Primer PCR Length: 1264. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2628 |
Y73B3B.2(ok3687) X. |
C. elegans |
Y73B3B.2 Homozygous. Outer Left Sequence: tgaaaacgtgctcgtacacc. Outer Right Sequence: atgactacggtagatggcgg. Inner Left Sequence: tcgtgcaaagtttgagcatt. Inner Right Sequence: ggaccgaaacatttttgcat. Inner Primer PCR Length: 1130. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2629 |
Y46G5A.35(ok3697) II. |
C. elegans |
Y46G5A.35 Homozygous. Outer Left Sequence: cttcaggaatcggtttcagc. Outer Right Sequence: agaagccgaagagaaaagcc. Inner Left Sequence: taatctcctcctcagccgtc. Inner Right Sequence: cacatgaagcgtcttcggta. Inner Primer PCR Length: 1314. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB503 |
sng-1(ok234) X. |
C. elegans |
T08A9.3. Homozygous. Outer Left Sequence: AATTTCCAACGACGTTTTCG. Outer Right Sequence: ATGGGTTTGATGGTGGTTGT. Inner Left Sequence: AATGCATGCCCTGTACATCA. Inner Right Sequence: GCAGCACCAGATTGGTATGA. Inner primer WT PCR product: 3359. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB509 |
F54D7.3(ok238) I. |
C. elegans |
F54D7.3 Homozygous. Outer Left Sequence: CATAATCCCCTGAACCCCTT. Outer Right Sequence: CACCTGCTAACATTCGCTGA. Inner Left Sequence: TCAATCAGTGCACCTTTTCG. Inner Right Sequence: CGAATATCCTTCGGAATCCA. Inner Primer PCR Length: 3269. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB511 |
T05A7.11&fut-5(ok242) II. |
C. elegans |
T05A7.11, T05A7.10. Homozygous. Outer Left Sequence: CAACATGTTCGGGAGTGATG. Outer Right Sequence: GCCACTCCATTTTTCGATGT. Inner Left Sequence: ACAGCAATGTCAAGCATTCG. Inner Right Sequence: ACGGGATATCAATGAGACGG. Inner Primer PCR Length: 3185 bp. Deletion Size: 1882 bp. Deletion left flank: TCGTAACTCCTTCATCATCTGGTTTCAAAT. Deletion right flank: ATGGAATATCATATCGTCGATTTTTATTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB512 |
D2030.5(ok243) I. |
C. elegans |
D2030.5 Homozygous. Outer Left Sequence: gcttcaacttccactgctcc. Outer Right Sequence: tctcaagcacattggtctcg. Inner Left Sequence: ccaagtagccttcatctcgc. Inner Right Sequence: cccatgtgcgtaaggaattt. Inner Length: 3121. Estimated Deletion Size: 1621. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB515 |
tag-10(ok246) II. |
C. elegans |
C31C9.1. Homozygous. Outer Left Sequence: AATGTGCTAATCCGCAAACC. Outer Right Sequence: TAATCATTTTCCAGCCCTCG. Inner Left Sequence: CCTGGGATATTTTCGCAGAC. Inner Right Sequence: CGATCATCCACTCGTCATTG. Inner primer WT PCR product: 2333. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB518 |
nos-1(ok250) II. |
C. elegans |
R03D7.7. Homozygous. Outer Left Sequence: CAACTTCTTGAAGGCTTCGG. Outer Right Sequence: TGTCTTGCGTTGATTTGCTC. Inner Left Sequence: CTTGGCTATTGCCCAACATT. Inner Right Sequence: TTGAGGGAATTCAAACAGGG. Inner primer WT PCR product: 3076. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB526 |
C55C3.3(ok258) IV. |
C. elegans |
C55C3.3. Homozygous. Outer Left Sequence: tgaatcggaaaaatcgaagg. Outer Right Sequence: gatctaccaagaatgcggga. Inner Left Sequence: caggtctcgccacgatttat. Inner Right Sequence: tttgtctgggcgaaaaattc. Inner primer WT PCR product: 3283. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB541 |
exc-5(ok271) IV. |
C. elegans |
C33D9.1a. Homozygous. Outer Left Sequence: taccttttggttgtgtgcca. Outer Right Sequence: caattaccgtcccaaccatc. Inner Left Sequence: ccaatagttgcggaaggaaa. Inner Right Sequence: attggactttgatgcggttc. Inner primer WT PCR product: 3388. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB545 |
pek-1(ok275) X. |
C. elegans |
F46C3.1. Homozygous. eukaryotic initiation factor 2 alpha kinase PEK. Outer Left Sequence: ctgagccatcgacaaactca. Outer Right Sequence: ccttggtaccattcaacgct. Inner Left Sequence: ctgagaaggcaacgctctct. Inner Right Sequence: atcaccgctactctggatgg. Inner primer WT PCR product: 2967. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB552 |
aap-1(ok282) I. |
C. elegans |
Y110A7A.10. Homozygous. Outer Left Sequence: GGACTCCGAGCTACTCAACG. Outer Right Sequence: ATGGGGGACAAGTGGATGTA. Inner Left Sequence: AATGAGCTTGTCGAGGAGGA. Inner Right Sequence: GGAGATGGAGAATCCCATGA. Inner primer WT PCR product: 2661. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB557 |
T28F4.2(ok289) I. |
C. elegans |
T28F4.2. Homozygous. Outer Left Sequence: GTGTGTGTGCAAAATGGAGG. Outer Right Sequence: ATAGTCCAAGCCACAAACCG. Inner Left Sequence: ATTGAAGGTTCGCTTGTTGG. Inner Right Sequence: AGCTCGTAGCTGAGCGTTTC. Inner primer WT PCR product: 3219. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB559 |
srp-8(ok291) V. |
C. elegans |
F20D6.3. Homozygous. Outer Left Sequence: GATGCCGGAAAAAGATGAAA. Outer Right Sequence: GTTATCATCCAGCAAATACACC. Inner Left Sequence: GTTGCACAATACGTATGTATTCTC. Inner Right Sequence: CTTTGGTGTTAGTTGCAGGAG. Inner primer WT PCR product: 1526. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB562 |
fmo-4(ok294) V. |
C. elegans |
F53F4.5. Homozygous. Outer Left Sequence: GCATATGGTACATTTGCCCC. Outer Right Sequence: AAATCAACTCAAACCGCACC. Inner Left Sequence: GCTTCATTGGCGGTAAACAT. Inner Right Sequence: CTCCTCCTCCTCCTTCTCGT. Inner primer WT PCR product: 2475. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB563 |
aaim-1(ok295) X. |
C. elegans |
Dopamine receptor knockout. [NOTE: (3/3/2025) ok295 was previously described as an allele of dop-3/T14E8.4, but is actually an allele of aaim-1/T14E8.4.1 according to current gene models.] Outer Left Sequence: ttgctccagcggttctagtt. Outer Right Sequence: gactgtctaagcgaccagcc. Inner Left Sequence: ttgtttgcgggtttgataca. Inner Right Sequence: agaagcacgcggtagttgat. Inner Primer PCR Length: 3254. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB564 |
gcy-31(ok296) X. |
C. elegans |
T07D1.1. Homozygous. Outer Left Sequence: ctacgacaattgcgggagat. Outer Right Sequence: aggcttaggcaaggcttagg. Inner Left Sequence: aaaatttccgcattttgtgg. Inner Right Sequence: ggcctaaaacattggcttga. Inner primer WT PCR product: 3072. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB568 |
svh-5(ok286) X. |
C. elegans |
C33A11.4/tag-97. Homozygous. Outer Left Sequence: GTTTATAGTCTGGTCTCACACAAGG. Outer Right Sequence: AATCGTCTGGTGTCTGTTTGACC. Inner Left Sequence: TACGAGCTGCACCAGATCTCG. Inner Right Sequence: TTACAGATTCTTCGTGAGACC. Inner primer WT PCR product: 3537. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB569 |
K08C7.6(ok299) IV. |
C. elegans |
K08C7.6. Homozygous. Outer Left Sequence: CTTATGCAGAGCATCACGGA. Outer Right Sequence: GCATATTTTAGCCATGCCGT. Inner Left Sequence: ATGGCGTTCTTGTCTGCTCT. Inner Right Sequence: AATTTTCCAATTTTTCGGGC. Inner primer WT PCR product: 2965. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB574 |
alg-2(ok304) II. |
C. elegans |
T07D3.7. Homozygous. Outer Left Sequence: tctgagtttggctcgatgtg. Outer Right Sequence: atgttccttggataccagcg. Inner Left Sequence: agcccagaactgggaaactt. Inner Right Sequence: aagtcgaattccgttggatg. Inner primer WT PCR product: 3297. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB575 |
F16H11.3(ok305) X. |
C. elegans |
F16H11.3. Homozygous. Outer Left Sequence: atcggcaaaggattcatcag. Outer Right Sequence: ttcttgtctggctgcctttt. Inner Left Sequence: tccattgtggctatgagctg. Inner Right Sequence: gatcgaacacctatgccgtt. Inner primer WT PCR product: 3216. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB578 |
C53D5.5(ok311) I. |
C. elegans |
C53D5.5. Homozygous. Outer Left Sequence: ccagcttctagccgcataac. Outer Right Sequence: caggtctcgaaacgaccaat. Inner Left Sequence: cccgtttttcagctttgtgt. Inner Right Sequence: acgggcaatattttcggaat. Inner primer WT PCR product: 2904. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB579 |
ife-2(ok306) X. |
C. elegans |
R04A9.4. Homozygous. Outer Left Sequence: AAACATTCGTTCATTTCCGC. Outer Right Sequence: GCACAGCAGCGATGTAAAAA. Inner Left Sequence: ATTTAAGTGGCTGGTGTGGC. Inner Right Sequence: CGTTTTGCCAATCGAATTTT. Inner primer WT PCR product: 2315. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB582 |
C04G6.1(ok219) II. |
C. elegans |
C04G6.1 Homozygous. Outer Left Sequence: ACCCGTCATTTCTGAAAACG. Outer Right Sequence: GCCAACCTGGTGTCGTAGTT. Inner Left Sequence: GACGTGCTTTGTGCGAATTA. Inner Right Sequence: CACTTGAGCTCCCTCGAATC. Inner Primer PCR Length: 2564. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB584 |
zag-1(ok214) IV. |
C. elegans |
F28F9.1. 7/03: Not homozygous (Mark Edgley). Outer Left Sequence: CTCCTCCCTGTCTCTCGTTG. Outer Right Sequence: TGAAGGAAAAAGCGAAGCAT. Inner Left Sequence: TGGCGAGGAAATTAAGTTGG. Inner Right Sequence: AGACGTTTATTGGCACAGCC. Inner primer WT PCR product: 2791. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB594 |
glc-3(ok321) V. |
C. elegans |
ZC317.3. Homozygous. Outer Left Sequence: TCAAAATACAGGGGTAGGCG. Outer Right Sequence: ACAATTCCTGGAACTCACGG. Inner Left Sequence: TGAAGAGGTTTTGAAACGCA. Inner Right Sequence: ACTTTCCGAGAGGAATGGGT. Inner Primer PCR Length: 2747 bp. Deletion Size: 1258 bp. Deletion left flank: GCGATTTTTGTGCTTGGCGTCAAAAATGAT. Deletion right flank: AAATGCATCGGACATGACAAAACCATCGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB630 |
rpm-1(ok364) V. |
C. elegans |
C01B7.6 Homozygous. Outer Left Sequence: cgaatctcctccacggaata. Outer Right Sequence: atcgatttgatggtacggga. Inner Left Sequence: tggaatggattctggtggat. Inner Right Sequence: gagttgggctgtatggagga. Inner Length: 2972. Estimated Deletion Size: 2272. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB631 |
srp-2(ok350) V. |
C. elegans |
C05E4.1. Homozygous. Outer Left Sequence: CTTACTGCCGCAAATCTTCGCGA . Outer Right Sequence: GTTGCGTAGAACTTTCGAGCCTA. Inner Left Sequence: CACTTTATGACGGCACAAAAAAG. Inner Right Sequence: GTGTTATTCTAATTGTCTCGGAAC. Inner primer WT PCR product: 2719. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB633 |
ptp-3(ok244) II. |
C. elegans |
C09D8.1a. Homozygous. Outer Left Sequence: gcattttgtttgccctgttt. Outer Right Sequence: tgcaatcgttttggaaatca. Inner Left Sequence: cctcctcgtatcctcgttca. Inner Right Sequence: tctccctgtcctctatccga. Inner primer WT PCR product: 2578. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB634 |
C43F9.6(ok356) IV. |
C. elegans |
C43F9.6. Homozygous. Outer Left Sequence: cggtgctgcattgtgtctat. Outer Right Sequence: tcgtactgcttgtttgcgtc. Inner Left Sequence: aaatcgttcgaaattgtggg. Inner Right Sequence: tctcgacagacggtgagttg. Inner primer WT PCR product: 2548. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB635 |
F07G6.2(ok362) X. |
C. elegans |
F07G6.2. Homozygous. Outer Left Sequence: tgcgctgtttagaattgtgc. Outer Right Sequence: ctcattgggcaaagtctggt. Inner Left Sequence: tgcgcagtgttccaataaag. Inner Right Sequence: atccgaaccattgactgagg. Inner primer WT PCR product: 2748. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB637 |
F22A3.1(ok165) X. |
C. elegans |
F22A3.1 Homozygous. Outer Left Sequence: CACATCCGATGGATATGCCATGC. Outer Right Sequence: AATGTCGATATATTTGATGTGTTGGC. Inner Left Sequence: CCCATCGAGTATAACCGTCG. Inner Right Sequence: CATTGCGATTCCCATGTAACC. Inner Primer PCR Product: 3203. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB638 |
sel-5(ok363) III. |
C. elegans |
F35G12.3A. Homozygous. Outer Left Sequence: CACTGAGCAATTGCCTTTCA. Outer Right Sequence: ATCGCCGAAGGTAGGTTTTT. Inner Left Sequence: CAAACACATCATCCACCACC. Inner Right Sequence: TTTCTTCCAGGTGGATTTGC. Inner primer WT PCR product: 3269. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB639 |
elp-1(ok347) V. |
C. elegans |
F38A6.2. Homozygous. Outer Left Sequence: CTTGTCTCGTCCCTGAAAGC. Outer Right Sequence: GCTCGCTTTCCTATTCAACG. Inner Left Sequence: TTGCCAATTCCAAACAGACA. Inner Right Sequence: ATTATATCCGACGTGCTGCC. Inner primer WT PCR product: 3036. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB640 |
skr-3(ok365) V. |
C. elegans |
F44G3.6. Homozygous. Outer Left Sequence: tgtaccaccgtgaggaaaca. Outer Right Sequence: atgcacacattacccccatt. Inner Left Sequence: gcgactcattcagcatcaga. Inner Right Sequence: tggcataggtcctggcttag. Inner primer WT PCR product: 2405. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB641 |
snf-2(ok147) I. |
C. elegans |
F55H12.1. Homozygous. Outer Left Sequence: CTCCCTACCACGCATTGTTT. Outer Right Sequence: CCACTCCGTCACCCACTACT. Inner Left Sequence: TTGAACGTGGACTTTTCGTG. Inner Right Sequence: TGATATTCGCTCGCAGTGAC. Inner primer WT PCR product: 3669. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB642 |
F57F10.1(ok368) II. |
C. elegans |
F57F10.1. Homozygous. Anion exchange protein. Outer Left Sequence: attgtgattgcaccaagcag. Outer Right Sequence: aatcaatgagacgcggaatc. Inner Left Sequence: tggtgatggcacaaagtgtt. Inner Right Sequence: tcgatgaatggatacggtga. Inner primer WT PCR product: 2831. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB643 |
msp-38(ok346) IV. |
C. elegans |
K08F4.8. Homozygous. Outer Left Sequence: atgctgggtgaaactaacgg. Outer Right Sequence: caaaagcatcgcagaaaaca. Inner Left Sequence: ctggaagttgtccagatggc. Inner Right Sequence: tccggtgtgaaatgtaacga. Inner primer WT PCR product: 2582. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB646 |
mtd-1(ok353) I. |
C. elegans |
ZK337.5. Homozygous. Outer Left Sequence: ACTGAAATGGGTGCTGCTCT. Outer Right Sequence: CAAATGTTGAGTCTTGCCGA. Inner Left Sequence: TGATAGTTCCGCCAACAACA. Inner Right Sequence: ACGCAGCCTTCTCAACTGAT. Inner primer WT PCR product: 2985. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB647 |
cdc-25.3(ok358) III. |
C. elegans |
ZK637.11. Homozygous. Strain grows better at 15 degrees. Outer Left Sequence: GTTCCTTCTCTAATCCCCGC . Outer Right Sequence: GTTTTTGATTCGCAGGTGGT. Inner Left Sequence: GTTTTCTGTCCACTTCCCGA. Inner Right Sequence: CCCACAATGAGACGAGTGTG . Inner primer WT PCR product: 2592. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB648 |
snf-8(ok349) IV. |
C. elegans |
ZK829.10. Homozygous. Outer Left Sequence: CACGTGTAAGCTCGACTCCA. Outer Right Sequence: ACATTGAACAATGCGGAACA. Inner Left Sequence: GGCCCACTCTTTAATACGCA. Inner Right Sequence: GAACTTGCCCCCACATCTAA. Inner primer WT PCR product: 3546. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB651 |
rhr-2(ok403) V. |
C. elegans |
B0240.1. Homozygous. Outer Left Sequence: CCCGTTTTACCAATCCCTTT. Outer Right Sequence: ATGACACACGACGGACAAAA. Inner Left Sequence: CGAAAGCGAGACTTTCCGTA. Inner Right Sequence: TAACTGCAAGAAAATCGGGG. Inner primer WT PCR product: 3086. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB652 |
puf-7(ok361) IV. |
C. elegans |
B0273.2. Homozygous. Outer Left Sequence: cagattttgagccaagctcc. Outer Right Sequence: gtgaacttctcgaagacggc. Inner Left Sequence: aatcattttcccgtccgttt. Inner Right Sequence: tccagtggatagttggcct. Inner primer WT PCR product: 3185. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB653 |
ogt-1(ok430) III. |
C. elegans |
K04G7.3. Homozygous. Outer Left Sequence: gccaaagaattgatttcgga. Outer Right Sequence: tgctcttgcaccacaaccta. Inner Left Sequence: acctgtccgagaccattctg. Inner Right Sequence: ccaacgctattgctcctctc. Inner primer WT PCR product: 2730. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB654 |
sir-2.3(ok444) X. |
C. elegans |
F46G10.3. Homozygous. Outer Left Sequence: cgcaccatattgctttgatg. Outer Right Sequence: gcatatgctgctgctgctaa. Inner Left Sequence: actctctcgcctgtgtcaaat. Inner Right Sequence: cgaagcgcttatcacctttc. Inner primer WT PCR product: 2267. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB655 |
T08D2.7(ok431) X. |
C. elegans |
T08D2.7. Homozygous. Outer Left Sequence: ataagacggcgttccacagt. Outer Right Sequence: acttggcgcgttagatgact. Inner Left Sequence: atgcaccgctcagctttatt. Inner Right Sequence: tcgatagagacctccggttg. Inner primer WT PCR product: 2905. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB656 |
glh-1(ok439) I. |
C. elegans |
T21G5.3. Homozygous. Outer Left Sequence: agtgcatttggaggatcagg. Outer Right Sequence: aaagagtttgcgcgtcattt. Inner Left Sequence: cgatcgagtgactgtccaga. Inner Right Sequence: ttcaattgcagacttcgtcg. Inner primer WT PCR product: 2952. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB658 |
glc-4(ok212) II. |
C. elegans |
C27H5.8. Homozygous. Outer Left Sequence: tcagcaccttcactgattgc. Outer Right Sequence: ttcccgaccactaggtatgc. Inner Left Sequence: cgacacattgtacagacccg. Inner Right Sequence: gcacctccaccacaggttat. Inner primer WT PCR product: 3279. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB659 |
C54A12.4(ok400) II. |
C. elegans |
C54A12.4. Homozygous. Outer Left Sequence: tcatccttcggcataccttc. Outer Right Sequence: atttcccactggttgcactc. Inner Left Sequence: tccgtggtggttattggatt. Inner Right Sequence: gaaaccggtcacaagttcgt. Inner primer WT PCR product: 2628. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB660 |
arr-1(ok401) X. |
C. elegans |
F53H8.2. Homozygous. Outer Left Sequence: agttttatgccgctctcgaa. Outer Right Sequence: tcaattcgttccccactctc. Inner Left Sequence: caacttttccgccacataca. Inner Right Sequence: atggcggaagtttaccctct. Inner primer WT PCR product: 2402. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB661 |
Y1A5A.1(ok414) III. |
C. elegans |
Y1A5A.1. Homozygous. Outer Left Sequence: aggaagcacagactgggaga. Outer Right Sequence: caaatgcttccgtttccatt. Inner Left Sequence: ctgctcgtgtgtgtgtgttg. Inner Right Sequence: tcgtagcattgatcgtcgtc. Inner primer WT PCR product: 2569. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB662 |
apb-3(ok429) I. |
C. elegans |
R11A5.1A. Homozygous. Outer Left Sequence: cgatatgccgaagaacaaca. Outer Right Sequence: caacagaaactcgtgctcca. Inner Left Sequence: tggaagtgctctccgagttt. Inner Right Sequence: tttcccttcacatcgagacc. Inner primer WT PCR product: 2880. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB663 |
F13G3.4(ok417) I. |
C. elegans |
F13G3.4. Homozygous. Outer Left Sequence: TTTCGTATTTCCAACTCCCG. Outer Right Sequence: CAACTGGATCCCCATTTGAC. Inner Left Sequence: TGATCCAATCAGCGACTTTG. Inner Right Sequence: CGATTTATCTGCATGCCTCA. Inner primer WT PCR product: 2157. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB664 |
F13G3.3&dylt-1(ok416) I. |
C. elegans |
F13G3.3, F13G3.4. Homozygous. Outer Left Sequence: TTTCGTATTTCCAACTCCCG. Outer Right Sequence: CAACTGGATCCCCATTTGAC. Inner Left Sequence: TGATCCAATCAGCGACTTTG. Inner Right Sequence: CGATTTATCTGCATGCCTCA. Inner primer WT PCR product: 2157. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB666 |
C46G7.2(ok399) III. |
C. elegans |
C46G7.2. Homozygous. Outer Left Sequence: tgaagtgccctgctatcaca. Outer Right Sequence: aatcaatgctctcgctcgtt. Inner Left Sequence: tccagttccctaggcacatc. Inner Right Sequence: gatgggtcttgcaacgattt. Inner primer WT PCR product: 2450. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB667 |
far-2(ok435) III. |
C. elegans |
F02A9.3. Homozygous. Outer Left Sequence: AATGAGCAATTCAAATGGGC. Outer Right Sequence: CCCTTCTTCCTTCCATCTCC. Inner Left Sequence: CAGTTGCGAAGAATCAGCAG. Inner Right Sequence: TGTGACCCTTTGATAAGCCC. Inner primer WT PCR product: 2989. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB668 |
ftn-2(ok404) I. |
C. elegans |
D1037.3. Homozygous. Ferritin. Outer Left Sequence: atctgcctgctttttgcact. Outer Right Sequence: agtttcgaatacgggtcgtg. Inner Left Sequence: gcaaacaaaaacgcttcgat. Inner Right Sequence: actggagctgcaatttgctt. Inner primer WT PCR product: 3129. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB669 |
wee-1.1(ok418) II. |
C. elegans |
F35H8.7. Homozygous. Outer Left Sequence: CCCCTCTGAAATTCCAGTCA. Outer Right Sequence: GAGGCTCCACCCACTTACAA. Inner Left Sequence: TCCCAAAACCTTGAATCAGC. Inner Right Sequence: CCGTTGAGCTCACATGCTTA. Inner primer WT PCR product: 2343. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB670 |
sst-20(ok427) I. |
C. elegans |
F54C1.9. Homozygous. Outer Left Sequence: catcaacagctgcgaaacat. Outer Right Sequence: atcatgacatcgtggctgaa. Inner Left Sequence: agtccgaatcgatccctctt. Inner Right Sequence: caccgcctctctttctcaac. Inner primer WT PCR product: 2883. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB671 |
fmo-1(ok405) IV. |
C. elegans |
K08C7.2. Homozygous. Outer Left Sequence: GAACAAAGGATGTCGGAGGA. Outer Right Sequence: TCGCAGCATTTTCTTTTGTG. Inner Left Sequence: ACATCAAAGGAAATGACGGC. Inner Right Sequence: CCGATCACACCAGGAAAAAT. Inner primer WT PCR product: 2403. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB673 |
Y1A5A.1(ok445) III. |
C. elegans |
Y1A5A.1. Homozygous. lim domain. Outer Left Sequence: aggaagcacagactgggaga. Outer Right Sequence: caaatgcttccgtttccatt. Inner Left Sequence: ctgctcgtgtgtgtgtgttg. Inner Right Sequence: tcgtagcattgatcgtcgtc. Inner primer WT PCR product: 2569. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB674 |
stam-1(ok406) I. |
C. elegans |
C34G6.7. Homozygous. Outer Left Sequence: gctcaagagtgtggaggagg. Outer Right Sequence: gctcggaaaaatcactgctc. Inner Left Sequence: gattaatgggagaatgccga. Inner Right Sequence: ctgttgagaattgggaggga. Inner primer WT PCR product: 2799. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB675 |
pmp-4(ok396) IV. |
C. elegans |
T02D1.5. Homozygous. ABC transporter. Outer Left Sequence: aaacagcctgagacggaatg. Outer Right Sequence: tatgtattggtgcggcttga. Inner Left Sequence: atgccatgacacttgcttca. Inner Right Sequence: atgcaccacctgtgcaaata. Inner primer WT PCR product: 2613. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB676 |
num-1(ok433) V. |
C. elegans |
T03D8.1b. Homozygous. Outer Left Sequence: CGTTAGGACCGTGTCGAAT. Outer Right Sequence: AGCGATTAAAAGAAACGCGA. Inner Left Sequence:CCGCAATGTTTTATGGGAAA. Inner Right Sequence: ACCGCATCCCAACATAAAAG. Inner primer WT PCR product: 2514. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB677 |
mbk-1(ok402) X. |
C. elegans |
T04C10.1. Homozygous. Outer Left Sequence: cgggtaatcgagtttctcca. Outer Right Sequence: actaatgcagaagcggcact. Inner Left Sequence: gaaacgtgtcatccagctca. Inner Right Sequence: tggaatgattggtatcccgt. Inner primer WT PCR product: 2563. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB680 |
ZK770.1(ok415) I. |
C. elegans |
ZK770.1. Homozygous. Outer Left Sequence: AAATTTCAGGCCACCAAATG. Outer Right Sequence: GACGAAGGCGGATAGGTGTA. Inner Left Sequence: ACGTTTCAACTGGATGGAGG. Inner Right Sequence: TGCATGAACTGTTAACCGGA. Inner primer WT PCR product: 2874. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB681 |
cat-1(ok411) X. |
C. elegans |
W01C8.6. Homozygous. Outer Left Sequence: CCATTGAATGTGCAACGAAC. Outer Right Sequence: ATGGATTAGCAGTCCATCGC. Inner Left Sequence: TCGAGTGACCTCAAACATGC. Inner Right Sequence: ATGCAAGCATACTGGGAAGG. Inner primer WT PCR product: 2850. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB682 |
moc-1(ok366) X. |
C. elegans |
T06H11.4. Received new stock 9/15/04. Homozygous. [NOTE: Seems to grow better at lower temperature (15C).] Outer Left Sequence: GGTCTGTTGCATGTGGTTTG. Outer Right Sequence: TTCGTCATCCCTCTTCATCC. Inner Left Sequence: TCTAAGCTGCAAACTCGCAA. Inner Right Sequence: AATCTGTTACCCTTGCTGCG. Inner primer WT PCR product: 3273. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB683 |
inx-20(ok426) I. |
C. elegans |
T23H4.1. Homozygous. Outer Left Sequence: GCAATCATGACAAAACGGTG. Outer Right Sequence: GGTCCCAACGGACACATTAC. Inner Left Sequence: GCCAACCTTGATTCCTCAAA. Inner Right Sequence: CCTGCTCAAACCACCTCATT. Inner primer WT PCR product: 2908. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB684 |
tank-1(ok446) V. |
C. elegans |
ZK1005.1. Homozygous. Outer Left Sequence: AATGAGATTGGCGGAATGAG. Outer Right Sequence: TCCAACATCCACAGGACAAA. Inner Left Sequence: TTCCAAGCTGTTCCCATTTC. Inner Right Sequence: TTACTCTCGCGGATTCGTCT. Inner primer WT PCR product: 2752. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB685 |
cdh-7(ok428) II. |
C. elegans |
R05H10.6. Homozygous. Outer Left Sequence: CCACCAAAGTGCACATCAAC. Outer Right Sequence: TGTCTTGCCTCATGTCTTGC. Inner Left Sequence: AGTTGACGATGGAGAATGGC. Inner Right Sequence: GTTCCATCCACGGTGTCTCT. Inner primer WT PCR product: 2740. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB686 |
fmo-3(ok354) III. |
C. elegans |
Y39A1A.19. Homozygous. Outer Left Sequence: GACCTTTTTCGAATTTGCCA. Outer Right Sequence: ACCGAGTTCATGGAGGTACG. Inner Left Sequence: TGTCGAGGTGACTTGCTTTG. Inner Right Sequence: TTGGCAATTACGTTGTGGAA. Inner primer WT PCR product: 3172. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB687 |
snf-5(ok447) II. |
C. elegans |
Y46G5A.30. Homozygous. Outer Left Sequence: CGTTACGGCTCTCAGACTCC. Outer Right Sequence: TGCACTGTAACGCTCACCTC. Inner Left Sequence: ATCTTGAAGCGCAAGCTGAT. Inner Right Sequence: GAACTCTGCGTCTCGACTCC. Inner primer WT PCR product: 2878. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB688 |
K02A2.3(ok228) II. |
C. elegans |
K02A2.3. Homozygous. Outer Left Sequence: CATGCCAGGAAGGAAGTCAT. Outer Right Sequence: TTTGGTGCTGCTCTTCAATG. Inner Left Sequence: TCTCGAAAACCAATGAGCCT. Inner Right Sequence: GTAACCCGCATGGGTATCAG. Inner primer WT PCR product: 2754. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB689 |
pak-1(ok448) X. |
C. elegans |
C09B8.7. Homozygous. Outer Left Sequence: GAGGAATGGATGCGTAAGGA. Outer Right Sequence: AGCCAGAAGCAACCAAGAAA. Inner Left Sequence: CCGACCATCGATTTTCAACT. Inner Right Sequence: GGAAGCGTCAGAAAAACCAG. Inner primer WT PCR product: 3211. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB690 |
sdn-1(ok449) X. |
C. elegans |
F57C7.3. Homozygous. Outer Left Sequence: CGAGGCATATGGTCTTGCTT. Outer Right Sequence: GCCTGTCGACTTACTCGGTC. Inner Left Sequence: CTGTAATCACCGCAACGAGA. Inner Right Sequence: GAAAGTGGTCCCTTCGTCAA. Inner primer WT PCR product: 2688. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB691 |
cht-1(ok456) X. |
C. elegans |
C04F6.3. Homozygous. Outer Left Sequence: AGCTATTGTGGGCATCGTTC. Outer Right Sequence: TTCCTTCTCGTGGCAAGTTT. Inner Left Sequence: TTACAAATGGCTTCCCGAAA. Inner Right Sequence: GAGATCCGAGCCAACCAATA. Inner primer WT PCR product: 2531. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB692 |
C08F11.14(ok457) IV. |
C. elegans |
C08F11.14. Homozygous. Outer Left Sequence: CCATCTTCAAGCTTTGCCTC. Outer Right Sequence: CACATTCGTCACCTGAATGC. Inner Left Sequence: CCAAAGTTGAGCACGTGAGA. Inner Right Sequence: GTTGCAAGGACTGATGCAGA. Inner primer WT PCR product: 3374. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB693 |
vab-3(ok452) X. |
C. elegans |
F14F3.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB694 |
pfn-2(ok458) X. |
C. elegans |
F35C8.6. Homozygous. Outer Left Sequence: TTCAGGGAGAGATGGTGGAC. Outer Right Sequence: GACGCTTTGCAACAAGAACA. Inner Left Sequence: TGCGGCAACTCTGATTACAC. Inner Right Sequence: AGAGCGCTGGTTGTTCATCT. Inner primer WT PCR product: 2802. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB695 |
ucp-4(ok195) V. |
C. elegans |
K07B1.3. Homozygous. Outer Left Sequence: AGTCCTGAACGGAGCTTTGA. Outer Right Sequence: TACAATGGCAGCAGCAAGTC. Inner Left Sequence: TCGCACATTGGTTTGTTGTT. Inner Right Sequence: AACGGCATGAGTTAGCCAAT. Inner primer WT PCR product: 2995. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB696 |
Y48G9A.4(ok460) III. |
C. elegans |
Y48G9A.4. Homozygous. Outer Left Sequence: AAGCCGATGCAAGCTAAGAA. Outer Right Sequence: GCGACGTGGATTTCTCATTT. Inner Left Sequence: TAGTACAACGTCGGCTGCTG. Inner Right Sequence: GTTTGCACACTGTCCCATTG. Inner primer WT PCR product: 2987. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB697 |
srp-10(ok453) V. |
C. elegans |
F09C6.4. Homozygous. Outer Left Sequence: CGGTTTGTGTCTTCCGAAAT. Outer Right Sequence: TGGGAATAGCTCTTTGCGAT. Inner Left Sequence: ATCTATGGCGATGGCTCTTG. Inner Right Sequence: ACCAATTCGAGCAGATGACC. Inner primer WT PCR product: 2408. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB699 |
rgs-9(ok461) X. |
C. elegans |
ZC53.7, ZC53.6. Homozygous. Outer Left Sequence: GGCACAGTCTGCAAGATGAA. Outer Right Sequence: ATCCACAACTCCATGGCTTC. Inner Left Sequence: GTCATTCACACACACAGCCC. Inner Right Sequence: CAAATGCCGAGTAAGGGAAA. Inner primer WT PCR product: 2766. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB700 |
erp-1(ok462) X. |
C. elegans |
F35A5.8. Homozygous. Outer Left Sequence: AGCCATCACATATTCCGCAT. Outer Right Sequence: ATTGGAGGACGGATGTTGAG. Inner Left Sequence: TGATCACTTTGGCTTGCTTG. Inner Right Sequence: CCAGTAATTTCGTCCGTCGT. Inner primer WT PCR product: 2434. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB701 |
erp-1(ok463) X. |
C. elegans |
F35A5.8. Homozygous. Outer Left Sequence: AGCCATCACATATTCCGCAT. Outer Right Sequence: ATTGGAGGACGGATGTTGAG. Inner Left Sequence: TGATCACTTTGGCTTGCTTG. Inner Right Sequence: CCAGTAATTTCGTCCGTCGT. Inner primer WT PCR product: 2434. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB703 |
unc-45(ok468) III. |
C. elegans |
F30H5.1. Homozygous. Outer Left Sequence: CAGGTCCGAGCTCTAGTTGG. Outer Right Sequence: CTTTGAACACCTCAGGCCAT. Inner Left Sequence: CATTTCGAAAGCAACGATGA. Inner Right Sequence: CTGCCGAGTAGAGAACCCAG. Inner primer WT PCR product: 3017. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB705 |
cdd-2&pam-1(ok477) IV. |
C. elegans |
F49E8.4, F49E8.3. Homozygous. Outer Left Sequence: TCTCAACTCCGCTTTTCGTT. Outer Right Sequence: TGAGAAATTCCGATTCTGGG. Inner Left Sequence: ATATTCCAGCTCACCAACGG. Inner Right Sequence: TCTCACCGAACAATATGCCA. Inner primer WT PCR product: 2843. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB706 |
fut-6(ok475) II. |
C. elegans |
T05A7.5b. Homozygous. Outer Left Sequence: AAAACCCGTAAAAACCCCAG. Outer Right Sequence: ACACTGGTCCCAACAAGGAG. Inner Left Sequence: CACATTTCGAATGAATGC. Inner Right Sequence: TGTGCCGAAAAGTTGTTTGT. Inner primer WT PCR product: 2262. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB707 |
pqn-21(ok486) I. |
C. elegans |
C37A2.5a. Homozygous. Outer Left Sequence: TTGTGGTTCGGTGTGTGTTT. Outer Right Sequence: TGGTTCTGTGCTGAAAGACG. Inner Left Sequence: GGGAGAGGATGCAACAAAGA. Inner Right Sequence: TGCTCCAGCTTTGAGGATTT. Inner primer WT PCR product: 2940. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB708 |
ceh-43(ok479) III. |
C. elegans |
C28A5.4, C28A5.5. Homozygous. Outer Left Sequence: ATCCCAATTCATGTGCCAAT. Outer Right Sequence: GCAACTTGCTCAAATGCAAA. Inner Left Sequence: TCCGTGGTTTCCTCATTTTC. Inner Right Sequence: ACTGAAGGAATGATGACGGC. Inner primer WT PCR product: 2244. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB709 |
snf-7(ok482) III. |
C. elegans |
ZK1010.9. Homozygous. Outer Left Sequence: TCGACAGGCTTTACCGACTT. Outer Right Sequence: ACTGCAAACCGGCAATTTAC. Inner Left Sequence: TTACTCTTGAAGGCGCCAGT. Inner Right Sequence: ACTTTCGGCAAATCCTGTTG. Inner primer WT PCR product: 2920. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB710 |
F44D12.1(ok484) IV. |
C. elegans |
F44D12.1. Homozygous. Outer Left Sequence: AAGAGAGGGATCGACTGCAA. Outer Right Sequence: AGGCAATGAGACGACGGTAG. Inner Left Sequence: AAACTGCTCAGGCAAATGCT. Inner Right Sequence: CCTTGAGCCGTGATATCCAT. Inner primer WT PCR product: 2735. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB711 |
pqm-1(ok485) II. |
C. elegans |
F40F8.7. Homozygous. Outer Left Sequence: GCCACACACCTAACCGACTT. Outer Right Sequence: CAAACCCACTTCCCATCCTA. Inner Left Sequence: TGGACGAGAAGCTGATGATG. Inner Right Sequence: GTGCTCTCCAATTGCTCTCC. Inner primer WT PCR product: 2626. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB712 |
daf-18(ok480) IV. |
C. elegans |
T07A9.6. Homozygous. Outer Left Sequence: CCTCCGACTGCTCCAGTAAC. Outer Right Sequence: AAGGAATGGCTTGAAGCAGA. Inner Left Sequence: CAGCAAAGGAATTGTCCGAT. Inner Right Sequence: CCCACGACAAATTCTCGACT. Inner primer WT PCR product: 3002. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB713 |
inpp-4B(ok489) III. |
C. elegans |
R01H10.7. Homozygous. Outer Left Sequence: AATTAACTGGCGACACCCTG. Outer Right Sequence: GCCAATAATTTCAGGGTCCA. Inner Left Sequence: TGATGAAACCACTTCGGACA. Inner Right Sequence: GCTCAGCTTCTGCAATTCCT. Inner primer WT PCR product: 2547. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB720 |
ced-5&tax-6(ok491) IV. |
C. elegans |
C02F4.1. Homozygous. Outer Left Sequence: CGGCCGTTACATTCAAGTTT. Outer Right Sequence: GCACTTCCAATGGGAACACT. Inner Left Sequence: GTACCGGATGCTCATTTGAA. Inner Right Sequence: CTGATCCGTCCAAAATCGTT. Inner primer WT PCR product: 3354. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB721 |
R10D12.17(ok495) V. |
C. elegans |
R10D12.17. Homozygous. Outer Left Sequence: AATGTTCCAGCCCTCTTCCT. Outer Right Sequence: GCCCTCAAATCGTTTGTCAT. Inner Left Sequence: TTTTGCATTGGTTCGAGTGA. Inner Right Sequence: AAATTGTTGCCCAAGAGCAC. Inner primer WT PCR product: 2429. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB732 |
cpz-1(ok497) I. |
C. elegans |
F32B5.8. Homozygous. Outer Left Sequence: TCAAGTGCCTTTACTGTGCG. Outer Right Sequence: GTTCACGAATGCTGGGAAAT. Inner Left Sequence: ATCTTGAACCATCCGTGCTC. Inner Right Sequence: CTTATGGCAAGGTTCGGAAG. Inner primer WT PCR product: 2574. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB733 |
ctbp-1(ok498) X. |
C. elegans |
F49E10.5. Homozygous. Outer Left Sequence: ATGAACGGTCCGTCAAGTTC. Outer Right Sequence: TTTCCGTTATTCAACCCGAC. Inner Left Sequence: TGCACTTCTTGATGGTCGAG. Inner Right Sequence: CACCGTCAGATTGGACCTTT. Inner primer WT PCR product: 3051. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB734 |
T14G8.3(ok502) X. |
C. elegans |
T14G8.3. Homozygous. Outer Left Sequence: ACGCTCTCAGACAACTGCAA. Outer Right Sequence: CGCATCAATTGTCATCATCC. Inner Left Sequence: GGAGGACTCGAAATCACCAA. Inner Right Sequence: TCTTCGGCTCTTCAGTCGAT. Inner primer WT PCR product: 2721. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB736 |
nac-1(ok507) X. |
C. elegans |
F31F6.6. Homozygous. Outer Left Sequence: ACACCGAACTTTATCAGGCG. Outer Right Sequence: TGGTAGGAGGAAAGCGAATG. Inner Left Sequence: ATTGCAGAGCCTCCAATCAT. Inner Right Sequence: TGATATGGTGACTGGGAGCA. Inner primer WT PCR product: 2815. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB737 |
snt-4(ok503) I. |
C. elegans |
T23H2.2. Homozygous. Outer Left Sequence: TACCATCGTGATGCCTTCTG. Outer Right Sequence: GAGATGATGCCACTGAGCAA. Inner Left Sequence: GCAGTTCGTAAACGTCGTCA. Inner Right Sequence: TATTAACGGCGCTCGAAATC. Inner primer WT PCR product: 2757. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB738 |
snf-4(ok496) II. |
C. elegans |
Y46G5A.25. Homozygous. Outer Left Sequence: AACTCTTCTTCTCCGGGCTC. Outer Right Sequence: CACCTGTCTTGGCATTTCCT. Inner Left Sequence: AACGCTTACAATTCCACGCT. Inner Right Sequence: GCAGCATTTATTGTTGCGAA. Inner primer WT PCR product: 2769. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB743 |
nphp-1(ok500) II. |
C. elegans |
M28.7. Homozygous. Outer Left Sequence: ATCGTCAGCTCGCAGAATTT. Outer Right Sequence: TGCCAGGAATTGCATAGACA. Inner Left Sequence: TCGATGAGGCTGTGATTCTG. Inner Right Sequence: TATCTGCCTTATGCCTGGCT. Inner primer WT PCR product: 2912. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB744 |
F20D6.11(ok508) V. |
C. elegans |
F20D6.11. Homozygous. Outer Left Sequence: GTCTCCGGATGAGCAAAGAG. Outer Right Sequence: CGCCTAGCAAATAGACCCAG. Inner Left Sequence: GGAAGAGTGAGTGCCTCTCG. Inner Right Sequence: GTACGAAGAATTTGCCCGAA. Inner primer WT PCR product: 2941. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB745 |
ser-4(ok512) III. |
C. elegans |
Y22D7AR.13. Homozygous. Outer Left Sequence: AATTATCGGATTTAGGGCCG. Outer Right Sequence: ATGGAACGGAGCATTATTCG. Inner Left Sequence: CAACACGCAACGAATGTACC. Inner Right Sequence: TGTGAAGTTTGGGAGGCTTT. Inner primer WT PCR product: 3126. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB746 |
T05C1.4(ok515) II. |
C. elegans |
T05C1.4. Homozygous. Outer Left Sequence: TGATTCTGTCCGGGATCTTC. Outer Right Sequence: ACATAATCCTTGCCGCAAAC. Inner Left Sequence: GAGCTCTTGCATTAGGTGGC. Inner Right Sequence: TTTCCAGCTCCCAATTCATC. Inner primer WT PCR product: 2739. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB747 |
hlh-10(ok516) V. |
C. elegans |
ZK682.4. Homozygous. Outer Left Sequence: CAATTCTCACGCCAAGATCA. Outer Right Sequence: CCGTCTCTTTCACCACCACT. Inner Left Sequence: AAGCATCCCTGATTGATTGG. Inner Right Sequence: CTGAAAGAAGCCGAATCACC. Inner primer WT PCR product: 2674. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB748 |
gta-1(ok517) IV. |
C. elegans |
K04D7.3. Homozygous. Outer Left Sequence: ATTTCAACGAGCATTCCTGG. Outer Right Sequence: TGTGCAGCCACAACTTTAGC. Inner Left Sequence: AGGCGTTGAAACAGGAAATG. Inner Right Sequence: GTCAACTGGAGACAACGGGT. Inner primer WT PCR product: 2903. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB751 |
eps-8(ok539) IV. |
C. elegans |
Y57G11C.24c. Homozygous. Outer Left Sequence: TGGAAAGGGAGAGTCGTTTG. Outer Right Sequence: ACCAACCTGCTTCTGCTGTT. Inner Left Sequence: TCTCCACCACCACAACGTAA. Inner Right Sequence: GCGGAGCAACTCTTCCATAG. Inner primer WT PCR product: 2814. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB752 |
F42G9.1(ok540) III. |
C. elegans |
F42G9.1. Homozygous. Strain is slow growing, slightly Unc, slightly Dpy. Outer Left Sequence: AGTAGAACAGGCAAGCGGAA. Outer Right Sequence: GGCCATCAGGATAAGAGCAG. Inner Left Sequence: CGCTTCCGATATTCCATTGT. Inner Right Sequence: TCCGGATGGCAAATCTAAAC. Inner primer WT PCR product: 2477. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB753 |
lov-1(ok522) II. |
C. elegans |
ZK945.9. Homozygous. Outer Left Sequence: ATCGCTTCCCTCTGATTTGA. Outer Right Sequence: TCCAATTTATGTGAACGGCA. Inner Left Sequence: CCATCGTTCCGAATCAAGTT. Inner Right Sequence: CATTCCAAAGTCTTCCTGGC. Inner primer WT PCR product: 2747. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB754 |
aak-2(ok524) X. |
C. elegans |
T01C8.1. Homozygous. Outer Left Sequence: TCATTTGCTGCAACTTCCTG. Outer Right Sequence: ATACGTGGCATTTACGGAGG. Inner Left Sequence: ATGTCGTTGGAAAGATTCGC. Inner Right Sequence: AAGGAGTGCTTAACGAGCCA. Inner primer WT PCR product: 2741. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB755 |
R03D7.1(ok521) II. |
C. elegans |
R03D7.1. Homozygous. Outer Left Sequence: CGAGGATGAAGGAGTTCCAG. Outer Right Sequence: CTGATGCAGCTGGAAGCATA. Inner Left Sequence: ACGCTTTCTGGTCAAACTGG. Inner Right Sequence: CGGTGAGATCTTCGTTGGTT. Inner primer WT PCR product: 2952. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB756 |
gar-2(ok520) III. |
C. elegans |
F47D12.1. Homozygous. Outer Left Sequence: TATGCAAATTCGTTCGAGCA. Outer Right Sequence: GAAGCACACCCGTGTTACCT. Inner Left Sequence: AGAAGCAGAAGGAGCACGAG. Inner Right Sequence: ACTGCGATTAATGGGACCTG. Inner primer WT PCR product: 2567. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB757 |
nhr-111(ok519) V. |
C. elegans |
F44G3.9. Homozygous. Outer Left Sequence: AATGGGGGTAATGTGTGCAT. Outer Right Sequence: GGTGCGGTTCAGTCAATTTT. Inner Left Sequence: CCAGGTGCAACTGATTGAGA. Inner Right Sequence: TGCTTCACATTGAGAGCGTT. Inner primer WT PCR product: 2342. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB758 |
hda-4(ok518) X. |
C. elegans |
C10E2.3. Homozygous. Outer Left Sequence: TCACAGCTCACCAAAGATCG. Outer Right Sequence: GTTGTTGCTGCTGCATTTGT. Inner Left Sequence: TTGCCAACAGGAGTAAAGGG. Inner Right Sequence: CCAATGAGTGCCTGGAATTT. Inner primer WT PCR product: 2643. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB759 |
akt-1(ok525) V. |
C. elegans |
C12D8.10A. Homozygous. Outer Left Sequence: TTGAGCGAACATTCTATGCG. Outer Right Sequence: GTCGTGGTGACAAGGGAAGT. Inner Left Sequence: AAAGGCACAAATGCAAATCC. Inner Right Sequence: ACTGCTTGGCTCTCGATGTT. Inner primer WT PCR product: 3295. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB760 |
tps-2(ok526) II. |
C. elegans |
F19H8.1. Homozygous. Outer Left Sequence: GTGTGCCGTTTTACCGATCT. Outer Right Sequence: CGCGGTTCCAAAGTAATGTT. Inner Left Sequence: TTTTCTGGCGCTGAATTTTT. Inner Right Sequence: AAACCTCAGCAACCCTCTGA. Inner primer WT PCR product: 2747. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB761 |
F35G8.1(ok527) X. |
C. elegans |
F35G8.1. Homozygous. Outer Left Sequence: TTCACGGACACCTACACCAA. Outer Right Sequence: AAAAGGAATGAACACACGCC. Inner Left Sequence: TTTGAAAGGTCCAGTGGGAG. Inner Right Sequence: TTGACGTCGTTTCATTTCCA. Inner primer WT PCR product: 3158. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB762 |
alr-1(ok545) X. |
C. elegans |
R08B4.2. Homozygous. Outer Left Sequence: TGGGTGTTTGGACTGTGAAA. Outer Right Sequence: CATTGTGTATGCCCGAGTTG. Inner Left Sequence: TCCGGAACTTTCAGTTGGAG. Inner Right Sequence: CCATCATTTCCACCAGCTTT. Inner primer WT PCR product: 2668. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB763 |
cwn-1(ok546) II. |
C. elegans |
K10B4.6. Homozygous. Outer Left Sequence: TCGTTTCTGACATGGCTCAC. Outer Right Sequence: ACCCATCCTTTCCCAATCTC. Inner Left Sequence: CGTATCCACGACCACAACAG. Inner Right Sequence: AGAATCTTCACACCAACGGG. Inner primer WT PCR product: 2704. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB765 |
lite-1(ok530) X. |
C. elegans |
C14F11.3. Homozygous. Outer Left Sequence: CAAAGTCGCGAACAATTGAA. Outer Right Sequence: CGCTTGAGTGGGCTTTACTC. Inner Left Sequence: TGGCAAATTGCTTTGGGTAT. Inner Right Sequence: CAAGAAGACCATGATCGCAA. Inner primer WT PCR product: 3355. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB766 |
icl-1(ok531) V. |
C. elegans |
C05E4.9. Homozygous. Outer Left Sequence: GTCAATAGTGCGACCGTCCT. Outer Right Sequence: CACAATGAGTTCTGCGGCTA. Inner Left Sequence: TCTGAGCCAAGAGTCGAGGT. Inner Right Sequence: GGTAGTCAAATCGGCTCCAA. Inner primer WT PCR product: 3099. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB767 |
atgp-2(ok532) II. |
C. elegans |
C38C6.2. Homozygous. Outer Left Sequence: CCATCAACTAGTCGCCCAAT. Outer Right Sequence: ATGCCGCACCTATACCTTTG. Inner Left Sequence: TGATGTGAATCCTCCGTTCA. Inner Right Sequence: AGACAGTCAAAATGGACGCC. Inner primer WT PCR product: 3089. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB768 |
C50F2.8(ok533) I. |
C. elegans |
C50F2.8. Homozygous. Outer Left Sequence: AGCGAAGAGTTTCCAACGAG. Outer Right Sequence: CAAACAAAGACGGGAAGGAA. Inner Left Sequence: ATTGATTGGAGTTGGCCTTG. Inner Right Sequence: CATCTCCAACCATGACACCA. Inner primer WT PCR product: 2778. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB769 |
C17H12(ok548) IV. |
C. elegans |
C17H12. Homozygous. Outer Left Sequence: GAAATCCGCCTGAAAAATCA. Outer Right Sequence: GTGAAAACCAAGTGCAGGGT. Inner Left Sequence: AGCATTATCCCCGCATGTAG. Inner Right Sequence: AAACTGGGCGAGGGATTTAG. Inner primer WT PCR product: 2532. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB770 |
Y18D10A.6(ok549) I. |
C. elegans |
Y18D10A.6. Homozygous. Outer Left Sequence: AAATGCAACAAGCCTCGAAC. Outer Right Sequence: ACCCACTTCTTCCACGTGTC. Inner Left Sequence: ATCCCTTGCAATTGTTGCTC. Inner Right Sequence: GTCGAGGGCTGACTTCTTTG. Inner primer WT PCR product: 3104. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB771 |
hum-4(ok550) X. |
C. elegans |
F46C3.3. Homozygous. Outer Left Sequence: TCTGTACGTTGTGGAGGCTG. Outer Right Sequence: CTGCTTTGCATGTTCTTGGA. Inner Left Sequence: ACTTCCTTTGGCACAACTGG. Inner Right Sequence: ATCGAATTGAACGCTGCTCT. Inner primer WT PCR product: 2848. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB772 |
atf-6(ok551) X. |
C. elegans |
F45E6.2. Homozygous. Outer Left Sequence: GGCGGGAGTTTAGGAGATTC. Outer Right Sequence: AAAGGCACGGAAATTGAGAA. Inner Left Sequence: AATGACCAGGAAATGTGGGA. Inner Right Sequence: AAGTGTCAATTGGCCAGTCC. Inner primer WT PCR product: 2983. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB773 |
nud-1(ok552) III. |
C. elegans |
Upstream of the ORF of F53A2.4. Homozygous. Outer Left Sequence: ACCATTTCCTATTTTCCCCG. Outer Right Sequence: ATGGCTAACTTGGCATACGG. Inner Left Sequence: CCAGTTGTTCTCGGCTTCTC. Inner Right Sequence: GCACCATTGACATGTTTTCG. Inner primer WT PCR product: 1919. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB774 |
zfp-1(ok554) III. |
C. elegans |
F54F2.2A. Homozygous. Outer Left Sequence: attcaatcagcctgtggagg. Outer Right Sequence: tgctgctgctttctcgttta. Inner Left Sequence: gttggcttgctgccaataat. Inner Right Sequence: cctacaagtggcatgcgata. Inner primer WT PCR product: 2733. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB775 |
T28D9.3(ok555) II. |
C. elegans |
T28D9.3. Homozygous. Outer Left Sequence: CCACTCTGCTTGGTGTCTCA. Outer Right Sequence: GGTGATCTGGATCTGGAGGA. Inner Left Sequence: GTGCTCAATGCAGCAACAGT. Inner Right Sequence: CGTCTTCAGCATCACGAGAA. Inner primer WT PCR product: 2632. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB776 |
kin-32(ok166) I. |
C. elegans |
C30F8.4a. Homozygous. Outer Left Sequence: gacaagtttgttctgtcccat. Outer Right Sequence: cgtcatgttcctatatgctca. Inner Left Sequence: tgtctgtcacgagcataaatc. Inner Right Sequence: ttcttggaatacggtccttgt. Inner primer WT PCR product: 3500. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB777 |
hcf-1(ok559) IV. |
C. elegans |
C46A5.9. Homozygous. Outer Left Sequence: tcatttcttgcagcaattcgctgttaacactgcgagagcg. Outer Right Sequence: . Inner Left Sequence: attcgaatcgatgatggagc. Inner Right Sequence: aaattgaagttgcaaacccg. Inner primer WT PCR product: 2512. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB778 |
F32E10.7(ok560) IV. |
C. elegans |
F32E10.7. Homozygous. Outer Left Sequence: CAGGAAACGTCTGTTCAGCA. Outer Right Sequence: CTCGTCTACAGTCGGAAGCC. Inner Left Sequence: TCTGCTCTTCCTCCAACACC. Inner Right Sequence: GTGGTCGATCAGGAATCGTT. Inner primer WT PCR product: 2879. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB779 |
zig-8(ok561) III. |
C. elegans |
Y39E4B.8. Homozygous. Outer Left Sequence: aaaggttgagaacgccaaga. Outer Right Sequence: ctaggctgggctagggtagg. Inner Left Sequence: gcatcggagacagaaactcc. Inner Right Sequence: tctgtcttaggtgcctgcct. Inner primer WT PCR product: 2785. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB780 |
tag-10(ok562) II. |
C. elegans |
C31C9.1a. Homozygous. Outer Left Sequence: AGGCCTTCAGCAAATCACAT. Outer Right Sequence: TCCCAATTTCCAGAATGAGC. Inner Left Sequence: ATCAATTCAACTCGTTCGCC. Inner Right Sequence: ATCGAGGTGACCGTGAAGAC. Inner primer WT PCR product: 2812. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB781 |
pkc-1(ok563) V. |
C. elegans |
F57F5.5. Homozygous. Outer Left Sequence: AAATTGTGAAACCGCACACA. Outer Right Sequence: TTGCAGCTATCCTGAACACG. Inner Left Sequence: TTCGGTAAGCCAAGTTGGAG. Inner Right Sequence: GGCGAGCAGTAGCACACATA. Inner primer WT PCR product: 2594. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB782 |
F27E5.1(ok564) II. |
C. elegans |
F27E5.1. Homozygous. Outer Left Sequence: CTGCCAGAGGTAAGTAGCCG. Outer Right Sequence: CAGATGGGAAGATCGGAAAA. Inner Left Sequence: TGAAAGACAACTTGCTCGGA. Inner Right Sequence: TGTCTTTTCAGCAGTCACCG. Inner primer WT PCR product: 3142. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB783 |
scd-2(ok565) V. |
C. elegans |
T10H9.2. Homozygous. Outer Left Sequence: TGGTGGTGGTTCAAACTCAA. Outer Right Sequence: CGATGGCTAGAACACCCATT. Inner Left Sequence: ATCACAAACCAATTGGGGAA. Inner Right Sequence: GAGTCTGGCCGGTGTAGTGT. Inner primer WT PCR product: 3154. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB784 |
F28H6.3(ok566) X. |
C. elegans |
F28H6.3. Homozygous. Outer Left Sequence: GGGTCCCCAGAGGTATTCAT. Outer Right Sequence: GAAAATGTTTCGGCTTCCAA. Inner Left Sequence: AGCACGAGAAGCTTTTTCCA. Inner Right Sequence: ACGAATTTTGCGAGACAACC. Inner primer WT PCR product: 2904. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB785 |
dop-5(ok568) V. |
C. elegans |
T02E9.3. Homozygous. Outer Left Sequence: TTGAAACACGAGTGGGCATA. Outer Right Sequence: CTTCCACGCTTTCCTATTGC. Inner Left Sequence: AGCAGATCAGGAACGCAACT. Inner Right Sequence: TTGGTTTAATCGTCATGCCA. Inner primer WT PCR product: 2869. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB786 |
stdh-1(ok569) V. |
C. elegans |
C06B3.4. Homozygous. Outer Left Sequence: GCTGGCATTGTTTCCAGAAT. Outer Right Sequence: GGCTACCACATTGTCCGAGT. Inner Left Sequence: AAGTGTCGAAACACGGGAGA. Inner Right Sequence: TAAAGATTGGCCCGCACTAC. Inner primer WT PCR product: 2645. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB787 |
T27A8.2(ok570) X. |
C. elegans |
T27A8.2. Homozygous. Outer Left Sequence: ATCGAATACATCCGTCCAGC. Outer Right Sequence: TCTTGACCCAGAAACGAACC. Inner Left Sequence: GGCAACATACCATTTCCACC. Inner Right Sequence: TGACCCAGAAACGTACCCAT. Inner primer WT PCR product: 2645. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB788 |
F11D5.3(ok574) X. |
C. elegans |
F11D5.3. Homozygous. Outer Left Sequence: GTTCAAAAAGAGCGCAAAGG. Outer Right Sequence: CAACCAATTCGGGAAAGAAA. Inner Left Sequence: TTTTCCTCGGCTACTGTGCT. Inner Right Sequence: GGACAATTTGAGCGGAGATG. Inner primer WT PCR product: 3007. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB789 |
tre-2(ok575) IV. |
C. elegans |
T05A12.2. Homozygous. Outer Left Sequence: CGACTTGGAATAGTTGCCGT. Outer Right Sequence: ACCACCCTATGTTCTGTGCC. Inner Left Sequence: GTGAACCGCATGAAGAGACA. Inner Right Sequence: GTTTGGTGCGATGGAACTCT. Inner primer WT PCR product: 2568. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB790 |
atf-4(ok576) X. |
C. elegans |
T04C10.4. Homozygous. Outer Left Sequence: TGTCGCCAGTGTTGGAATAA. Outer Right Sequence: ACCGTGAAGATGGAGGTGAC. Inner Left Sequence: CGTGCGCTTCAAGTTCACTA. Inner Right Sequence: GCCAGAAGGCTACTTGGTTG. Inner primer WT PCR product: 2701. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB791 |
hsp-16.48(ok577) V. |
C. elegans |
T27E4.3, T27E4.8. Homozygous. Outer Left Sequence: TGGCATTCCTTCCTTATTGC. Outer Right Sequence: TGAGAAGCCGAGTAGCTGGT. Inner Left Sequence: GTAAGGCTTTCTGCCGTTTG. Inner Right Sequence: TGAGGGCCCTGTAGAAGTTG. Inner primer WT PCR product: 3051. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB792 |
F09C12.2(ok582) II. |
C. elegans |
F09C12.2. Homozygous. Outer Left Sequence: ATGACCGTGGAGTGTGACAA. Outer Right Sequence: CGATCCCTCACTCGGATAAA. Inner Left Sequence: GGTTGCAGGGGTTCTGAATA. Inner Right Sequence: CTTGGCTCATTTTTGACGGT. Inner primer WT PCR product: 3078. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB793 |
pbo-4(ok583) X. |
C. elegans |
K09C8.1. Homozygous. Outer Left Sequence: CGTTGGTAATGAGCACGATG. Outer Right Sequence: AGAACGAGTTGCGAATACGG. Inner Left Sequence: GTGTTGTGTCTTGGCATTGG. Inner Right Sequence: AAGGATGCCTTGTTGAGTGG. Inner primer WT PCR product: 2885. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB794 |
nhr-41(ok584) IV. |
C. elegans |
Y77E11A.5. Homozygous. Outer Left Sequence: AGGCTCACCAAGAGCTTCAA. Outer Right Sequence:AGTAACCCGAGAATTTCGCA . Inner Left Sequence: TCAATTCGAAGCCCTTTCAC. Inner Right Sequence: CATTGATGAAACCTTCCCGT. Inner primer WT PCR product: 2853. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB795 |
F28H6.3(ok585) X. |
C. elegans |
F28H6.3. Homozygous. Outer Left Sequence: GGGTCCCCAGAGGTATTCAT. Outer Right Sequence: GAAAATGTTTCGGCTTCCAA. Inner Left Sequence: AGCACGAGAAGCTTTTTCCA. Inner Right Sequence: ACGAATTTTGCGAGACAACC. Inner Primer WT PCR Product: 2904. Deletion size: 531 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB796 |
sta-1(ok587) IV. |
C. elegans |
Y51H4A.17. Homozygous. Outer Left Sequence: AATTTCCAGACATGATGGGC. Outer Right Sequence: GCAATACGACTTGCCAGTGA. Inner Left Sequence: GCAGCCACACTTTATGAGCA. Inner Right Sequence: AAAGGTGCCAAATGAAATGG. Inner primer WT PCR product: 2902. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB797 |
dsl-5(ok588) IV. |
C. elegans |
F58B3.8. Homozygous. Outer Left Sequence: ATTGGTGTCGCTTTCCTTTG. Outer Right Sequence: TGTACGGGTTCGAACATTCA. Inner Left Sequence: TCTGCATGTGGGAAGACGTA. Inner Right Sequence: GAGGCAATGGTCAGAGAAGC. Inner primer WT PCR product: 2708. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB798 |
rrf-1(ok589) I. |
C. elegans |
F26A3.8. Homozygous. Outer Left Sequence: AGTCAGGAATTCGCTCAGGA. Outer Right Sequence: TCAATCATTGGCAGGTTTCA. Inner Left Sequence: GCTTGGCAATTCTTCTTTGC. Inner Right Sequence: TCGAAGGGATTCAATTCGTC. Inner primer WT PCR product: 3018. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB799 |
C25G6.5(ok594) X. |
C. elegans |
C25G6.5. Homozygous. Outer Left Sequence: CAGGGTCTTAACACGGCAAT. Outer Right Sequence: TGCCTTCAATTTCATCTCCC. Inner Left Sequence: CAAAAATTGGAAGGTGAGCC. Inner Right Sequence: AAATGGGATCGGTGAATGAA. Inner primer WT PCR product: 2691. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB800 |
hst-2(ok595) X. |
C. elegans |
C34F6.4. Homozygous. Outer Left Sequence: CCCTATCTACTGCCAGCGAG. Outer Right Sequence: GCGTCAGCAAAAAGAACACA. Inner Left Sequence: GAAATCGATGGAGGACGAGA. Inner Right Sequence: GCTGTGGAAAAAGCGAAAAG. Inner primer WT PCR product: 3131. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB801 |
hum-2(ok596) V. |
C. elegans |
F36D4.3. Homozygous. Outer Left Sequence: AGCATCCAATATGGACGGAG. Outer Right Sequence: ACGTTTGGCAAGCCATTTAC. Inner Left Sequence: CGGATAAGGCTCGAAGATGA. Inner Right Sequence: ACGTCTCGCCAAATATCCAC. Inner primer WT PCR product: 2679. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB802 |
srp-9(ok598) V. |
C. elegans |
F09C6.5. Homozygous. Outer Left Sequence: TTCACCATCGGTTACGACAA. Outer Right Sequence: ATTATGGACTTGCGAGGTGC. Inner Left Sequence: GACTCGAGGACAGGGATCAA. Inner Right Sequence: CACCTACCTCTACCGCCAAA. Inner primer WT PCR product: 2731. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB803 |
ZK430.5(ok599) II. |
C. elegans |
ZK430.5. Homozygous. Outer Left Sequence: AGCCAATTATTCGGAAGCCT. Outer Right Sequence: GCCTCCTCACCTTGACTCAG. Inner Left Sequence: TGGCAGTATTTCTCGTGCAG. Inner Right Sequence: TCGAAGAATTCGGCTCAGTT. Inner primer WT PCR product: 3291. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB804 |
T07F10.1(ok608) V. |
C. elegans |
T07F10.1. Homozygous. Outer Left Sequence: GGAAATCGATTGCATTCACC. Outer Right Sequence: TCAATTCGGTCAAAGGCTCT. Inner Left Sequence: TGAACCTGCATACAAAGCCA. Inner Right Sequence: TGTTTCCCTCCAAGTAACGG. Inner primer WT PCR product: 2758. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB805 |
nxf-1&nxf-2(ok611) V. |
C. elegans |
C15H11.6. Homozygous. Outer Left Sequence: GCGGACGTACCATTCAAAGT. Outer Right Sequence: ACTGCAGCCTGAAAGTTCGT. Inner Left Sequence: GGCAGAAGTAAGGCTTGCAC. Inner Right Sequence: CATGGATTGACACACCTTGC. Inner primer WT PCR product: 3088. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB806 |
tre-5(ok612) II. |
C. elegans |
C23H3.7. Homozygous. Outer Left Sequence: AAATGGCGATTCAAAGTTCG. Outer Right Sequence: TCTTTGCCACGTGACTGTTC. Inner Left Sequence: AACATCCGGGAAATCATCAA. Inner Right Sequence: CCCGTGGAATTTAAGACGAA. Inner primer WT PCR product: 2691. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB807 |
vha-2(ok619) III. |
C. elegans |
R10E11.6. Homozygous. Outer Left Sequence: TTGAAACGCCGATATCATCA. Outer Right Sequence: AGCGATGTTGGAATAAACGC. Inner Left Sequence: CCCACATTCCAAATAAACCG. Inner Right Sequence: TTCGTAGTAGGCGCTGGATT. Inner primer WT PCR product: 2829. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB808 |
D1022.3(ok620) II. |
C. elegans |
D1022.3, D1022.4. Homozygous. Outer Left Sequence: ACATGGCCGGTATTCTGGTA. Outer Right Sequence: TACGCAGACAACGTCAAACC. Inner Left Sequence: GGCGATGGACTACAACAGGT. Inner Right Sequence: CAGCTTTCCGAGGAATTACG. Inner primer WT PCR product: 2467. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB809 |
ptl-1(ok621) III. |
C. elegans |
F42G9.9a. Homozygous. Outer Left Sequence: CCTCCTACCACCCATCTGAA. Outer Right Sequence: CAACATGCTCAGGGAAGTCA. Inner Left Sequence: TGAACCGAAGCCTAAACCAG. Inner Right Sequence: CTGGAAATTTGTTGGGCAGT. Inner primer WT PCR product: 2452. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB810 |
R07E5.3(ok622) III. |
C. elegans |
R07E5.3, R07E5.14. Homozygous. Outer Left Sequence: ATTATTGTGATACCGGGCCA. Outer Right Sequence: AATTGAGAAGAGCGAGCGAG. Inner Left Sequence: CTACGCGAAACGGATCAAAT. Inner Right Sequence: CGTGGATTGGAGAGGACAAT. Inner primer WT PCR product: 2877. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB811 |
glo-4(ok623) V. |
C. elegans |
F07C3.4. Homozygous. Outer Left Sequence: ATTCTGGTGGAGAACCAACG. Outer Right Sequence: AACAACTGCTTCCCGAGGTA. Inner Left Sequence: AGGAACATGACGAAAGGCAG. Inner Right Sequence: TGATTCCATCTGGCTCCTTC. Inner primer WT PCR product: 2769. glo-4(ok623) causes a a partially-penetrant Dpy phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB812 |
fax-1(ok624) X. |
C. elegans |
F56E3.4. Homozygous. Outer Left Sequence: TAGTGCACGGACTAGGGCTT. Outer Right Sequence: AGATTGAGCACCACCAAACC. Inner Left Sequence: GGAAGCCCTAGCGAGAAGAT. Inner Right Sequence: CTTGAAGTGGCACGAGTCAA. Inner primer WT PCR product: 2430. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB813 |
C41C4.1(ok625) II. |
C. elegans |
C41C4.1. Homozygous. Outer Left Sequence: CACCAGAAATTGAGCAAGCA. Outer Right Sequence: CCCTCGTCCATTTGCTACAT. Inner Left Sequence: TTGCATTTCGATTGGCATAA. Inner Right Sequence: CCCTGGTGATAACACGGTTT. Inner primer WT PCR product: 2704. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB814 |
cdk-5(ok626) III. |
C. elegans |
T27E9.3, T27E9.4. Homozygous. Outer Left Sequence: GAAACTCAACTTCTTCGCCG. Outer Right Sequence: TCCGGTATACGCAAATGACA. Inner Left Sequence: ATGTCCGCTATGTTCAAGGG. Inner Right Sequence: TCATGTTGGCTTCCATCAAA. Inner primer WT PCR product: 2658. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB815 |
F18F11.3(ok628) IV. |
C. elegans |
F18F11.3 Homozygous. Outer Left Sequence: CTCACTCGGGAAAGCGTTAG. Outer Right Sequence: AAAGATTGGAGATGATGGCG. Inner Left Sequence: TTGCCACCGTTGAAACATAA. Inner Right Sequence: CACCAACCACTCCCCTTCTA. Inner Primer PCR Length: 3145. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB816 |
sra-11(ok630) II. |
C. elegans |
F44F4.13. Homozygous. Outer Left Sequence: ATGTGGACAATAAGGGCAGC. Outer Right Sequence: CAGCTCATCCTGCTCAAATG. Inner Left Sequence: CAATTTCGCACGGAATCTTT. Inner Right Sequence: GCGATTGTAGATGTCTGGCA. Inner primer WT PCR product: 2267. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB817 |
abt-4(ok633) V. |
C. elegans |
Y39D8C.1. Homozygous. Outer Left Sequence: ATGGACAGCGTGTCATACCA. Outer Right Sequence: TTTGGGTAAGTTGGGCTTTG. Inner Left Sequence: CGGCTCCGTCACTTCTATTC. Inner Right Sequence: GATCTCAAGAACCCCGACAA. Inner primer WT PCR product: 3226. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB818 |
hum-1(ok634) I. |
C. elegans |
F29D10.4. Homozygous. Outer Left Sequence: AGTGCATGCAAACAGCACTC. Outer Right Sequence: CAGTAAATACGCCGGTGGTT. Inner Left Sequence: CCAACCAGGGACTGAAGTGT. Inner Right Sequence: GTCAATGTTCAGCATGTCGG. Inner primer WT PCR product: 3054. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB819 |
xbx-4(ok635) IV. |
C. elegans |
C23H5.3. Homozygous. Outer Left Sequence: TCAAACAAATTGCGAAGCAG. Outer Right Sequence: TGGGGTGCTGAAAATTTAGG. Inner Left Sequence: ATTCTGGGAGCCCAAGTTTT. Inner Right Sequence: GTGATGCTTCTCGGTCCAAT. Inner primer WT PCR product: 2596. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB820 |
bmk-1(ok391) V. |
C. elegans |
F23B12.8 Homozygous. Outer Left Sequence: CGAGAACCTGCTTTTCAAGG. Outer Right Sequence: CAATCTTGTGCTACTGCCGA. Inner Left Sequence: ATTTGCTGCGAACCTTGACT. Inner Right Sequence: GCCGCGAATCATTGTATTTC. Inner Primer PCR Length: 2690. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB821 |
clh-2(ok636) II. |
C. elegans |
B0491.8 Outer Left Sequence: AACAAATCTTCCCGTGCATC. Outer Right Sequence: ATCGATAGACCATTGGCTGG. Inner Left Sequence: GCTCAACTTCAGGGCAGACT. Inner Right Sequence: GTAGATATTGGCCATCGCGT. Inner Primer PCR Length: 2884. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB822 |
dhs-6(ok637) II. |
C. elegans |
C17G10.8. Homozygous. Outer Left Sequence: CCATAGAGCGTTCACAGCAA. Outer Right Sequence: CTAACGTGTGGCTTTGGGAT. Inner Left Sequence: TATGTGCACCTTTACGGGGT. Inner Right Sequence: ACGCAATGCTGATGAAGTTG. Inner Primer WT PCR product: 3096. Deletion size: 924 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB823 |
ceh-37(ok642) X. |
C. elegans |
C37E2.5. Homozygous. Outer Left Sequence: CACCCAACGGAACTCTTGT. Outer Right Sequence: GGTACACGAGCATGGGTCT. Inner Left Sequence: CGGAAATCGCAATGTAATC. Inner Right Sequence: TAAATTCGACTCGGGCTTT. Inner primer WT PCR product: 2900. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB824 |
F52F12.6(ok646) I. |
C. elegans |
F52F12.6. Homozygous. Outer Left Sequence: ACGGATGGAACAGGTGACTC. Outer Right Sequence: TCATGATGGATTGGCTGAAA. Inner Left Sequence: TTGGGAAATTTGGAAACTGG. Inner Right Sequence: TATGAAACAAATGCTGGCGA. Inner primer WT PCR product: 3150. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB825 |
hsp-43(ok647) X. |
C. elegans |
C14F11.5. Homozygous. Outer Left Sequence: ATTGCGACTTTCTGAGCGAT. Outer Right Sequence: CCATGTGATCACCCTATCCC. Inner Left Sequence: ATCATTTTTGACCAAAGGCG. Inner Right Sequence: GATCATCATCGTCCAACGTG. Inner primer WT PCR product: 2626. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB826 |
F56D6.11&F56D6.21(ok650) IV. |
C. elegans |
F56D6.11&F56D6.21. Homozygous. Outer Left Sequence: TACGGGCCTCTGTCAATTTC. Outer Right Sequence: TCGTCGTGATTGTGTTGGTT. Inner Left Sequence: GCTCTCTTCCAAATGGCAAC. Inner Right Sequence: ATTCGGTGGCAAAAGTCAAG. Inner primer WT PCR product: 3169. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB827 |
C23H5.8(ok651) IV. |
C. elegans |
C23H5.3, C23H5.8. Homozygous. Outer Left Sequence: TCAAACAAATTGCGAAGCAG. Outer Right Sequence: TGGGGTGCTGAAAATTTAGG. Inner Left Sequence: ATTCTGGGAGCCCAAGTTTT. Inner Right Sequence: GTGATGCTTCTCGGTCCAAT. Inner primer WT PCR product: 2595. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB828 |
srd-2(ok652) II. |
C. elegans |
R05H5.1. Homozygous. Outer Left Sequence: AGCTCTCGTCATCGAGCATT. Outer Right Sequence: TTCGACATGCTCTCCAACAG. Inner Left Sequence: TTTGAATTTCTCACGGAACG. Inner Right Sequence: AGACGAACCCAAAATGATCG. Inner primer WT PCR product: 3326. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB829 |
B0336.6(ok640) III. |
C. elegans |
B0336.6. Homozygous. Outer Left Sequence: GATACAATTCCCACGCCTTG. Outer Right Sequence: GGAAGGCGGAATGAGTGTTA. Inner Left Sequence: GCAGTGAGAGAACGAGCACA. Inner Right Sequence: CGAGTCATGCGAATCTTCAA. Inner primer WT PCR product: 2654. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB830 |
epac-1(ok655) III. |
C. elegans |
T20G5.5. Homozygous. Outer Left Sequence: TGGCCACAGCTCTTTTCTTT. Outer Right Sequence: GGGAAAACTCACGGTTTTGA. Inner Left Sequence: GTGGAGGAAGACCGTGTTGT. Inner Right Sequence: TGCCACTGATGAAAGGAGTG. Inner Primer WT PCR product: 3313. Deletion size: 999 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB831 |
tbx-8(ok656) III. |
C. elegans |
T07C4.2 Homozygous. Outer Left Sequence: CAGTTTTTGCCCGTTTTGAT. Outer Right Sequence: AGAAATTGCGTGGCCTAGAA. Inner Left Sequence: AAAATGTTCCCGAAGCTTGA. Inner Right Sequence: TCTTGGTGGCAGAAAGAACC. Inner Primer PCR Length: 2408. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB832 |
F27E11.1(ok657) V. |
C. elegans |
F27E11.1. Homozygous. Outer Left Sequence: AAGGGATGCAGATGATGGAG. Outer Right Sequence: TGCAGGCCTTCAGAACTTTT. Inner Left Sequence: AACCGGGAAGGAGTTACGAT. Inner Right Sequence: TCATGGACTGTGGCAGTAGC. Inner primer WT PCR product: 2891. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB833 |
T27D12.2(ok658) II. |
C. elegans |
T27D12.2. Homozygous. Outer Left Sequence: ATAAGGGCAATGAGCACAGG. Outer Right Sequence: TGAGCTCACGCCAGAATATG. Inner Left Sequence: CTCCAACCACGGCATAAAGT. Inner Right Sequence: TCTACGGCTTATAGCTCGGC. Inner primer WT PCR product: 3227. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB834 |
amx-1(ok659) III. |
C. elegans |
R13G10.2. Homozygous. Outer Left Sequence: TCCCGAGTATTTCGGCTATG. Outer Right Sequence: TACGTAGCATCACCATCCGA. Inner Left Sequence: TGACAACCGATGCTTCTCTG. Inner Right Sequence: ATACCGACGAATCGATCAGC. Inner primer WT PCR product: 3023. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB835 |
rcq-5(ok660) III. |
C. elegans |
E03A3.2. Homozygous. Outer Left Sequence: CACACGTTTTCGCATTTCAC. Outer Right Sequence: GGAGCGTACTTGCCACATTT. Inner Left Sequence: GCCAACTCTCCAGAAACCAA. Inner Right Sequence: TTTCAGAGATGAGCTCGGGT. Inner primer WT PCR product: 3002. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB836 |
F57C7.2(ok661) X. |
C. elegans |
F57C7.2. Homozygous. Outer Left Sequence: ATCGCATGGACACCATCATA. Outer Right Sequence: TTGACTGGAAATGGAGGAGG. Inner Left Sequence: GGGCTTTCAAACATTACCGA. Inner Right Sequence: CGGTGTACAGCTTACTCGCA. Inner primer WT PCR product: 3059. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB837 |
T07D3.4(ok664) II. |
C. elegans |
T07D3.4. Homozygous. Outer Left Sequence: ATGTCTAGGCGGTGGAGAGA. Outer Right Sequence: TGGGTGTTTGTGGTTGAAGA. Inner Left Sequence: GCAGTGTCGGCTGCTAATTT. Inner Right Sequence: TTTCTGAAACCCGTAGGACG. Inner primer WT PCR product: 2309. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB838 |
T13H5.2(ok665) II. |
C. elegans |
T13H5.2. Homozygous. Outer Left Sequence: AGCTGGAAGAGGTTTGTGGA. Outer Right Sequence: CAACTTCAGGCTCCAGCTTC. Inner Left Sequence: TTTAGGTCCAGTGCTCGGTC. Inner Right Sequence: CCGAATTCGTTGATTCTGGT. Inner primer WT PCR product: 3051. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB839 |
F54A3.4(ok666) II. |
C. elegans |
F54A3.4. Homozygous. Outer Left Sequence: ATAGAAAATGCGAGAGCGGA. Outer Right Sequence: GCCTGCCTACCATTAAAGCA. Inner Left Sequence: TGTGCAGGGTGTCTCATTGT. Inner Right Sequence: TTGAAATTTCTCGGGGTACG. Inner primer WT PCR product: 2859. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB840 |
nhr-40(ok667) X. |
C. elegans |
T03G6.2 Homozygous. Outer Left Sequence: ATCAGTGTCCCCACCCATAA. Outer Right Sequence: GGCTTCCGTGTCTGAATGAT. Inner Left Sequence: TTCCATCTTTCTTCGTTCCG. Inner Right Sequence: TCGTCGACTTCTTTCCGTTT. Inner Primer PCR Length: 2895. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB841 |
F14B8.1(ok668) X. |
C. elegans |
F14B8.1. Homozygous. Outer Left Sequence: TTCCATTGCTTCCCTCAATC. Outer Right Sequence: ATGGCAAGGGTGGTAGTGAC. Inner Left Sequence: ATTCCCAACATTTTCCACCA. Inner Right Sequence: TTGGCTGGGATGATTCTTTC. Inner primer WT PCR product: 2944. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB842 |
abt-2(ok669) I. |
C. elegans |
F12B6.1. Homozygous. Outer Left Sequence: TGTCCTGGCCTAATTTTTGC. Outer Right Sequence: AAATGCCACGTATAATGCCC. Inner Left Sequence: GGCTCCACAGCAAATGAGAT. Inner Right Sequence: ACTGGAAATGGAACGAGACG. Inner Primer WT PCR Product: 2966. Deletion size: 1152 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB843 |
wrt-5(ok670) IV. |
C. elegans |
W03D2.5, W03D2.3. Homozygous. Outer Left Sequence: GCGGTTTTTAATGGGGAAAT. Outer Right Sequence: TGAGAAGGAAGGATGATGGG. Inner Left Sequence: AACTGAGGCCTGGAGTTTGA. Inner Right Sequence: CAGCCTTTTTGGAGAGCTTG. Inner primer WT PCR product: 2763. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB844 |
C06C6.5(ok671) V. |
C. elegans |
C06C6.5. Homozygous. Outer Left Sequence: TGAGGACACTCTCGCGTATG. Outer Right Sequence: CGCACACCTAACCATGACAC. Inner Left Sequence: AAATGTGAAATCTTTGCCGC. Inner Right Sequence: GTGCACCCGAGATCAAAAAG. Inner primer WT PCR product: 2464. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB845 |
gur-4(ok672) II. |
C. elegans |
K09E4.5. Homozygous. Outer Left Sequence: TCGCGCAGTTATTTGAGTTG. Outer Right Sequence: TTCAATAATTCGGCTTTCGG. Inner Left Sequence: CGCCGAAACTTCTGAAAGTC. Inner Right Sequence: GTGTCTGAAATGGAGGGGAA. Inner primer WT PCR product: 3218. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB846 |
F01D5.9(ok673) II. |
C. elegans |
F01D5.9. Homozygous. Outer Left Sequence: ATCATCAGTTTTCTTGGCGG. Outer Right Sequence: TTTTGCAGTGAGCGAAAATG. Inner Left Sequence: CTCTCCATTTCTCACCGCTC. Inner Right Sequence: TTCATGCGGAAATTGTTGAA. Inner primer WT PCR product: 2808. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB847 |
C14H10.3(ok674) X. |
C. elegans |
C14H10.3. Homozygous. Outer Left Sequence: GCGAAAACTGAACACGGAAT. Outer Right Sequence: CCTTAACATGCGGCCATTAT. Inner Left Sequence: GAAAAGACGCACGAGGAAAG. Inner Right Sequence: ATTTCTGACGACTGGTTGGG. Inner primer WT PCR product: 3138. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB848 |
rgef-1(ok675) V. |
C. elegans |
F25B3.3. Homozygous. Outer Left Sequence: TGTCGGCTTCTCTGTTGTTG. Outer Right Sequence: CGAGCGGTATCATTTTGGAT. Inner Left Sequence: CATACTGCCACGTGGTGAAG. Inner Right Sequence: GGAATTGCGAGCTATGGTGT. Inner primer WT PCR product: 2838. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB849 |
kap-1(ok676) II. |
C. elegans |
F08F8.3. Homozygous. Outer Left Sequence: CATTTTGCTCGCTGTGAGAC. Outer Right Sequence: AACTTCTCGAACCACTGCGT. Inner Left Sequence: CCATGAATCCATGCCTCTTT. Inner Right Sequence: ATCATCAATTTGGCATGCTG. Inner primer WT PCR product: 3332. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB850 |
egl-47(ok677) V. |
C. elegans |
C50H2.2. Homozygous. Outer Left Sequence: GATATGCTCATGTGGCATCG. Outer Right Sequence: AGATCGATGAGTGTGGAGGG. Inner Left Sequence: ATGCCATCTTTTTCAAACGG. Inner Right Sequence: GGAAGACCTGATTGGGTTGA. Inner Primer WT PCR Product: 2549. Deletion size: 966 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB851 |
inx-20(ok681) I. |
C. elegans |
T23H4.1. Homozygous. Outer Left Sequence: GCAATCATGACAAAACGGTG. Outer Right Sequence: GGTCCCAACGGACACATTAC. Inner Left Sequence: GCCAACCTTGATTCCTCAAA. Inner Right Sequence: CCTGCTCAAACCACCTCATT. Inner primer WT PCR product: 2909. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB852 |
ras-2(ok682) III. |
C. elegans |
F17C8.4. Homozygous. Outer Left Sequence: CTTCTCACATCAAACGGCAA. Outer Right Sequence: ACACCACTCATGCAAAGCTG. Inner Left Sequence: CCATGGATGCCTGAAAAGTT. Inner Right Sequence: CAGAAACGTTCGCAATTCAA. Inner primer WT PCR product: 2592. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB853 |
T14G12.4(ok683) X. |
C. elegans |
T14G12.4. Homozygous. Outer Left Sequence: AATAATCGACGTTTGACGGC. Outer Right Sequence: TAATCATCCTTGGAAACGCC. Inner Left Sequence: TTGGTGTTACAAGCACGGAA. Inner Right Sequence: ATCGCAGTGGTTAGTCCCAC. Inner primer WT PCR product: 2102. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB854 |
lrg-1(ok684) III. |
C. elegans |
F55H2.4. Homozygous. Outer Left Sequence: TGATCCAATGAAAGGCAACA. Outer Right Sequence: TCTTGCAAAATGATCCCCTC. Inner Left Sequence: GCGGATATTTTTGGGAGTGA. Inner Right Sequence: CTGCTCTCGGATTTCGTAGG. Inner primer WT PCR product: 2912. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB855 |
Y32F6B.3(ok685) V. |
C. elegans |
Y32F6B.3. Homozygous. Outer Left Sequence: CCCATTCTCGTCCACTTTGT. Outer Right Sequence: GTGATCCCATTCCAAAATGC. Inner Left Sequence: GAAGACAACGCCTCTGGAAG. Inner Right Sequence: AGGAAAATGGGTGAGCAATG. Inner primer WT PCR product: 2112. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB856 |
B0393.5(ok686) III. |
C. elegans |
B0393.5. Homozygous. Outer Left Sequence:GTTCACCTGGATGGATTGGT. Outer Right Sequence:GCGAGTTCAAATTTTCGAGG . Inner Left Sequence: AAATTCAAAGGCAGCACCAC. Inner Right Sequence: TTCCGCAAAATCCAAAAATC. Inner primer WT PCR product: 3110. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB857 |
pah-1(ok687) II. |
C. elegans |
K08F8.4. Homozygous. Outer Left Sequence:TCCAACGACGGTGAACACTA. Outer Right Sequence: CTCGTCACAAGGCAGTCGTA. Inner Left Sequence: CGTCTGTAAATCGAGCAGCA. Inner Right Sequence: GAAGTACGCCATGGAATCGT. Inner primer WT PCR product: 2344. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB858 |
R09B3.3(ok688) I. |
C. elegans |
R09B3.3. Homozygous. Outer Left Sequence: CGTTGTTGATTTGTCCGATG. Outer Right Sequence: TGGTCTCCGCTCGTTCTACT. Inner Left Sequence: TGACGGTTTAATTTTTCCGC. Inner Right Sequence: CAGGATCTCAAGTGCCTCGT. Breaks are at R09B3 coordinates 4090/5259. Inner primer WT PCR product: 2206. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB859 |
Y57A10C.6(ok693) II. |
C. elegans |
Y57A10C.6. Homozygous. Outer Left Sequence: AAGTTTGGTTGCCCAGTGAA. Outer Right Sequence: CCTGGCTACGTAGTTCCCAA. Inner Left Sequence: ACTTTTCCGATTTTCCGGTT. Inner Right Sequence: TCGTTGGAGTCGGTATGACA. Inner primer WT PCR product: 2202. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB860 |
nck-1(ok694) X. |
C. elegans |
ZK470.5. Homozygous. Outer Left Sequence: TCTTGCCAGCCTTCATTCTT. Outer Right Sequence: TGTTGGATTTGTGCCTTCAA. Inner Left Sequence: TTCACCAACTTTGGCAACTG. Inner Right Sequence: GAACAATCAAGGGCTTAGCG. Inner primer WT PCR product: 2915. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB861 |
F41D9.3(ok695) X. |
C. elegans |
F41D9.3. Homozygous. Outer Left Sequence: TGACACTGTTGCAGTCCTCC. Outer Right Sequence: ACAGAAGTCGTCGCTGTTGA. Inner Left Sequence: GCAGAAAGTGATCCGCATTT. Inner Right Sequence: TAACTACTCGTGCGCATTGG. Inner primer WT PCR product: 3367. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB862 |
zig-2(ok696) X. |
C. elegans |
F42F12.2. Homozygous. Outer Left Sequence: TTTGTTTCGGGTAAAGCCAC. Outer Right Sequence: TTGCGCCCTCTAGAAACACT. Inner Left Sequence: TTTGTCTTGCCCCACCTAAC. Inner Right Sequence: AGCAAAGCAAAGGGCAACTA. Inner primer WT PCR product: 2229. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB863 |
F22E12.2(ok697) V. |
C. elegans |
F22E12.2. Homozygous. Outer Left Sequence: TGTCGCCACGTAATCACATT. Outer Right Sequence: ATCCTCGTGCCACTCACTTT. Inner Left Sequence: ACACTTCTCCTCAACCCCCT. Inner Right Sequence: TGGCAACTTGCAAAATGTGT. Inner primer WT PCR product: 2460. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB864 |
xpa-1(ok698) I. |
C. elegans |
K07G5.2. Homozygous. Outer Left Sequence: TGAGCGAGGAGAAAGAGAGC. Outer Right Sequence:AAAAACGACACGATAACGGC. Inner Left Sequence: AGATAGCCGGAATAGCTGGC. Inner Right Sequence: CTGGAGCCAATCCAACTGAT. Inner primer WT PCR product: 2133. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB865 |
C05D2.3(ok703) III. |
C. elegans |
C05D2.3. Homozygous. Outer Left Sequence: AGATATTGCGACCCACTTG. Outer Right Sequence: TGTCGTCTATGCCGTTCAA. Inner Left Sequence: CGGATGTGAAGCCTGGTTA. Inner Right Sequence: GCGCAATTTCACGATCAAT. Inner primer WT PCR product: 2405. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB866 |
klp-10(ok704) IV. |
C. elegans |
C33H5.4. Homozygous. Outer Left Sequence: CACACACCGAGACTGACGA. Outer Right Sequence: TTGATTCTCAGCCAGGCTCT. Inner Left Sequence: TAAATTAGCGATGCCCGAA. Inner Right Sequence: TTCTTCTTGTGCCTGCATTG. Inner primer WT PCR product: 2678. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB867 |
haf-1(ok705) IV. |
C. elegans |
C30H6.6. Homozygous. Outer Left Sequence: CACCCCTGTCACAGACCTTT. Outer Right Sequence: CGCCAGAGAACAACAGATG. Inner Left Sequence: TGGGCACAAGTTTCATGGT. Inner Right Sequence: AATTTTCTCGCCCTCCAGAT. Inner primer WT PCR product: 2412. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB868 |
xnd-1(ok708). |
C. elegans |
C05D2.5. Homozygous. Outer Left Sequence: GAACCCATTGTTGCCAATCT. Outer Right Sequence: GAGGATCGTCATTTCCCTGA. Inner Left Sequence: TTTTCCACCAATATCCCCAA. Inner Right Sequence: TTGAAGCCCTTTTGTCAACC. Inner primer WT PCR product: 2810. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB869 |
xnd-1(ok709). |
C. elegans |
C05D2.5. Homozygous. Outer Left Sequence: GAACCCATTGTTGCCAATCT. Outer Right Sequence: GAGGATCGTCATTTCCCTGA. Inner Left Sequence: TTTTCCACCAATATCCCCAA. Inner Right Sequence: TTGAAGCCCTTTTGTCAACC. Inner primer WT PCR product: 2810. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB870 |
F39H12.4(ok711) X. |
C. elegans |
F39H12.4. Homozygous. Outer Left Sequence: GTTTCGTCGACTTTGCATCA. Outer Right Sequence: GCACTACACCTTCCGAGAGC. Inner Left Sequence: CCGATAGGGTTGCTTGATGT. Inner Right Sequence: GGTGCAACCGAAAGTTTGTT. Inner primer WT PCR product: 2828. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB871 |
gly-13(ok712) X. |
C. elegans |
B0416.6. Homozygous. Outer Left Sequence: TGTTTCAAAACGCTCACTCG. Outer Right Sequence: TTCCATAACTGCAGTCGCAA. Inner Left Sequence: TTCGGTAAGAATGAAACCCG. Inner Right Sequence: TTCAAAACGGGAATCTGGAG. Inner primer WT PCR product: 3235. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB872 |
R09E10(ok713) IV. |
C. elegans |
R09E10. Homozygous. Outer Left Sequence: ATTTGCCGTCAAAACTGACC. Outer Right Sequence: TACATTGTTGCCCACTGCAT. Inner Left Sequence: TGCAGCTGATCGTTTCATTC. Inner Right Sequence: TGCAGGTGTGAAGTGGACTC. Inner primer WT PCR product: 3420. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB873 |
lig-4(ok716) III. |
C. elegans |
C07H6.1. Homozygous. Outer Left Sequence: TCATTGTCCGTCTCTTTCCC. Outer Right Sequence: TCCTGAATCTCGAATCCACC. Inner Left Sequence: TGGCGTCAGATGTGATCTTC. Inner Right Sequence: ACATCAGAAGGCAACCAAGC. Inner primer WT PCR product: 3201. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB874 |
M110.7(ok721) II. |
C. elegans |
M110.7. Homozygous. Outer Left Sequence: ACTTCATTCATCGCGAATCC. Outer Right Sequence: TTCTTGCACATCCAAGCAAC. Inner Left Sequence: GGAAAGTGTTTGAATGCGGT. Inner Right Sequence: AAGACTCACAGCTGCCTGGT. Inner primer WT PCR product: 2923. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB875 |
baz-2&ZK783.6(ok722) III. |
C. elegans |
ZK783.4 Homozygous. Outer Left Sequence: TCAGCTATCAAGCTCCGGTT. Outer Right Sequence: TGAACGTGCTCTTCATCGTC. Inner Left Sequence: CGTCATACGCCCAGAAGAAT. Inner Right Sequence: ACCAGTTGGTGAGAAATCCG. Inner Primer PCR Length: 3113. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB876 |
zig-6(ok723). |
C. elegans |
T03G11.8. Homozygous. Outer Left Sequence: GGAGTGAACACCAACCTCGT. Outer Right Sequence: TTTTTCGCACTTCTTGCCTT. Inner Left Sequence: AAAATTGCGTTCAACCAAGC. Inner Right Sequence: TAGCCTTCGGCGTTCTTTTA. Inner primer WT PCR product: 2398. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB877 |
nth-1(ok724) III. |
C. elegans |
R10E4.5. Homozygous. Outer Left Sequence: AGAATGCGGTAAAACGATGC. Outer Right Sequence: TGATGAATTGCATCCGAAAA. Inner Left Sequence: ACAGTGAATATGACGCGCAA. Inner Right Sequence: GCACACCTTCCTTTCTCTGC. Inner primer WT PCR product: 2170. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB878 |
T21H8.1(ok725) X. |
C. elegans |
T21H8.1. Homozygous. Outer Left Sequence: CCATTCGTATGGTGTGCAAG. Outer Right Sequence: ACGCATTATTCGGATTCTGG. Inner Left Sequence: CATGGTCCATTTCGTTCTGA. Inner Right Sequence: AACAGGAGTGCCCACGTTAC. Inner primer WT PCR product: 2713. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB879 |
wnk-1(ok266) IV. |
C. elegans |
C46C2.1 Homozygous. Outer Left Sequence: CAAAACGACTCTGCTCCACA. Outer Right Sequence: GCAATTGTGCATGGTTTGTC. Inner Left Sequence: CAACGACATCATCTCCATCG. Inner Right Sequence: TGTCAAGTCGACACGAGACC. Inner Primer PCR Length: 3092. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB880 |
Y74C9A.4(ok727). |
C. elegans |
Y74C9A.4. Homozygous. Outer Left Sequence: CATCGATTGGATCAGCTTCA. Outer Right Sequence: GCGCCCAAAAATTACAAAAA. Inner Left Sequence: GCCTGATGGTTTACGGAGAA. Inner Right Sequence: TTGATTTTCAGACGTGCAGC. Inner Primer WT PCR Product: 3251. Deletion size: 696 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB881 |
srp-9(ok728) V. |
C. elegans |
F09C6.5. Homozygous. Outer Left Sequence: TTCACCATCGGTTACGACAA. Outer Right Sequence: ATTATGGACTTGCGAGGTGC. Inner Left Sequence: GACTCGAGGACAGGGATCAA. Inner Right Sequence: CACCTACCTCTACCGCCAAA. Inner primer WT PCR product: 2731. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB882 |
C44B12.7(ok731) IV. |
C. elegans |
C44B12.7. Homozygous. Outer Left Sequence: GGTCAGCGGTGTAACTTGGT. Outer Right Sequence: CATAACCGGGATATCGGATG. Inner Left Sequence: TCAAGTTGCCGGAAGTTTTT. Inner Right Sequence: TGAATAAAGCCTCCCAGTCG. Inner primer WT PCR product: 2120. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB883 |
kqt-2(ok732) X. |
C. elegans |
M60.5. Homozygous. Outer Left Sequence: TCTTTGTCGGAGAAGCCACT. Outer Right Sequence: GCAAATTCAAAAGTTGGGGA. Inner Left Sequence: GAGAATGCCGGAAAATTCAA. Inner Right Sequence: TGGCAATAAAGTGACGCTTG. Inner primer WT PCR product: 3213. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB884 |
fkh-10(ok733) I. |
C. elegans |
C25A1.2. Homozygous. Outer Left Sequence: ATTGAACCCCCTGAATTTCC. Outer Right Sequence: CAGGGCATCAAAAACTGACA. Inner Left Sequence: ATCTGTGTGCAGATGCTTGC. Inner Right Sequence: GGGAAAATGTTTTCAGCCAA. Inner primer WT PCR product: 2131. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB885 |
Y76B12C.2(ok734) IV. |
C. elegans |
Y76B12C.2. Homozygous. Outer Left Sequence: ATTGGCAAAAGGTGAACGTC. Outer Right Sequence: CAGTTTCAAAGCATTTCGCA. Inner Left Sequence: CGGAAGATGAATGGGAAGAA. Inner Right Sequence: GACAAGCGACTCGTCTAGGG. Inner primer WT PCR product: 2715. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB886 |
adr-2(ok735) III. |
C. elegans |
T20H4.4. Homozygous. Outer Left Sequence: CTCCATATTCGCTTCCGTGT. Outer Right Sequence: AGAACACGCTCTTCGTCGAT. Inner Left Sequence: CACGATGCTGCATGAGATTT. Inner Right Sequence: AGCTCGCTTCCAATCTTCAA. Inner primer WT PCR product: 2144. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB887 |
C36H8.1(ok736) IV. |
C. elegans |
C36H8.1. Homozygous. Outer Left Sequence: GTGAAACCGATTTTGATGGG. Outer Right Sequence: GCGCGAGATGCTCTTTTATT. Inner Left Sequence: ATTTTGCACAACATAGGCCC. Inner Right Sequence: CCCTACTCGGATTCGTCAAA. Inner primer WT PCR product: 2103. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB888 |
casy-1(ok739) II. |
C. elegans |
B0034.3. Homozygous. Outer Left Sequence: CCTTCGCGGTTTTTATTGAA. Outer Right Sequence: CCATCATTTGTGCAATACGC. Inner Left Sequence: AAAGAAGAAAATCGTGGCGA. Inner Right Sequence: ATTGCTCACATCGAGCCTCT. Inner primer WT PCR product: 2331. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB889 |
ceh-40(ok740) X. |
C. elegans |
F17A2.5. Homozygous. Outer Left Sequence: AACAGTTGATGTTCCTCCCG. Outer Right Sequence: ACAATGGGCGAATAATCCA. Inner Left Sequence: GGGCCATCTGAAAATGAGAA. Inner Right Sequence: CCCACCTCTCGCTAATGTGT. Inner primer WT PCR product: 2509. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB891 |
ent-1(ok743) IV. |
C. elegans |
ZK809.4. Homozygous. Outer Left Sequence: ACGACCGTGGTAATCGAAAG. Outer Right Sequence: ACCATTCAGGTTCAGGTTGC. Inner Left Sequence: GGAGAACAACGAGATGGTGC. Inner Right Sequence: GCAAAAGTAGGCGGAGTTTG. Inner primer WT PCR product: 2879. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB892 |
zipt-17(ok745) IV. |
C. elegans |
C30H6.2. Homozygous. Outer Left Sequence: AAATAATGGCGGCTCATTTG. Outer Right Sequence: GAACAGAGCCATACCGTCGT. Inner Left Sequence: CACGACGGTCAAGGAGTTTT. Inner Right Sequence: CTATTCCTCCCACCCCAATC. Inner primer WT PCR product: 2209. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB893 |
R09B5.4(ok746) V. |
C. elegans |
R09B5.4. Homozygous. Outer Left Sequence: AAAGCTTGGCAGAAAAACGA. Outer Right Sequence: TTCCATTTGATTGTGGGCTT. Inner Left Sequence: TTGTGACAATTTCCTGCCAA. Inner Right Sequence: TGAACTTCCTGCCCGTTATC. Inner primer WT PCR product: 2645. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB894 |
pgp-13(ok747) X. |
C. elegans |
F22E10.2. Homozygous. Outer Left Sequence: GACAAAATGCAGGGTGGTTT. Outer Right Sequence: CGGGTAAGTTGCCAAGAAAA. Inner Left Sequence: CTGATTCCCGTCTCCACAAT. Inner Right Sequence: CTCAAGTGGCACGTCTTTCA. Inner primer WT PCR product: 3297. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB895 |
K01D12.11(ok748) V. |
C. elegans |
K01D12.11. Homozygous. Outer Left Sequence: TTGCATCCGCCTGAAATAAT. Outer Right Sequence: TCCAGTTTTTGATATCCGGG. Inner Left Sequence: ACCGGTGTGATCTTGTCTCC. Inner Right Sequence: GTTAATGCGACGCCAAAAGT. Inner primer WT PCR product: 2758. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB896 |
gar-1(ok755). |
C. elegans |
C15B12.5 Homozygous. Outer Left Sequence: TGCAAATTTGAAAATGCCAA. Outer Right Sequence: CAAGTTCCGCACATCTCTGA. Inner Left Sequence: CGATTGGTAAAAGTTGGGGA. Inner Right Sequence: GTTTCCCTCGCCATATCAGA. Inner Primer WT PCR product: 3158. Deletion size: 1264 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB898 |
C54D10.10(ok757) V. |
C. elegans |
C54D10.10 Homozygous. Outer Left Sequence: ATTGGGAAGTTGGTGAATGG. Outer Right Sequence: CTTCGTGCCACATTTTCTGA. Inner Left Sequence: AAGTTCCGAGGCGATATTCA. Inner Right Sequence: CAAAGCGATGCACCGTAATA. Inner Primer PCR Length: 2110. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB899 |
C17G1.7(ok762) X. |
C. elegans |
C17G1.7 Homozygous. Outer Left Sequence: GTCTCGTTGGCCACCACTAT. Outer Right Sequence: CAGCTGATTGTGCATTCGTT. Inner Left Sequence: TCATGAGACATCGACAAGCC. Inner Right Sequence: TTTGGTGTCAAAACCAGCAG. Inner Primer PCR Length: 2272. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB900 |
clh-3(ok763). |
C. elegans |
E04F6.11 Homozygous. Outer Left Sequence: GTCAATTCGCTCATTCGGTT. Outer Right Sequence: GGTCAAGAAACGGAAAACCA. Inner Left Sequence: TTTTGAGCATCATCTTCCCC. Inner Right Sequence: AGGTCAGATGCGGTTATTCG. Inner Primer PCR Length: 3344. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB901 |
nex-2(ok764) I. |
C. elegans |
T07C4.9 Homozygous. Outer Left Sequence: TGATTCATCGAAGGTCACCA. Outer Right Sequence: AAGGCAGCAGAAGCAGTAGC. Inner Left Sequence: AAGGCAGCAGAAGCAGTAGC. Inner Right Sequence: GATGGCCGTGATCTACCAGT. Inner Primer PCR Length: 3043. Estimated Deletion Size: about 500 bp. Update added 2/04: Work completed by Arseni Markoff: Deletion is 404 bp, starts at genomic position 2874 (+/- AATA) from atg (+1) of the gene and ends 3277 +/-4. Thus it begins 18 +/-4 bp from the end of exon 4 and lies entirely in intron 4 of the gene (I-4 is 927 bp). I checked if a possible branching site in the intron should be affected by this deletion, but it seems not to be the case. Our conclusion is that the deletion represents a non-functional mutation. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB902 |
jamp-1(ok765) V. |
C. elegans |
R01B10.5 Homozygous. Outer Left Sequence: CGTTATTAAAAGGCACCCGA. Outer Right Sequence: CCATGTCATCATTGTCTGGC. Inner Left Sequence: TCTTTGGAAATTCGGGTGAC. Inner Right Sequence: GCCATCATGTCTCGGATTCT. Inner Primer PCR Length: 2994. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB903 |
kin-23(ok766) I. |
C. elegans |
W04G5.6 Homozygous. Outer Left Sequence: GCAATCGGCATCAAGAAGAT. Outer Right Sequence: GAATTTTTCCCCGTTTGGAT. Inner Left Sequence: GAGAAAAGCAGTGTACGGGC. Inner Right Sequence: TGGAAACCGATGCCATTATT. Inner Primer PCR Length: 2119. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB904 |
bath-47(ok767) II. |
C. elegans |
T07H3.1 Homozygous. Outer Left Sequence: CTTTCCAGCTGGCCAAATAA. Outer Right Sequence: AGGAAACAGCTCCGAAGTCA. Inner Left Sequence: TTGCTCCCAGTGAATTTTCC. Inner Right Sequence: GTGGAGGGTGTGCTTCTCAT. Inner Primer PCR Length: 3105. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB905 |
clh-3(ok768). |
C. elegans |
E04F6.11 Homozygous. Outer Left Sequence: GTCAATTCGCTCATTCGGTT. Outer Right Sequence: GGTCAAGAAACGGAAAACCA. Inner Left Sequence: TTTTGAGCATCATCTTCCCC. Inner Right Sequence: AGGTCAGATGCGGTTATTCG. Inner Primer PCR Length: 3344. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB906 |
gcy-35(ok769) I. |
C. elegans |
T04D3.4 Homozygous. Outer Left Sequence: CCGTAGGTGACTGTCGGTTT. Outer Right Sequence: TAGAAGGCTAACCCACGCAT. Inner Left Sequence: GTAGTTGACGGCAAAACCGT. Inner Right Sequence: GCGAAAAAGGCTTGTGGTAG. Inner Primer PCR Length: 3123. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB907 |
tiam-1(ok772) I. |
C. elegans |
C11D9.1 Homozygous. Outer Left Sequence: TTTTGGTGAAAGCCTTGGTC. Outer Right Sequence: CATCATTTGGCATTTCGTTG. Inner Left Sequence: CGTCTCAACAGATTCAGCCA. Inner Right Sequence: ATGGTCATGGTCGGTCATTT. Inner Primer PCR Length: 2609. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB908 |
pmp-1(ok773) II. |
C. elegans |
C44B7.8. Homozygous. Outer Left Sequence: AAACGGGAGGAGGAAGAGAC. Outer Right Sequence: CACCAGCATTTGTTGGCATA. Inner Left Sequence: CGAAACGACACTCCGATTTT. Inner Right Sequence: TCGAAACGTTCAGAACCTCC. Inner Primer WT PCR Product: 3253. Deletion Size: 952 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB909 |
F21A9.2(ok774) I. |
C. elegans |
F21A9.2 Homozygous. Outer Left Sequence: ATATGCGTACGAATCCCTCG. Outer Right Sequence: CTCACTCGAGCCCATCTTTC. Inner Left Sequence: GTCTTCGTTGTCTGATGCGA. Inner Right Sequence: CTCATTCGGCCACTTCATTT. Inner Primer PCR Length: 2981. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB910 |
elo-3(ok777) IV. |
C. elegans |
D2024.3 Homozygous. Outer Left Sequence: CATTGTTTTGTCGCCTCCTT. Outer Right Sequence: GCCTCTGATGATTAGCCGAA. Inner Left Sequence: ATCGACAACATGGATGCAAA. Inner Right Sequence: ACACAAATCGTCTCTTCCGC. Inner Primer PCR Length: 2148. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB911 |
fshr-1(ok778) V. |
C. elegans |
C50H2.1 Homozygous. Outer Left Sequence: TTGCCCAGACAAAACATTCA. Outer Right Sequence: AATCCAATTGTGGCCGTAAA. Inner Left Sequence: TGTTCAGGGTTAAGTTCGGG. Inner Right Sequence: CCAAAGAACAGGGTTGGAAA. Inner Primer PCR Length: 3352. Estimated Deletion Size: about 2300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB912 |
ddx-19(ok783) II. |
C. elegans |
T07D4.4a. Homozygous. Outer Left Sequence: CCAGTAATGCTCCACCACCT. Outer Right Sequence: CGTGTGACAGAAAATGACGG. Inner Left Sequence: GGAGTTTTAGCCCCGAGAAC. Inner Right Sequence: CGACAGCGAGTCCACTGTAA. Inner Primer WT PCR product: 3113. Deletion size: 1107 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB913 |
zig-1(ok784) II. |
C. elegans |
K10C3.3 Homozygous. Outer Left Sequence: GAACCCCCTATTCATCGGTT. Outer Right Sequence: CATGCAGAGGCAAATAAGGC. Inner Left Sequence: AATTGGTCAAGCATGGGAAC. Inner Right Sequence: AGTGGGTACACCCATTGGAA. Inner Primer PCR Length: 2953. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB914 |
pxn-1(ok785) V. |
C. elegans |
ZK994.3 Homozygous. Outer Left Sequence: CCAGCATCAAGGAAATGGTT. Outer Right Sequence: ACGCCTCCTTGTGTCAGAAC. Inner Left Sequence: ACCACGGGATAATTCCTTCC. Inner Right Sequence: TTGATGATTGTATGGCCGAA. Inner Primer PCR Length: 2968. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB915 |
ksr-1(ok786) X. |
C. elegans |
F13B9.5. Homozygous. Outer Left Sequence: AGGGAAAAGATCCGGAGAAG. Outer Right Sequence: TTGACACTTGCGAGAATTGC. Inner Left Sequence: TCACGTGCGGGATACAGTAA. Inner Right Sequence: TTAAACTTCGGACTTGGCGT. Inner Primer WT PCR Product: 3347. Deletion size: 2088 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB916 |
gly-14(ok787). |
C. elegans |
M01F1.1. Homozygous. Outer Left Sequence: GGAATTGACACCCTTGCTGT. Outer Right Sequence: AAAGCAGTGGAAATCGGAAA. Inner Left Sequence: AGTGTAGGGACATGCTTGGG. Inner Right Sequence: ATGCGCCTTTAAAAATCGAG. Inner Primer WT PCR product: 3312. Deletion size: 693 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB917 |
Y37A1B.17(ok788) IV. |
C. elegans |
Y37A1B.17 Homozygous. Outer Left Sequence: TTTGAACGAAAGAAGTGGGG. Outer Right Sequence: CCAACACGCACTTTTCATGT. Inner Left Sequence: CCTATCGATCCTTCAAGCCA. Inner Right Sequence: GTCTCTGGCTGGTCTATCGC. Inner Primer PCR Length: 2242. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB918 |
acr-16(ok789) V. |
C. elegans |
F25G6.3 Homozygous. Outer Left Sequence: CTTCATGCAACCCTTTCACA. Outer Right Sequence: AAAAGAAGACAGGTGCCACG. Inner Left Sequence: CAGGAGCGCAGATTGTATGA. Inner Right Sequence: AGTCCTCTGGGCTTTCCATT. Inner Primer PCR Length: 3196. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB919 |
snf-1(ok790) I. |
C. elegans |
W03G9.1 Homozygous. Outer Left Sequence: ATTCCTGCAGCCTATCGTGT. Outer Right Sequence: GGTGGTGGTTCTGAAGTCGT. Inner Left Sequence: TCCGTTCTCTTCCTCACCAC. Inner Right Sequence: AGGCTTAGGAATGTGGGGTT. Inner Primer PCR Length: 3088. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB920 |
clh-6(ok791) V. |
C. elegans |
R07B7.1 Homozygous. Outer Left Sequence: AACAAGTTCCCAAAACTGCG. Outer Right Sequence: AATGAAGATCCTGTGTCGGG. Inner Left Sequence: TGCGTACTTTTACCTCGGCT. Inner Right Sequence: ATGTTGGTCGAACGGATAGC. Inner Primer PCR Length: 3211. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB921 |
nhr-84(ok792). |
C. elegans |
T06C12.7. Homozygous. Outer Left Sequence: AGCTCGAGGAAGTTGACCTG. Outer Right Sequence: GTGTGGTTGTGTCTGCTCGT. Inner Left Sequence: GCGAGCTTCATCATCTCCTC. Inner Right Sequence: TTTCGGGCAATTTTCTCAAC. Inner Primer WT PCR product: 3014. Deletion size: 1171 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB922 |
rnf-5(ok793) III. |
C. elegans |
C16C10.7. Homozygous. Outer Left Sequence: GCAGTTGTTGCACGAGAAGA. Outer Right Sequence: AGAGAGAATCCGTCAGCGAA. Inner Left Sequence: CTTGAGCCATTCTTGATCCC. Inner Right Sequence: AAGATCGCCTGAAGGGAAAT. Inner Primer wt PCR product: 2648. Deletion size: 508 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB923 |
nnt-1(ok794) X. |
C. elegans |
C15H9.1. Homozygous. Outer Left Sequence: ACTGCATGCATCACTTCGAG. Outer Right Sequence: CAATTATTCCGAGCGCATTT. Inner Left Sequence: AACGGTCAACTGATTTTCCG. Inner Right Sequence: CGATGAGCCAAGATAAGCGT. Inner Primer WT PCR product: 3179. Deletion size: 1341 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB924 |
gcy-23(ok797) IV. |
C. elegans |
T26C12.4. Homozygous. Outer Left Sequence: CACGATTTGCTGTGTACGCT. Outer Right Sequence: AGAACGACGAATTCATTGGC. Inner Left Sequence: CAACAATCCAACAACAACGC. Inner Right Sequence: GTTTTTCACCAGCGTGGAAT. Inner Primer WT PCR Product: 3273. Deletion size: 842 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB925 |
ire-1(ok799) II. |
C. elegans |
C41C4.4. Homozygous. Outer Left Sequence: AGGTAGGCGAGGAGAGATCC. Outer Right Sequence: TAATGGGGTTTCGCTTCTGA. Inner Left Sequence: TCGTCGATGTTCTTCAAACG. Inner Right Sequence: TTCATTCTGGAAGCTTGGCT. Inner Primer WT PCR product: 3031. Deletion size: 2093 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB927 |
T11G6.8(ok801) IV. |
C. elegans |
T11G6.8. Homozygous. Outer Left Sequence: GCCATCATGTCGATGTCAAA. Outer Right Sequence: CAGCGAATTTTTGCGATTTT. Inner Left Sequence: CCGGAAAAATTGGGAAGATT. Inner Right Sequence: GAAAATTCCGCTGAGACGAG. Inner Primer PCR Length: 3163. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB928 |
phy-2(ok802) IV. |
C. elegans |
F35G2.4 Homozygous. Outer Left Sequence: GCAGGTACGCAGGCATTTAT. Outer Right Sequence: TTCAACATCCGTTCCACGTA. Inner Left Sequence: GTTGCAGGGCTCTTGCTTAC. Inner Right Sequence: TCCCTCTTCATCATCATCCC. Inner Primer PCR Length: 3083. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB929 |
tdp-1(ok803) II. |
C. elegans |
F44G4.4 Homozygous. Outer Left Sequence: TTTCCCTGTCGGTTTTGAAC. Outer Right Sequence: GTGAACACGAGTTCCGAGGT. Inner Left Sequence: TTTTGCTCGGAGATTTTTGG. Inner Right Sequence: TGTGAACACGACGCCATACT. Inner Primer PCR Length: 2144. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB930 |
med-1(ok804) X. |
C. elegans |
T24D3.1. Homozygous. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB931 |
ZK836.3(ok805) V. |
C. elegans |
ZK836.3. Homozygous. Outer Left Sequence: ACTTCCACCTCTTGGCCTTT. Outer Right Sequence: AAAATGTCGGTCACTACGGC. Inner Left Sequence: GTGGCTCATCGTCAAAGTCA. Inner Right Sequence: CTTCGAATCGTATCCGTCGT. Inner Primer WT PCR Product: 2677. Deletion size: 881 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB932 |
F19B6.4(ok806) IV. |
C. elegans |
F19B6.4 Homozygous. Outer Left Sequence: GTGCCTCATTAAGCAATCGG. Outer Right Sequence: ATCATTTGGCGCAGAAAATC. Inner Left Sequence: CCCCACTCAAAAGTCACGAT. Inner Right Sequence: GGCCACAGTTCGATCTCATT. Inner Primer PCR Length: 3307. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB933 |
Y42G9A.6(ok812) III. |
C. elegans |
Y42G9A.6. [Y42G9A.5 merged into Y42G9A.6 based on EST data.] Homozygous. Outer Left Sequence: CTCGGAAGGCAACTTATTCG. Outer Right Sequence: GTCATGGCGGTCTTATTGGT. Inner Left Sequence: TAGAGTGCCATGAATGCGAG. Inner Right Sequence: TCCATCCGTTTACATCAGCA. Inner Primer WT PCR Product: 2744. Deletion size: 1025 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB934 |
C41C4.7(ok813) II. |
C. elegans |
C41C4.7 Homozygous. Outer Left Sequence: ACTGTCGGATCCATGACACA. Outer Right Sequence: CCGTTCTCTCGGTCAATCAT. Inner Left Sequence: GTCCGCTGGTTTTCACATCT. Inner Right Sequence: GTGGCATTTTTGCTCGTTCT. Inner Primer PCR Length: 2465. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB935 |
nhl-2(ok818) III. |
C. elegans |
F26F4.7. Homozygous. Outer Left Sequence: TTGGGGTAACCTCCTCACTG. Outer Right Sequence: TTGGCACAGAACCACTACCA. Inner Left Sequence: GGATATGGGGTCTGTGATGG. Inner Right Sequence: TGTGAATTGGAAACACCGAA. Inner Primer WT PCR product: 2808. Deletion size: 1496 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB936 |
src-2(ok819) I. |
C. elegans |
F49B2.5. Homozygous. Outer Left Sequence: CCCAGCGTGTCAAGTAGTCA. Outer Right Sequence: TCCCATTGGTCATCTGGAAT. Inner Left Sequence: CGATTCATGGCAGTTTAACG. Inner Right Sequence: ATTAGGTTCGCCTTTTGCCT. Inner Primer WT PCR product: 3166. Deletion size: 2426 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB937 |
alp-1&T11B7.5(ok820) IV. |
C. elegans |
T11B7.4&T11B7.5. Homozygous. Outer Left Sequence: TCCACCACAAGGTTTCAACA. Outer Right Sequence: GGACACGTGATTGTGATTGC. Inner Left Sequence: TCTTAGGTTTGGGGCAGTTG. Inner Right Sequence: GTTGTTGGCTTTGATTCCGT. Inner Primer WT PCR product: 2157. Deletion size: 1236 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB938 |
vha-12(ok821) X. |
C. elegans |
F20B6.2. Homozygous. Outer Left Sequence: ACGCAGTAAGAAACGGCAAG. Outer Right Sequence: AGTACGGCGCATTGAACTTT. Inner Left Sequence: GCAGACAGCACTGCAAAAAG. Inner Right Sequence: GAGTGGTGGTGATGGTGATG. Inner Primer WT PCR product: 2135. Deletion size: 1145 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB939 |
tag-196(ok822) V. |
C. elegans |
F41E6.6 Homozygous. Outer Left Sequence: TGTTAACTGCTGCTGCGTCT. Outer Right Sequence: AGCAATTGTTCGAAGATCCG. Inner Left Sequence: CCTTGGGAGACACCACAACT. Inner Right Sequence: CCTGCACTCCACACACATTC. Inner Primer PCR Length: 2729. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB940 |
tag-196(ok823) V. |
C. elegans |
F41E6.6. Homozygous. Outer Left Sequence: TGTTAACTGCTGCTGCGTCT. Outer Right Sequence: AGCAATTGTTCGAAGATCCG. Inner Left Sequence: CCTTGGGAGACACCACAACT. Inner Right Sequence: CCTGCACTCCACACACATTC. Inner Primer WT PCR product: 2729. Deletion size: 898 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB941 |
tag-196(ok824) V. |
C. elegans |
F41E6.6. Homozygous. Outer Left Sequence: TGTTAACTGCTGCTGCGTCT. Outer Right Sequence: AGCAATTGTTCGAAGATCCG. Inner Left Sequence: CCTTGGGAGACACCACAACT. Inner Right Sequence: CCTGCACTCCACACACATTC. Inner Primer WT PCR product: 2729. Deletion size: 898 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB942 |
cdc-42(ok825) II. |
C. elegans |
R07G3.1. Homozygous. Outer Left Sequence: TCAACAAAGCTCATTCACGC. Outer Right Sequence: ATGAGCATTTTTCTGCGCTT. Inner Left Sequence: AGTTGTTTTGGCCATTTTGC. Inner Right Sequence: AGCCCATTTCCTCATACACG. Inner Primer WT PCR Product: 2264. Deletion size: 632 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB943 |
gly-20(ok826). |
C. elegans |
C03E10.4. Homozygous. Outer Left Sequence: TGGCAAATGCTGTTATAGCG. Outer Right Sequence: TTGTAGACCCGGAAAAATGC. Inner Left Sequence: TTGTGTATTATACCCCCGCC. Inner Right Sequence: AAAAGCGGTAAGAAACCCGT. Inner Primer WT PCR Product: 3077. Deletion size: 1133 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB944 |
F27D9.7(ok831) X. |
C. elegans |
F27D9.7. Homozygous. Outer Left Sequence: TGGCATCCAATCAACGAATA. Outer Right Sequence: GGAAGCTGAGCCAAATTCAC. Inner Left Sequence: CTGCTAGGCCAGCTGAAGTT. Inner Right Sequence: CCCAACGAGTCCAGATCACT. Inner Primer WT PCR product: 3364. Deletion size: 1896 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB945 |
T04C9.4(ok832). |
C. elegans |
T04C9.4. Homozygous. Outer Left Sequence: ATTTTGCATCGGGTCATTGT. Outer Right Sequence: CTTGTTTCACCTACGGGCTC. Inner Left Sequence: GGAACGAAAGTACCAGGGGT. Inner Right Sequence: CCCTTAATGTTTGCCACGTC. Inner Primer WT PCR product: 2377. Deletion size: 1189 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB946 |
ric-19(ok833). |
C. elegans |
C32E8.7. Homozygous. Outer Left Sequence: TGGGAAAGCTCGAACAAAGT. Outer Right Sequence: ATAAGAAAGGAGGGTGCCGT. Inner Left Sequence: ATTTCGCATGGTTAAGACCG. Inner Right Sequence: AGCGGGATGAATGCAGATAG. Inner Primer WT PCR product: 3019. Deletion size: 1671 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB947 |
zyx-1(ok834) II. |
C. elegans |
F42G4.3b. Homozygous. Outer Left Sequence: AAACCTTTACGCAACGATGG. Outer Right Sequence: TGGAAGGAAGGGGAGATTTT. Inner Left Sequence: CGAGCTTGAATGTTTCACGA. Inner Right Sequence: TAAACTATGATCCCTGCGCC. Inner Primer WT PCR Product: 2803. Deletion size: 599 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB948 |
C18G1.2(ok835) V. |
C. elegans |
C18G1.2. Homozygous. Outer Left Sequence: TCTCTCCGGGCTCTTTGTTA. Outer Right Sequence: ATCTGTCCCTGGTCTCATCG. Inner Left Sequence: ACTATCATGAATGAGCCGCC. Inner Right Sequence: GCGCATAGAACACGGTACAA. Inner Primer WT PCR Product: 2204. Deletion size: 498 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB949 |
cnk-1(ok836) III. |
C. elegans |
R01H10.8. Homozygous. Outer Left Sequence: TGTGTTGAGCAGTGGAAAGG. Outer Right Sequence: TTGGCTGGCCATACTCAAAT. Inner Left Sequence: TATTTGGGCATGATTCGTGA. Inner Right Sequence: TTCGAACATAACCATCCGGT. Inner Primer WT PCR product: 3263. Deletion size: 2143 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB950 |
cup-4(ok837) III. |
C. elegans |
C02C2.3. Homozygous. Outer Left Sequence: GATCAGCCCTACCCATGCTA. Outer Right Sequence: GTCGAAAAGGCCAATGATGT. Inner Left Sequence: AAACAATTGGAAGCGACACC. Inner Right Sequence: CACACAGTTACGCAAATCGG. Inner Primer WT PCR product: 2287. Deletion size: 1107 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB951 |
lin-13(ok838) III. |
C. elegans |
C03B8.4. Homozygous. Outer Left Sequence: TCCTGCATTCGAAGCTCTTT. Outer Right Sequence: ACTCACCCATCGAGTTTTGC. Inner Left Sequence: TTCTACCGTCTTCGTACCCG. Inner Right Sequence: CACCATCACAAGACGGAATG. Inner Primer WT PCR Product: 3097. Deletion size: 1451 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB952 |
ZK822.3(ok847). |
C. elegans |
ZK822.3. Homozygous. Outer Left Sequence: CTGAATCGCCGTAATCCAGT. Outer Right Sequence: TTTGCTGTAGGCCTGCGTAT. Inner Left Sequence: AAACTCAACGCCTCGAAAAA. Inner Right Sequence: AATGCAGGTGTAGGTAGGCG. Inner Primer WT PCR product: 3318. Deletion size: 2277 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB953 |
C16C10.5(ok848) III. |
C. elegans |
C16C10.5. Homozygous. Outer Left Sequence: CTCGAATTGGAGCAGCTTTC. Outer Right Sequence: CTGGTCAATTCACGCAGAGA. Inner Left Sequence: ATCCCATCCATGTGGTGAGT. Inner Right Sequence: AAAGAAGCAAAACGCCAAAA. Inner Primer WT PCR Product: 2161. Deletion size: 1397 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB954 |
mml-1(ok849) III. |
C. elegans |
T20B12.6. Homozygous. Outer Left Sequence: TTCTGTGGTGGCTGCTAGTG. Outer Right Sequence: AAAGCGACAAGAAACATCCG. Inner Left Sequence: TGCTACAGACGATGCGAAAG. Inner Right Sequence: CAATTGAAAGCAAGTTGCGA. Inner Primer WT PCR product: 2807. Deletion size: 1390 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB955 |
F34H10.4(ok850) X. |
C. elegans |
F34H10.4. Homozygous. Outer Left Sequence: AGACAATTTCCGTCCGTCAC. Outer Right Sequence: CCCTCTTCTGAGTTTTCCCC. Inner Left Sequence: TTCTCCCCTTTTTGCATGTC. Inner Right Sequence: GTGTCTTTTGTTCCGACGGT. Inner Primer WT PCR product: 2628. Deletion size: 2095 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB956 |
F48E8.7(ok851). |
C. elegans |
F48E8.7. Homozygous. Outer Left Sequence: CAAAAGCATTGAAGTCAGCG. Outer Right Sequence: GCTTTTGGTGGGAGAAACAA. Inner Left Sequence: TCAGTGATCTCCTCCAGCAA. Inner Right Sequence: CGAAAATTCAGATTTGCGGT. Inner Primer WT PCR product: 2125. Deletion size: 698 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB957 |
F40F9.1(ok852). |
C. elegans |
F40F9.1. Homozygous. Outer Left Sequence: TCCAAAGCCTTGGTCAGTTT. Outer Right Sequence: ATCGATGAAGTCGGGTGAAG. Inner Left Sequence: TTGCGAAATCACACGTCTTC. Inner Right Sequence: CTTCCTTCGACAAGACAGCC. Inner Primer WT PCR product: 2691. Deletion size: 1720 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB958 |
hst-2(ok855) X. |
C. elegans |
C34F6.4. Homozygous. Outer Left Sequence: CCCTATCTACTGCCAGCGAG. Outer Right Sequence: GCGTCAGCAAAAAGAACACA. Inner Left Sequence: GAAATCGATGGAGGACGAGA. Inner Right Sequence: GCTGTGGAAAAAGCGAAAAG. Inner Primer WT PCR product: 3132. Deletion size: 1389 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB959 |
pgp-5(ok856) X. |
C. elegans |
C05A9.1. Homozygous. Outer Left Sequence: ACTACCACTGGGTCCCACAA. Outer Right Sequence: CTCTTGGGGCAAAATGAAAA. Inner Left Sequence: TTCTGCCTGCTGGAAGTTTT. Inner Right Sequence: CAGCAGCAAGAAGTTGAACG. Inner Primer PCR Length: 3006 bp. Deletion Size: 928 bp. Deletion left flank: CACCATCCAAAATCATTTTGTCTGAGCGCT. Deletion right flank: TTCTGCTGTTTTACCGAAGAAATAATATTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB960 |
exl-1(ok857) II. |
C. elegans |
F26H11.5. Homozygous. Outer Left Sequence: AGCGATGGATTTCGATTGAC. Outer Right Sequence: AAGGCACATGCCTAAAATGC. Inner Left Sequence: CAATCGAGTTCATCCCAACC. Inner Right Sequence: TTCCCAAAATTTCTTCTGCG. Inner Primer WT PCR product: 2197. Deletion size: 615 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB961 |
cey-4(ok858) III. |
C. elegans |
Y39A1C.3. Homozygous. Outer Left Sequence: GGGAACTGCAGCTACTCGAC. Outer Right Sequence: GAAAAAGTGTGCCAGGGTGT. Inner Left Sequence: AACTTCGTTACGCGATCCAC. Inner Right Sequence: AAAATTGAAAATTGCCGTCG. Inner Primer WT PCR product: 2225. Deletion size: 639 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB963 |
F07C6.4b(ok860) IV. |
C. elegans |
F07C6.4b. Homozygous. Outer Left Sequence: TGATTGACTTGCTGCTGACC. Outer Right Sequence: AGGGTAAAGGAAGGGCTCAA. Inner Left Sequence: CCTGTGCGTTTTTGGTTTTT. Inner Right Sequence: CAGGAGGATGGAGCATTGAT. Inner Primer WT PCR product: 2719. Deletion size: 2238 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB964 |
cku-80(ok861) III. |
C. elegans |
R07E5.8. Homozygous. Outer Left Sequence: CTTGAAAAACGCACGCATTA. Outer Right Sequence: TTCTGACATGCTGACTTCGG. Inner Left Sequence: GTTACAGGAATGCCGCCTAA. Inner Right Sequence: TTGTTGAATGAGGAATGGCA. Inner Primer WT PCR Product: 3314. Deletion size: 1646 bp; includes 315-bp insertion at break. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB965 |
W10C8.1(ok862). |
C. elegans |
W10C8.1. Homozygous. Outer Left Sequence: TCCAGGCGTATCTTCATTCC. Outer Right Sequence: ACTTTTTCCGGATCAGGGTT. Inner Left Sequence: GATCAACACCGGAAGGATGT. Inner Right Sequence: TTTTCGATTTCGCATTTTCC. Inner Primer WT PCR product: 2962. Deletion size: 1193 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB966 |
K01D12.11(ok863) V. |
C. elegans |
K01D12.11. Homozygous. Outer Left Sequence: CGGACGCTGGTACTTCTTCT. Outer Right Sequence: GGGTCCATGAAAGAACTGGA. Inner Left Sequence: CTGGGACACCAACTGGAACT. Inner Right Sequence: CCTATTACCCGTTCCCCAAT. Inner Primer WT PCR product: 3033. Deletion size: 1259 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB967 |
Y81G3A.3(ok871) II. |
C. elegans |
Y81G3A.3. Homozygous. Outer Left Sequence: TGTGGACCCGAAACAGTACA. Outer Right Sequence: AACACATCGGCTTCAATTCC. Inner Left Sequence: GGTTTCGGTGATGTCGTTCT. Inner Right Sequence: GTTTTCGGGATATTCGCAGA. Inner Primer WT PCR product: 2833. Deletion size: 1481 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB968 |
rgs-4(ok872) II. |
C. elegans |
Y38E10A.21. Homozygous. Outer Left Sequence: TAAGCGGCTGAGCTATGGTT. Outer Right Sequence: AGACGACGAGAGAAACGAGC. Inner Left Sequence: AGTTTCCGTTGCCAATGAAC. Inner Right Sequence: TCCTTGTAGGCGTTTGTGTG. Inner Primer WT PCR product: 3078. Deletion size: 2103 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB969 |
fat-2(ok873) IV. |
C. elegans |
W02A2.1. Homozygous. Outer Left Sequence: ATGTGATGTGATGCTGGGAA. Outer Right Sequence: TTGCTTTCTTTCGGCAAACT. Inner Left Sequence: CAATGCACCATATTTCACGC. Inner Right Sequence: ATCAGAAATTTGCCGGTTTG. Inner Primer WT PCR product: 2728. Deletion size: 1224 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB970 |
ddr-1(ok874) X. |
C. elegans |
C25F6.4. Homozygous. Outer Left Sequence: CATAGCGACTGAAAAACGGG. Outer Right Sequence: GTTGAGCATGATGTGATGGC. Inner Left Sequence: TGGACGGAAACTTTGACACA. Inner Right Sequence: GGAATTCACCGTCCATGAGT. Inner Primer WT PCR product: 3323. Deletion size: 2974 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB971 |
zipt-16(ok875). |
C. elegans |
T11F9.2. Homozygous. Outer Left Sequence: CTTCACAGCTCATCCACCAG. Outer Right Sequence: GAAACGGGCAATTCAAGTGT. Inner Left Sequence: GGCAACTACACAGAAGCCGT. Inner Right Sequence: TAACAAAGCAGGGATGGGAG. Inner Primer WT PCR Product: 2503. Deletion size: 595 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB972 |
T01D3.5(ok876) V. |
C. elegans |
T01D3.5. Homozygous. Outer Left Sequence: GTGCTTGGCCAATTTTTCAT. Outer Right Sequence: CAGTTTTATCGGCGCTTCAT. Inner Left Sequence: TGAAACGCGGATAACATTGA. Inner Right Sequence: TCAGACAATGGAGGGGGTAA. Inner Primer WT PCR product: 2100. Deletion size: 1150 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB973 |
Y76A2B.6(ok877) III. |
C. elegans |
Y76A2B.6. Homozygous. Outer Left Sequence: GGGGAAATGGTGTGAGTGAT. Outer Right Sequence: ACCGATTCTCTGCATTCACC. Inner Left Sequence: TTCGGAACATACGGAGGAAG. Inner Right Sequence: TGAAACCCCTGGAGAAAATG. Inner Primer WT PCR product: 3043. Deletion size: 2533 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB974 |
gem-4(ok878) IV. |
C. elegans |
T12A7.1. Homozygous. Outer Left Sequence: TGAACGCTGACCTGAGTTTG. Outer Right Sequence: ATCATATTCGTCTGGCGGAG. Inner Left Sequence: GACGCGATTTGTAGCCTAGC. Inner Right Sequence: GTCTCTTTGCCATGGATCGT. Inner Primer WT PCR product: 3269. Deletion size: 1719 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB975 |
T27F2.2(ok879). |
C. elegans |
T27F2.2. Homozygous. Outer Left Sequence: TTTTTCAGGCGTTCCATTTC. Outer Right Sequence: TTATCAGTGCGGATCAACCA. Inner Left Sequence: GCAAAATCGCAAACCTGAAT. Inner Right Sequence: CGACACACATTCGATATGGC. Inner Primer WT PCR Product: 2884. Deletion size: 2524 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB976 |
rhgf-1(ok880) X. |
C. elegans |
F13E6.6. Homozygous. Outer Left Sequence: TTACTTTGGCCACACCATCA. Outer Right Sequence: GCATTCAAGTCAAAGGGCAT. Inner Left Sequence: CGTAGTTTGCGCACTCACAT. Inner Right Sequence: TGTAGGGATGCTATCTGGGG. Inner Primer WT PCR product: 3285. Deletion size: 1171 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB977 |
lst-1(ok814) I. |
C. elegans |
T22A3.3. Homozygous. Outer Left Sequence: CGAAAGGGGAGTGGGTTACT. Outer Right Sequence: TTTGCACAGAATTCGCTCAC. Inner Left Sequence: ACATCTTAAAGGCGCACACC. Inner Right Sequence: CAGGAAAAAGAGGGAAAGGC. Inner Primer WT PCR product: 2631. Deletion size: 727 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB978 |
F32F2.1(ok884) V. |
C. elegans |
F32F2.1. Homozygous. Outer Left Sequence: ATCTACCAACACTGGGACGC. Outer Right Sequence: TTTCCAATTGAACCCCGTAA. Inner Left Sequence: AGTTGCAGTTGCAGGTGTTG. Inner Right Sequence: GGTCCGAGAGCTAGTTGCAC. Inner Primer WT PCR product: 3161. Deletion size: 1337 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB979 |
F28B3.1(ok885) I. |
C. elegans |
F28B3.1. Homozygous. Outer Left Sequence: TTCAAAATACCAAAAGCCGC. Outer Right Sequence: ATTGTTTCCACCGTTTTGGA. Inner Left Sequence: TTCTCATGTGCCCACACAAT. Inner Right Sequence: CAGTAATCCTCCTAGGCCCC. Inner Primer WT PCR product: 3046. Deletion size: 1112 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB980 |
Y81G3A.3(ok886) II. |
C. elegans |
Y81G3A.3. Homozygous. Outer Left Sequence: TGTGGACCCGAAACAGTACA. Outer Right Sequence: AACACATCGGCTTCAATTCC. Inner Left Sequence: GGTTTCGGTGATGTCGTTCT. Inner Right Sequence: GTTTTCGGGATATTCGCAGA. Inner Primer WT PCR product: 2833. Deletion size: 1179 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB981 |
F19F10.5(ok888) V. |
C. elegans |
F19F10.5. Homozygous. Outer Left Sequence: ACACCAGTTGCAATTCTCCC. Outer Right Sequence: AGTTTGGGTGAGAACCAACG. Inner Left Sequence: TTTCGCAGAATTTCGAGGAT. Inner Right Sequence: CTGTCGGCAAGAAGAAAAGG. Inner Primer WT PCR product: 2581. Deletion size: 2158 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB982 |
flp-21(ok889) V. |
C. elegans |
C26F1.10. Homozygous. Outer Left Sequence: TCTGATGCGTTTACAGTCGG. Outer Right Sequence: TTTTCTTGTTCAACGGCCTC. Inner Left Sequence: TTAAGCGGAGCACACTTCCT. Inner Right Sequence: GGCAATTGAAAATTGTTGCC. Inner Primer WT PCR product: 3182. Deletion size: 1786 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB983 |
ver-2(ok897) I. |
C. elegans |
T17A3.8. Homozygous. Outer Left Sequence: AAAAACTCGGCGTTTGTTTG. Outer Right Sequence: TTTAAACGTCTCCCGGTACG. Inner Left Sequence: TTTGTACAACTGGCTCAGCG. Inner Right Sequence: ACTCAGCCATCAGATCCCAG. Inner Primer WT PCR product: 3128. Deletion size: 1543 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB984 |
sra-11(ok898) II. |
C. elegans |
F44F4.13. Homozygous. Outer Left Sequence: ATGTGGACAATAAGGGCAGC. Outer Right Sequence: CTTTGCTCCGCCTATTTGAG. Inner Left Sequence: CAATTTCGCACGGAATCTTT. Inner Right Sequence: CACCAACCGGTCTCAATTTT. Inner Primer WT PCR product: 2100. Deletion size: 615 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB985 |
sra-11(ok899) II. |
C. elegans |
F44F4.13. Homozygous. Outer Left Sequence: ATGTGGACAATAAGGGCAGC. Outer Right Sequence: CTTTGCTCCGCCTATTTGAG. Inner Left Sequence: CAATTTCGCACGGAATCTTT. Inner Right Sequence: CACCAACCGGTCTCAATTTT. Inner Primer WT PCR product: 2100. Deletion size: 1004 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB986 |
Y55F3AM.6(ok900) IV. |
C. elegans |
Y55F3AM.6. Homozygous. Outer Left Sequence: GTCGCATTTCCGTTCATTTT. Outer Right Sequence: ACGTCTCATTACGGGATTCG. Inner Left Sequence: AAATGCCACGTCATGAAACA. Inner Right Sequence: TTTGGGTCCAGAAAAGCAAG. Inner Primer WT PCR product: 2766. Deletion size: 1184 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB987 |
sbt-1(ok901) V. |
C. elegans |
T03D8.3. Homozygous. Outer Left Sequence: TTCAGGCAAATCCATCATCA. Outer Right Sequence: GCCGTTGATAAAGGAGGTCA. Inner Left Sequence: TTTTGCCACCAATTCCATCT. Inner Right Sequence: AGTCGTTGCAGACGTCAATG. Inner Primer WT PCR Product: 2959. Deletion size: 1382 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB988 |
cey-2(ok902) I. |
C. elegans |
F46F11.2. Homozygous. Outer Left Sequence: GAGGAAGCTCTCGAGCAGAA. Outer Right Sequence: GCAGACGCTATTGACGCATA. Inner Left Sequence: ACAGCGAAGAGAAGATGCGT. Inner Right Sequence: GGCTGAAACGTTCCTTTTTG. Inner Primer WT PCR Product: 2816. Deletion size: 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB989 |
pros-1(ok903). |
C. elegans |
K12H4.1. Homozygous. Outer Left Sequence: TGACGAAATCAAAATGCCAA. Outer Right Sequence: AATGAGGAAGACGAGCTCCA. Inner Left Sequence: ATCCCGACAAAATCGAAAAA. Inner Right Sequence: GTCGGGAATCTGATCTTCCA. Inner Primer WT PCR Product: 2816. Deletion size: 1315 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB990 |
F59G1.1a(ok911) II. |
C. elegans |
F59G1.1a. Homozygous. Outer Left Sequence: CAGAACGACTCGATCCACAA. Outer Right Sequence: AGCGGATAAAGTGCAGAACG. Inner Left Sequence: ATCCGATGGAAGTTGCAAAA. Inner Right Sequence: TACGCAGGCATCATGTTGTT. Inner Primer WT PCR product: 3116. Deletion size: 849 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB991 |
C26H9A.2(ok912) IV. |
C. elegans |
C26H9A.2. Homozygous. Outer Left Sequence: ATGTCGAAAATGCCCAAAAC. Outer Right Sequence: AAGTCTGAACCAGGGGTGTG. Inner Left Sequence: CCCTGAGCGAGCACTTATTC. Inner Right Sequence: CGTGTTCAAAACTGCAAGGA. Inner Primer WT PCR Product: 2824. Deletion size: 1250 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB992 |
unc-104(ok913). |
C. elegans |
C52E12.2. Homozygous. Outer Left Sequence: AAGGTTTTGGAAAGATCGCA. Outer Right Sequence: CGACTTTCCTTGGAGCTCTG. Inner Left Sequence: CATTTGCTTCTTTTCCCTGC. Inner Right Sequence: GGCTCACATCTCCACAGTCA. Inner Primer WT PCR product: 3024. Deletion size: 1285 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB993 |
tdc-1(ok914) II. |
C. elegans |
K01C8.3. Homozygous. Outer Left Sequence: AACGGTGCATTTTTCAGGAC. Outer Right Sequence: GGACGTTGAGAATGCGAAAT. Inner Left Sequence: AAATGGTTTACGGGCTTGG. Inner Right Sequence: ATGGTTGGCCATGTTGAGAT. Inner Primer WT PCR product: 2713. Deletion size: 629 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB994 |
B0024.10(ok915) V. |
C. elegans |
B0024.10 Homozygous. Outer Left Sequence: TTGACGACGAACAGCTTGAC. Outer Right Sequence: TCAATCGAGCTTCACAGCAC. Inner Left Sequence: CATTTTGGCATAGCGGATTT. Inner Right Sequence: GTTTGTTGAAGCGAAGGAGC. Inner Primer WT PCR Product: 2517. Deletion size: 1140 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB995 |
hpl-2(ok916) III. |
C. elegans |
K01G5.2a. Homozygous. Outer Left Sequence: TTCTATGCTCATCGTTCCCC. Outer Right Sequence: CAGTCGGTGAGTTTGGGAAT. Inner Left Sequence: TTTTTACGGGCGAAATTCAG. Inner Right Sequence: TTCTGAGAATGCGTATTGCG. Inner Primer WT PCR product: 2399. Deletion size: 1739 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB996 |
hpl-2(ok917) III. |
C. elegans |
K01G5.2a. Homozygous. Outer Left Sequence: TTCTATGCTCATCGTTCCCC. Outer Right Sequence: CAGTCGGTGAGTTTGGGAAT. Inner Left Sequence: TTTTTACGGGCGAAATTCAG. Inner Right Sequence: TTCTGAGAATGCGTATTGCG. Inner Primer WT PCR product: 2399. Deletion size: 779 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB998 |
php-3(ok919) III. |
C. elegans |
Y75B8A.1 Homozygous. Outer Left Sequence: TAATGGGACAGAAAGGCACC. Outer Right Sequence: CTACTTGCTCCTCCGTCGAG. Inner Left Sequence: TTGACGCGCAAAATATCTCA. Inner Right Sequence: CAATGCCACAGAGAAAAGCA. Inner Primer PCR Length: 2951. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB999 |
Y73F8A.25(ok920) IV. |
C. elegans |
Y73F8A.25. Homozygous. Outer Left Sequence: AAAGTTGCAGTGGGGAAATG. Outer Right Sequence: AAGCGAATACGGATCATTGG. Inner Left Sequence: TTTCACGGAATTCTGGCTTC. Inner Right Sequence: TCTGAGCAAATTTTCCGCTT. Inner Primer WT PCR Product: 2305. Deletion size: 920 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |