Laboratory Information

NameRB View on WormBase
Allele designationok
HeadBarstead, Robert
InstitutionOklahoma Med Research Foundation, Oklahoma City, OK
Address Program in Molecular and Cell Biology Oklahoma Medical Research Foundation 825 N.E. 13th Street Oklahoma City, OK 73104

Website http://mcbi.ouhsc.edu/barstead/
Gene classes

Strains contributed by this laboratory

Strain Genotype Species Description
MT12755 ceh-32(ok343) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc. ok343 is lethal or has a linked lethal.
RB1000 gcy-5(ok921) II. C. elegans ZK970.6 Homozygous. Outer Left Sequence: CGGTGTCATTTCAGAGAGCA. Outer Right Sequence: GTTGAGGCAACCTTAAGCGA. Inner Left Sequence: TTGCTCAGCTTTTGGCCTAT. Inner Right Sequence: AGTGCGGATTGTCTGGAAAG. Inner Primer WT PCR Product: 3316. Deletion size: 1545 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1001 C01F6.1(ok922) IV. C. elegans C01F6.1 Homozygous. Outer Left Sequence: GGTTTTAGGAAACGGCATCA. Outer Right Sequence: AGCGTTACGAATTTTGGCAC. Inner Left Sequence: CTAGCAGGAGTGGTCTTGCC. Inner Right Sequence: GGATCAAAATGGAACATCCG. Inner Primer WT PCR Product: 2438. Deletion size: 1583 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1002 T19D2.1(ok923) X. C. elegans T19D2.1. Homozygous. Outer Left Sequence: GAGGAAATCGCGATGAAGAG. Outer Right Sequence: TCTCCGCAGTTTACAGAGCA. Inner Left Sequence: AGAGTTGGCTGTATTTGCGG. Inner Right Sequence: CGGCACATTCTGAAAGTCAA. Inner Primer WT PCR Product: 3298. Deletion size: 1666 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1003 aco-1(ok924) X. C. elegans ZK455.1. Previously called gei-22. Homozygous. Outer Left Sequence: CACACACAAAAACGGACAGG. Outer Right Sequence: TCGTTGCTCCAAATCACAAA. Inner Left Sequence: AGACGAGCTTCCAATCTCCA. Inner Right Sequence: TTCCTCCGTTGCGGTAATAG. Inner Primer WT PCR product: 2984. Deletion size: 540 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1004 K08E3.4(ok925). C. elegans K08E3.4. Homozygous. Outer Left Sequence: GGATGGACTCGAACCAAAAA. Outer Right Sequence: TTCTGGAGGGTCTCTGCCTA. Inner Left Sequence: TTGCAGGAAACACAACGAAG. Inner Right Sequence: CAAATTTGCCATATGTTGCG. Inner Primer WT PCR product: 2983. Deletion size: 1146 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1005 R02D3.1(ok926) IV. C. elegans R02D3.1. Homozygous. Outer Left Sequence: TGTTCAAGCGTAACACGACC. Outer Right Sequence: AAACCATTTGGATTGCCGTA. Inner Left Sequence: CAGATGTCTGCCGCTGTAAC. Inner Right Sequence: TTCAACACAACCAAATCCGA. Inner Primer WT PCR product: 3055. Deletion size: 923 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1006 C08B6.4(ok890) V. C. elegans C08B6.4. Homozygous. Outer Left Sequence: AACACAACGAGGGACCTGAC. Outer Right Sequence: TGAACGCATCTGGATCATGT. Inner Left Sequence: GAGTCGGGGAAAAAGGGATA. Inner Right Sequence: GGTCGACCTAATGGAGACCA. Inner Primer WT PCR product: 2177. Deletion size: 1624 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1007 C16C10.12(ok927) III. C. elegans C16C10.12. Homozygous. Outer Left Sequence: GAGAAAGTGAGCTCCGCAAT. Outer Right Sequence: GCCTACAAAAATGCCATTCG. Inner Left Sequence: ATCACATCGAGGCAAGCTCT. Inner Right Sequence: CAATCGATACAAGCAGCCAA. Inner Primer WT PCR Product: 2693. Deletion size: 635 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1008 cri-2(ok928) V. C. elegans K07C11.5. Homozygous. Outer Left Sequence: GAACGGCCTATGGTGACACT. Outer Right Sequence: TGAGCAGAACGAAAGGAGGT. Inner Left Sequence: GACAATTGTTTTTGGACGGG. Inner Right Sequence: CCGAGCAAATTTGGAAACAT. Inner Primer WT PCR product: 2642. Deletion size: 1680 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1009 Y48C3A.14(ok929) II. C. elegans Y48C3A.14 [Merged Y48C3A.15 in to this gene based on BLASTX homologies.] Homozygous. Outer Left Sequence: GACACCCTTGGTGTTCAGGT. Outer Right Sequence: ATCACTTTTCCTCGGGGAGT. Inner Left Sequence: TTGTGGCGACTCTGATGAAG. Inner Right Sequence: ACGAACATTTGAATTTCCCG. Inner Primer WT PCR Product: 2998. Deletion size: 2275 bp; includes insertion of approximately 1150 bp at break. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1010 gcy-5(ok930) II. C. elegans ZK970.6. Homozygous. Outer Left Sequence: CGGTGTCATTTCAGAGAGCA. Outer Right Sequence: GTTGAGGCAACCTTAAGCGA. Inner Left Sequence: TTGCTCAGCTTTTGGCCTAT. Inner Right Sequence: AGTGCGGATTGTCTGGAAAG. Inner Primer WT PCR Product: 3316. Deletion size: 2542 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1011 crb-1(ok931) X. C. elegans F11C7.4 Homozygous. Outer Left Sequence: TGAATCTTTGCAATTCGTGG. Outer Right Sequence: CTTGGTGTTCAACATGACCG. Inner Left Sequence: ATTGGCAAACGATTTTCTCG. Inner Right Sequence: CAGTCAACGGACAGCTTGAA. Inner Primer WT PCR Product: 3232. Deletion size: 843 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1012 egl-8(ok934) V. C. elegans B0348.4a Homozygous. Outer Left Sequence: ACATCCGGAGCTAAAGCAGA. Outer Right Sequence: CGCCGAGAAAGCAATAGAAC. Inner Left Sequence: TGCTACCTATTGGGTTTCGG. Inner Right Sequence: TGGCCGAGTTTTCTCATCTC. Inner Primer PCR Length: 2928. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1013 pax-2(ok935) IV. C. elegans K06B9.5. Homozygous. Outer Left Sequence: GGGCAGAACACGAATTTTTC. Outer Right Sequence: GCACATCCCTGGTTGAAACT. Inner Left Sequence: CGCAAATTTGGTCCTGAAAT. Inner Right Sequence: CTCCGCCTACTGTTAGCTCG. Inner Primer WT PCR product: 2959. Deletion size: 1620 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1014 unc-73(ok936) I. C. elegans F55C7.7D Homozygous. Outer Left Sequence: ATACGAGGAGCTGCTGGAGA. Outer Right Sequence: TTTCGAGGATCCGATGATTC. Inner Left Sequence: TATCCCCTGGTAAAGGGACC. Inner Right Sequence: ACGAGAGCACGTAACCGTCT. Inner Primer PCR Length: 3353. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1015 nhr-66(ok940). C. elegans T09A12.4. Homozygous. Outer Left Sequence: GGTATCTGCCTTGTTCTGCC. Outer Right Sequence: GAAACGATGCTCATGCTCAA. Inner Left Sequence: AACCGCGAACAACGAGTTAC. Inner Right Sequence: CAGGGGAACCGCTAGACATA. Inner Primer WT PCR product: 3091. Deletion size: 1317 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1017 nab-1(ok943). C. elegans C43E11.6. Homozygous. Outer Left Sequence: ATCGCAATTTTCTCCATTCG. Outer Right Sequence: GCGTACTTCTTTCGGAGTGG. Inner Left Sequence: TATTCCGATTCCACACAGCA. Inner Right Sequence: CGATGCGTCAATTTATGTGG. Inner Primer WT PCR Product: 3254. Deletion size: 1032 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1018 cgr-1(ok944) X. C. elegans T27A10.7. Homozygous. Outer Left Sequence: TCCATGCGAATTGTTGAAAA. Outer Right Sequence: ATCCGCATCTGAATGAGCTT. Inner Left Sequence: TGTCTCCACTGCTAACACGC. Inner Right Sequence: CCGCCCATCAAAAAGATAAA. Inner Primer WT PCR product: 2628. Deletion size: 1242 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1019 pax-2(ok946) IV. C. elegans K06B9.5. Homozygous. Outer Left Sequence: GGGCAGAACACGAATTTTTC. Outer Right Sequence: GCACATCCCTGGTTGAAACT. Inner Left Sequence: CGCAAATTTGGTCCTGAAAT. Inner Right Sequence: CTCCGCCTACTGTTAGCTCG. Inner Primer WT PCR product: 2959. Deletion size: 712 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1020 C26D10.4(ok947) II. C. elegans C26D10.4. Homozygous. Outer Left Sequence: GTTACTGAATTGCCGTGCCT. Outer Right Sequence: CAAAAGTGTACCGCTGGGTT. Inner Left Sequence: AAAAATCACGAGATTCCGCA. Inner Right Sequence: CATCATCATTGATCGCTTGG. Inner Primer WT PCR Product: 3275. Deletion size: 1473 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1021 crt-1(ok948) V. C. elegans Y38A10A.5. Homozygous. Outer Left Sequence: TATGGCACTTCGTCAGATGG. Outer Right Sequence: CATTGTCGTAGCAGACGAGC. Inner Left Sequence: TGTCGAGAGGAATCGATGTG. Inner Right Sequence: TTTGCTCTTGTTCGGTTTCA. Inner Primer WT PCR product: 2134. Deletion size: 1287 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1022 R11A5.2(ok949) I. C. elegans R11A5.2. Homozygous. Outer Left Sequence: AATGCTGGCGTTCTCTGTCT. Outer Right Sequence: TGCTGCCTATCGTGAGTTTG. Inner Left Sequence: TGAAATGGAGGATCCCTGAG. Inner Right Sequence: ATTTCGTGTGGGAAATTGGA. Inner Primer WT PCR product: 2183. Deletion size: 1109 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1023 C49C8.4(ok950) IV. C. elegans C49C8.4. Homozygous. Outer Left Sequence: CCCCTTGTGCTACGAAAAGA. Outer Right Sequence: CTCCCTTTTCTGACCTGCTG. Inner Left Sequence: AGGTTACGGTATCGGTGCTG. Inner Right Sequence: TTCACTGGCGTGTATTTTGG. Inner Primer WT PCR product: 2871. Deletion size: 1439 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1024 drh-2(ok951) IV. C. elegans C01B10.1. Homozygous. Outer Left Sequence: TTGTTTGAACATCTCGCTGC. Outer Right Sequence: CGGTTTTGGGAGGATGAATA. Inner Left Sequence: TTGGGGCTCACTCTCACTTT. Inner Right Sequence: CCGTAGGGGTGCAAAACTAA. Inner Primer WT PCR product: 3101. Deletion size: 789 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1025 set-2(ok952) III. C. elegans C26E6.9a. Homozygous. Outer Left Sequence: TATAGGTCCCCATGGAGCTG. Outer Right Sequence: GGCCTGAATCAAGAAATGGA. Inner Left Sequence: TGCACGGTGAATGATCAAAT. Inner Right Sequence: CATCGGGAAGCTCTTCTGTC. Inner Primer WT PCR product: 3324. Deletion size: 1269 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1026 R03E9.3(ok953) X. C. elegans R03E9.3. Homozygous. Outer Left Sequence: AAAATGGCGAAAGGGCTAGT. Outer Right Sequence: CGGAACTACGGTAAATGCGT. Inner Left Sequence: GCCGACATTTTGGAAAAGAA. Inner Right Sequence: TTTTGCCGTTCTAGGTGTCC. Inner Primer WT PCR product: 2667. Deletion size: 1196 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1027 R03E9.3(ok954) X. C. elegans R03E9.3. Homozygous. Outer Left Sequence: AAAATGGCGAAAGGGCTAGT. Outer Right Sequence: CGGAACTACGGTAAATGCGT. Inner Left Sequence: GCCGACATTTTGGAAAAGAA. Inner Right Sequence: TTTTGCCGTTCTAGGTGTCC. Inner Primer WT PCR product: 2667. Deletion size: 832 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1028 mrp-3(ok955) X. C. elegans E03G2.2. Homozygous. Outer Left Sequence: GCCTGAGATCAACGACTTCC. Outer Right Sequence: CACAAACTATTGGTGTGGCG. Inner Left Sequence: TGTCTTTTGCGAGTCGATTG. Inner Right Sequence: TGTCAAGTTGTCTGCTTGGG. Inner Primer WT PCR Product: 3071. Deletion size: 658 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1029 hdl-1(ok956) IV. C. elegans ZK829.2. Homozygous. Outer Left Sequence: TCTCGGCATGTTGTTAGCTG. Outer Right Sequence: TTGGCTGCTGTTCTGATACG. Inner Left Sequence: TGAAGAGGAAGCTTTTGGGA. Inner Right Sequence: CCGGAAAAGTCTTGATTGGA. Inner Primer WT PCR Product: 3232. Deletion size: 895 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1030 snf-9(ok957) IV. C. elegans C49C3.1 Homozygous. Outer Left Sequence: CTATTGTCAGGGACTCGGGA. Outer Right Sequence: TGACATGTTTCCACGGCTTA. Inner Left Sequence: CTGGAGATTTCCGACGAGAG. Inner Right Sequence: CGGGGGTATAGTGGGCTAAT. Inner Primer PCR Length: 3002. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1031 fat-4(ok958) IV. C. elegans T13F2.1. Homozygous. Outer Left Sequence: AAATACGGTCTTGACACGCC. Outer Right Sequence: CAGGCATTGCGCCTATAAAT. Inner Left Sequence: CGCACACCTTTGCTCATTTA. Inner Right Sequence: AAACAGTAAGCGCATCCACC. Inner Primer WT PCR product: 3114. Deletion size: 715 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1032 osr-1(ok959) I. C. elegans C32E12.3. Homozygous. Outer Left Sequence: CGAATATTCCCGAAAAACGA. Outer Right Sequence: CCACGACTTCTCCCTTTCAA. Inner Left Sequence: AATCCCAGTGCAGGCATATC. Inner Right Sequence: ATTTCCAGCACCATTATCGG. Inner Primer WT PCR product: 2824. Deletion size: 983 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1033 C16C10.12(ok962) III. C. elegans C16C10.12. Homozygous. Outer Left Sequence: CGGATTGTCCACTTGAGACC. Outer Right Sequence: TGAAGCAATTTTGTTCAGCG. Inner Left Sequence: GTACGAAGCCGTTCAAAAGC. Inner Right Sequence: GGAGAAGAATGGAACCGTGA. Inner Primer WT PCR product: 3027. Deletion size: 2510 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1034 C36B1.10(ok970) I. C. elegans C36B1.10. Homozygous. Outer Left Sequence: ACAGAGTCGTCTGCTCGGAT. Outer Right Sequence: TCCCTTGGTCTCTGAATCGT. Inner Left Sequence: CGATCTCTTTGGAAACTCGC. Inner Right Sequence: ACCGATGTCTGTTGAAAGCC. Inner Primer WT PCR Product: 3303. Deletion size: 1202 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1035 F22D3.2(ok975) II. C. elegans F22D3.2. Homozygous. Outer Left Sequence: CTTGCCAAATTTGATTGGCT. Outer Right Sequence: ACCAACTTGGCATTTTTCCA. Inner Left Sequence: ACGGTCTCTCGTGTTCTCGT. Inner Right Sequence: TCCGATAACTTCTCGCCAGT. Inner Primer WT PCR Product: 2887. Deletion size: 817 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1036 hyl-1(ok976) IV. C. elegans C09G4.1. Homozygous. Outer Left Sequence: CATAGGCGGTCTAGGAGCAG. Outer Right Sequence: ATGGCGAGCTTTTCTGTCAT. Inner Left Sequence: GCCCCGTAAATAAGCACAAA. Inner Right Sequence: TCGTGTTCTTTCACGTCTCG. Inner Primer WT PCR Product: 2824. Deletion size: 863 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1037 M04F3.4(ok981) I. C. elegans M04F3.4. Homozygous. Outer Left Sequence: GCGAGAAACTGAAGTCGGTC. Outer Right Sequence: ATCCAGCACATCCACAACAA. Inner Left Sequence: GTCAGGAACTGCTCGTAGCC. Inner Right Sequence: ATGGTCAAGCTTCAGCGACT. Inner Primer WT PCR Product: 2480. Deletion size: 328 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1038 C09G4.2(ok966) IV. C. elegans C09G4.2. Homozygous. Outer Left Sequence: TCCAGTGCCTATTTTCTGGG. Outer Right Sequence: TCATTTCGGTGCAAAATTCA. Inner Left Sequence: CATTGAGTTCAAGCCGTTCA. Inner Right Sequence: CTTCTTCCGGATAACCACCA. Inner primer WT PCR product: 2924. Deletion size: 1192 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1039 C17E7.5(ok985) V. C. elegans C17E7.5. Homozygous. Outer Left Sequence: TTCTTGTGCGAAAAATTCCC. Outer Right Sequence: TATGCACCAAACACGCAAAT. Inner Left Sequence: CTCAGACAACTGTGGCGAAA. Inner Right Sequence: ATTGCGCAACGTGAATTTTT. Inner Primer PCR Length: 3294 bp. Deletion Size: 1242 bp. Deletion left flank: AAAACTCCATAAAAATTACCTTTTTAAAAA. Deletion right flank: ACACAGTAGTGTTTAAGCAAGATTTTCTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1041 pgp-15(ok987) X. C. elegans F22E10.4. Homozygous. Outer Left Sequence: GATCTCGAACCAACGCTCTC. Outer Right Sequence: TGGAGTCGCAATGCTTGTAG. Inner Left Sequence: CCTTCTCTCCGACGTCAGTC. Inner Right Sequence: CGTTGCACCCACTTGTATTG. Inner Primer WT PCR product: 3156. Deletion size: 2256 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1042 parp-1(ok988) I. C. elegans Y71F9AL.18. Homozygous. Outer Left Sequence: GTCGGTGTACGGCATTCTTT. Outer Right Sequence: TCATTTTTGGGGGATTTCAG. Inner Left Sequence: TCCCAGAGAAGATCGGATTG. Inner Right Sequence: AAAGAATCGAATCGCAAAGC. Inner Primer WT PCR Product: 2473. Deletion size: 1007 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1043 F25B5.1(ok989) III. C. elegans F25B5.1. Homozygous. Outer Left Sequence: TTTTCAGTCGCCCAATTACC. Outer Right Sequence: ATCATTCAATCCCTTGTGCC. Inner Left Sequence: GGCAGAGGAAGAAGTTGTCG. Inner Right Sequence: TCGTGTTGTCCAGTGAGGAG. Inner Primer WT PCR product: 2735. Deletion size: 1956 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1044 Y47H9C.2(ok990) I. C. elegans Y47H9C.2. Homozygous. Outer Left Sequence: GAGTGAGTTGGTAGCTCCGC. Outer Right Sequence: TGGTGCATCGATCGAAATTA. Inner Left Sequence: GCCACGTGTCGATAACATTG. Inner Right Sequence: CCATGAATCTTTGACGGCTT. Inner Primer PCR Length: 2844 bp. Deletion Size: 890 bp. Deletion left flank: GGTGCGGTCCACGGCTGGTCCCTATATATT. Deletion right flank: ACTATAACAAAAAGAAAACAAATACATTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1045 pgp-10(ok991) X. C. elegans C54D1.1. Homozygous. Outer Left Sequence: AGCTCTTCACTTCCGCGATA. Outer Right Sequence: GTGGCGTTGTACATTCGTTG. Inner Left Sequence: TGGTAGTGGAAAAAGCACCC. Inner Right Sequence: ACCCGGAAGGTCCTACAAGT. Inner Primer WT PCR product: 3218. Deletion size: 2060 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1046 elo-9(ok993) II. C. elegans Y53F4B.2. Homozygous. Outer Left Sequence: GAATGAGGCGTAGATTCCGA. Outer Right Sequence: ATTTTCAGCATGCGACCTCT. Inner Left Sequence: TTGTTGGCACATCTGGAAAA. Inner Right Sequence: TCTCACGAAAAACCAGGTGA. Inner Primer WT PCR Product: 3162. Deletion size: 1227 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1047 pgp-7&pgp-6(ok994) X. C. elegans T21E8.2&T21E8.1. Homozygous. Outer Left Sequence: GCTGCAGATCCAGCCATATT. Outer Right Sequence: AAGTGACAACAGCAAACCCC. Inner Left Sequence: AGCACCCTGAACGATATTGG. Inner Right Sequence: ACGTTGGAGACAACACGACA. Inner Primer WT PCR product: 3265. Deletion size: 8345 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1048 gcy-32(ok995) V. C. elegans C06B3.8. Homozygous. Outer Left Sequence: CCTAACAACGAACACGGCTT. Outer Right Sequence: GCATTCGGCAATTGGTTATT. Inner Left Sequence: ACACGCACCAATCAACTGAA. Inner Right Sequence: GCGAAGATACGTGGACACAA. Inner Primer WT PCR Product: 3151. Deletion size: 1988 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1049 rom-2(ok996) III. C. elegans C48B4.2. Homozygous. Outer Left Sequence: CCCATCGAGAGAATTGGAAA. Outer Right Sequence: ATGCGTGAAGGAAAACCTGT. Inner Left Sequence: CGGAGATGAACAGAGCACAA. Inner Right Sequence: CAGATGAGCAAATGCAAAGG. Inner Primer WT PCR product: 2823. Deletion size: 530 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1050 F15C11.2(ok997) I. C. elegans F15C11.2a. Homozygous. Outer Left Sequence: AGCTGCTCTTGAACGGTTGT. Outer Right Sequence: TGAATAAAAGGGGAACGTCG. Inner Left Sequence: CAGGAGCCCTTGCTCAATAG. Inner Right Sequence: GCTTATTAAAGGGGCCGAAG. Inner Primer WT PCR product: 2991. Deletion size: 1147 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1052 trpa-1(ok999) IV. C. elegans C29E6.2. Homozygous. Outer Left Sequence: TCGGCTCTCTTTTCCTGTGT. Outer Right Sequence: GGTACACCGAAGTGCCATCT. Inner Left Sequence: GCTGGAATTGGAAGGATTGA. Inner Right Sequence: TCGTGACACTACCATTCCCA. Inner Primer WT PCR Product: 3280. Deletion size: 1334 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1053 R05F9.10(ok1000) II. C. elegans R05F9.10, R05F9.1b. Homozygous. Outer Left Sequence: TTGTAAGGGGAAATTCTGCG. Outer Right Sequence: TGACGAGGGACACACAAAAA. Inner Left Sequence: AGGAGATTGGCGGAAGAGAT. Inner Right Sequence: AGTCGCAGGTTTAGCTCCAA. Inner Primer WT PCR Product: 3317. Deletion size: 2275 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1054 ndx-4(ok1003) I. C. elegans Y37H9A.6. Homozygous. Outer Left Sequence: CATATTGCCCAGAAATGGCT. Outer Right Sequence: CCGAGAAGCTTTTGCTCTGT. Inner Left Sequence: AGTGGCAAAAATGGCAAAAA. Inner Right Sequence: GATTTGAAGCCCAAAGAGCA. Inner Primer WT PCR Product: 2133. Deletion size: 785 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1055 R57.1(ok1004) X. C. elegans R57.1. Homozygous. Outer Left Sequence: GACCCCAACCAATATCATGC. Outer Right Sequence: TGGATACGTGTCCCATGTTG. Inner Left Sequence: CGTTTCGGTTTCAAAGTGGT. Inner Right Sequence: TGAAGTTGATCACCGGAACA. Inner Primer WT PCR Product: 2805. Deletion size: 1523 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1056 cec-1(ok1005) III. C. elegans ZK1236.2. Homozygous. Outer Left Sequence: AATTGTAGAACCATGGCCGA. Outer Right Sequence: AACATGTGCAACAATTCCGA. Inner Left Sequence: CGTTCGGTTTGAGATGGATT. Inner Right Sequence: AGATGAGAGGCGCAGACATT. Inner Primer WT PCR Product: 2703. Deletion size: 2221 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1057 C10G8.8(ok1006) V. C. elegans C10G8.8. Homozygous. Outer Left Sequence: ACCACTTTTTCACGGACCAG. Outer Right Sequence: GCCATCACCCTCTCTTTTCA. Inner Left Sequence: CTTCTCAACTCGCTCCATCC. Inner Right Sequence: CTCATTCGGGAAAAGAACCA. Inner Primer WT PCR Product: 3004. Deletion size: 1524 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1058 F02E11.1(ok1007) II. C. elegans F02E11.1. Homozygous. Outer Left Sequence: ATGGTAGCGAGAAGGGAAGG. Outer Right Sequence: CGAAAAGAACGGGAAAATCA. Inner Left Sequence: CAGGAAGGAGGTGATCAGGA. Inner Right Sequence: TGACACGAATCTTCAAAGCG. Inner Primer WT PCR Product: 2485. Deletion size: 2082 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1059 nhr-3(ok1008) X. C. elegans H01A20.1. Homozygous. Outer Left Sequence: CCCTGTATTCCTCGCATTGT. Outer Right Sequence: GGACAAACACGAGACCGAGT. Inner Left Sequence: TTGATGGCCTGTCATCTGAA. Inner Right Sequence: CCCGTCACAATGAAACACTG. Inner Primer WT PCR Product: 3070. Deletion size: 1296 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1060 R07E5.15&R07E5.17(ok1009) III. C. elegans R07E5.15, R07E5.17. Homozygous. Outer Left Sequence: TCACGGTCATCGATTGGTTA. Outer Right Sequence: TGGCCCGGTATCACAATAAT. Inner Left Sequence: CTTGAAAAGCAACTCGGACC. Inner Right Sequence: CGGAAAATTCGACCAGAGAA. Inner Primer WT PCR Product: 2236. Deletion size: 992 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1061 tnt-3(ok1011) X. C. elegans C14F5.3 Homozygous. Outer Left Sequence: AGCGGGATCAATTCCTTTCT. Outer Right Sequence: TATGCAACGTCTTTTGGCAG. Inner Left Sequence: CGGATGCGTTTGGTATTTCT. Inner Right Sequence: TCATTCGGGAGGAACGATAC. Inner Primer PCR Length: 3234. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1062 cpz-2(ok1012) V. C. elegans M04G12.3 Homozygous. Outer Left Sequence: GAGCTACCGCTCCACTTTTG. Outer Right Sequence: CGAGCAACTTGAAACGATGA. Inner Left Sequence: AAGTTTTCAGCTTCTGGGCA. Inner Right Sequence: TGAGCCATGCGAGTATGAAG. Inner Primer PCR Length: 3062. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1063 fut-3(ok1013) II. C. elegans F59E12.13 Homozygous. Outer Left Sequence: GAAAGTTCCAATGGGCTCAA. Outer Right Sequence: TCAACATTTTGAGCAGACGC. Inner Left Sequence: TCGTTGTCAAACCATTTCCA. Inner Right Sequence: TTGAAACCGCCAAGTGATTT. Inner Primer PCR Length: 3345. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1064 T28B8.5(ok1014) I. C. elegans T28B8.5 Homozygous. Outer Left Sequence: TGTGCTAGCTTTCCAAACCC. Outer Right Sequence: GATGGGTGTATTTTGGACCG. Inner Left Sequence: CCTGGAAGGCATTTTTGTGT. Inner Right Sequence: TTCACGGATTTTTCGTGTTG. Inner Primer PCR Length: 3066. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1066 Y52B11A.4(ok1023) I. C. elegans Y52B11A.4 Homozygous. Outer Left Sequence: ATAGGCGGAGCTTAAACGGT. Outer Right Sequence: CTGATTTTTCCAGAGTCCGC. Inner Left Sequence: CGTCGCCAATTTTTGAATTT. Inner Right Sequence: TGGTGACTCATTCCGTCGTA. Inner Primer PCR Length: 2468. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1067 his-24(ok1024) X. C. elegans M163.3 Homozygous. Outer Left Sequence: GAGGACTCGCACAGTCATCA. Outer Right Sequence: TTCATTTGAGCAATTGAGCG. Inner Left Sequence: TTTCAAGTGTCACCCAACCA. Inner Right Sequence: CCATCCGTGCAAAGTTTCTT. Inner Primer PCR Length: 2807. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1068 T28F3.1(ok1025) IV. C. elegans T28F3.1 Homozygous. Outer Left Sequence: ACAAGGAATTGGCGGAATTT. Outer Right Sequence: TTGAACGCTAAACAACACGC. Inner Left Sequence: TAGGCGGTGCAGAAGCTATT. Inner Right Sequence: GGAGCATCGTTGTTTCGTTT. Inner Primer PCR Length: 3197. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1069 gly-12(ok1026) X. C. elegans F48E3.1 Homozygous. Outer Left Sequence: TTTCATCTCTGGTTCTCGGG. Outer Right Sequence: GGTCGGAGTTTGCACATTTT. Inner Left Sequence: CTAGCCGCATTCTTCTTTGG. Inner Right Sequence: TCCAATCGTTTCTTCCATCC. Inner Primer PCR Length: 2828. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1070 mrp-6(ok1027) X. C. elegans F20B6.3 Homozygous. Outer Left Sequence: GTTGCGAACCTAGGCATTGT. Outer Right Sequence: TCGGAAATGGATCTCTGGAC. Inner Left Sequence: TCTGGATGCAAGCATCTGTC. Inner Right Sequence: CGCCACCATCTCCAGTAAAT. Inner Primer PCR Length: 3296. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1071 F14F3.3(ok1028) X. C. elegans F14F3.3 Homozygous. Outer Left Sequence: GGAGCGAGAAAATGGTTTTG. Outer Right Sequence: GCAGTCATCGCATTCCTTTT. Inner Left Sequence: GATGCAAAGGGCGAAAATAA. Inner Right Sequence: TAGTAATGCGTCCGCAAACA. Inner Primer PCR Length: 2829. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1072 sod-2(ok1030) I. C. elegans F10D11.1 Homozygous. Outer Left Sequence: ACTGCTCGACAGACTCCGAT. Outer Right Sequence: GACGCATTCACCAACAAATG. Inner Left Sequence: TCGAGGCTGGAACTTCAACT. Inner Right Sequence: CCCCTAATAACTGCACCGAA. Inner Primer PCR Length: 2320. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1073 dgk-4(ok1031) IV. C. elegans F42A9.1a Homozygous. Outer Left Sequence: CACCAACTCCTGGAGCAACT. Outer Right Sequence: AATCTCATGACTGGGGCAAG. Inner Left Sequence: TGAGCCATCGACTGCTTATG. Inner Right Sequence: CGGCGTTGGTAGTTTTCAGT. Inner Primer PCR Length: 3388. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1074 smf-3(ok1035) IV. C. elegans Y69A2AR.4 Homozygous. Outer Left Sequence: TTCAGCTTGTCAAGGGCTTT. Outer Right Sequence: CTTCCATTGGGGAAGTTTGA. Inner Left Sequence: CCCAAAGTGATCGGAACCTA. Inner Right Sequence: GGGATTATTTGGACCCGACT. Inner Primer PCR Length: 2195. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1075 pes-9(ok1037) V. C. elegans R11H6.1 Homozygous. Outer Left Sequence: CTTCGATGAGACAGCCACAA. Outer Right Sequence: TTACTGGAAGTTTCCCCGTG. Inner Left Sequence: CAACGGCAACAAGATTAGGG. Inner Right Sequence: GTGAAGCAGTGGCAATTCAA. Inner Primer PCR Length: 2301. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1077 rgs-10(ok1039) X. C. elegans F45B8.2 Homozygous. Outer Left Sequence: AAACCACAGGGTCTGACAGG. Outer Right Sequence: CTTGCGCGACATCAAAAGTA. Inner Left Sequence: GGCATGTTCACTCGGAATTT. Inner Right Sequence: CGTTTGTGCAGAGTGAAGGA. Inner Primer PCR Length: 2185. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1078 T10G3.5(ok1040) V. C. elegans T10G3.5 Homozygous. Outer Left Sequence: GCTTCCAATTCTCTTGCTCG. Outer Right Sequence: ATTTAAGCGGAACAGCCTCA. Inner Left Sequence: TGAACTGCGTCTTCAATTCG. Inner Right Sequence: GAAATCAGAGGGAATCCGGT. Inner Primer PCR Length: 2757. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1079 alg-4(ok1041) III. C. elegans ZK757.3 Homozygous. Outer Left Sequence: GGATTTGGTCCGAAGTAGCA. Outer Right Sequence: GCCGATGATCAAGGATCTGT. Inner Left Sequence: GAGTTGGAATGGAGACCGAA. Inner Right Sequence: CAATATGCGTGAGGTGGTTG. Inner Primer PCR Length: 2888. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1080 haf-4(ok1042) I. C. elegans W04C9.1. Homozygous. Outer Left Sequence: AGTCCTTGGGTCTCACAACG. Outer Right Sequence: ACGATTTGTTCCTGCCAATC. Inner Left Sequence: CCGTGAAAAAGTACGCGTTT. Inner Right Sequence: GCACTCTAAACACTTCCGGC. Inner Primer PCR Length: 2570 bp. Deletion Size: 1678 bp. Deletion left flank: ACACGGGACAAGTCATCGCTACCGTGGTCG. Deletion right flank: GCGTCAATTTCGGTTCGACAAATCGTTTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1081 klf-2(ok1043) V. C. elegans F53F8.1 Homozygous. Outer Left Sequence: GTTACTGTTTGCCCATGCCT. Outer Right Sequence: CGTCTTGTTCATCCGTTTCA. Inner Left Sequence: GAAATGCCCAAAAGTGTCGT. Inner Right Sequence: CTCGAAAATTTCCTGGAGCA. Inner Primer PCR Length: 3195. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1082 K12G11.2(ok1048) V. C. elegans K12G11.2 Homozygous. Outer Left Sequence: TGTCAGGTGGAATACGACGA. Outer Right Sequence: ACATATTCCGAAAAGTGCCG. Inner Left Sequence: TGTTCCATTCACTTCCGTCA. Inner Right Sequence: TGCACGTACACATTCTGCAA. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1083 F27C8.5(ok1050) IV. C. elegans F27C8.5 Homozygous. Outer Left Sequence: AGATTGCGTCTGTGTGATCG. Outer Right Sequence: CTAGAGAAAGGTGCATCGGC. Inner Left Sequence: CGCGGCTTCACAAATAAAAT. Inner Right Sequence: AGAACCTCTTTTCCGGTGGT. Inner Primer PCR Length: 3168. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1084 oct-1(ok1051) I. C. elegans F52F12.1 Homozygous. Outer Left Sequence: TATCGGAGTGTCGATGCAAG. Outer Right Sequence: CAGCCTACCTTCGTGCCTAC. Inner Left Sequence: GATTCTCGTTTCTTGGCTGC. Inner Right Sequence: GCAAGAGGCAGGCATAGTTC. Inner Primer PCR Length: 3239. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1085 tir-1(ok1052) III. C. elegans F13B10.1a Homozygous. Outer Left Sequence: GCAATCAAAGTTTCCAGCGT. Outer Right Sequence: CCTTGTCCTACTCAGCCAGC. Inner Left Sequence: AGATAAAGTCGGCAACCTGC. Inner Right Sequence: CAAATGGCGATCTGTACCCT. Inner Primer PCR Length: 3224. Estimated Deletion Size: about 1900 bp. From Nathalie Pujol 11/04: breakpoints, with a 8 bases insertion, AAATGTCGCCGGATCGTGAACTTGCAAGAAT/AGAATAAA/TGTAGACAGTGCTGGCGT AATTCGCCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1086 inx-5(ok1053) X. C. elegans R09F10.4 Homozygous. Outer Left Sequence: TTGCAAGCATTATTTGCGAG. Outer Right Sequence: ATTCCATTTTCCCATCCTCC. Inner Left Sequence: GGCAGCTTGACACAATTGAA. Inner Right Sequence: TTATTGCCGGTGGTTCTGAT. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1087 kal-1(ok1056) I. C. elegans K03D10.1 Homozygous. Outer Left Sequence: TTTTCCGGAAGATTCCAGTG. Outer Right Sequence: AAAAATGCGGGAATGTTTTG. Inner Left Sequence: GCTGAAAAATCGTGGGAAAA. Inner Right Sequence: CCCATTTTCTTTTGCAGGAA. Inner Primer PCR Length: 2786. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1088 magu-2(ok1059) V. C. elegans C01B7.4 Homozygous. Outer Left Sequence: AAAGACCGGGGAGAGATGAT. Outer Right Sequence: GCATATTCTTTTTGGCGCTC. Inner Left Sequence: TAGCACGCTGTCCATGTAGC. Inner Right Sequence: TTGACTCATACGCCCAATCA. Inner Primer PCR Length: 3137. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1089 hpl-1(ok1060) X. C. elegans K08H2.6 Homozygous. Outer Left Sequence: CCGACATAGGTTTGCACCTT. Outer Right Sequence: CGAAGTGGAATTGGTGGTCT. Inner Left Sequence: CAAGATGCTCCGTTGTTTCA. Inner Right Sequence: GGAGTCGGGAATCAGTCAGA. Inner Primer PCR Length: 2728. Upper breakpoint flanking sequence: TTCGGATTTGAAAGAGTCTGAAAAAGAT. Lower breakpoint flanking sequence: TTGAACTGTAGTCTTTGCTACTTCTT. Deletion Size: 1948 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1090 hpl-2(ok1061) III. C. elegans K01G5.2 Homozygous. Outer Left Sequence: TTTTTACGGGCGAAATTCAG. Outer Right Sequence: AATTCAGTGATGACACGGCA. Inner Left Sequence: AATTTGTCGATGCACCATGA. Inner Right Sequence: CAGTCGGTGAGTTTGGGAAT. Inner Primer PCR Length: 2358. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1091 Y64G10A.7(ok1062) IV. C. elegans Y64G10A.7 Homozygous. Outer Left Sequence: AAAGACCGGACCACTTTGTG. Outer Right Sequence: AACTCACGTTGGACCGAATC. Inner Left Sequence: GTGCGCACACTTGTTCTTGT. Inner Right Sequence: CGATTGACATGCAATTTTCG. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 2700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1092 E02H1.2(ok1070) II. C. elegans E02H1.2 Homozygous. Outer Left Sequence: TTTTCCAAGGTGGACCAAAG. Outer Right Sequence: CTTTTCTCGACGGCTTCAAC. Inner Left Sequence: TTGCTAGGGAGCATCCAAGT. Inner Right Sequence: CCCAATACAACCAGCAACAA. Inner Primer PCR Length: 2359. Estimated Deletion Size: about 350 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1093 C08H9.2(ok1071) II. C. elegans C08H9.2 Homozygous. Outer Left Sequence: CATCTTTTCCTGCAACGACA. Outer Right Sequence: AACATCACTTTCCGTTTGGC. Inner Left Sequence: GGATCTTCTGCTCCTTGACG. Inner Right Sequence: GGACGTCTCATTGGAAAGGA. Inner Primer PCR Length: 3020. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1094 tag-52(ok1072) X. C. elegans C02F12.4 Homozygous. Outer Left Sequence: GCAAATACCACCACCACACA. Outer Right Sequence: TATAAACGACGGGAAAACGC. Inner Left Sequence: AAGCTCACCGCAAACTCAAT. Inner Right Sequence: ACATACAGCACGGCATTTGA. Inner Primer PCR Length: 2998. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1095 chup-1(ok1073) X. C. elegans ZK721.1 Homozygous. Outer Left Sequence: AATTTCAGGCGCTATGAGGA. Outer Right Sequence: CTTGAAATAAAAGCGCGAGG. Inner Left Sequence: TGGGATGTGGTGTACGAAAA. Inner Right Sequence: CAGGAAATGACAGCAGCAAA. Inner Primer PCR Length: 2993. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1096 R06C7.1(ok1074) I. C. elegans R06C7.1 Homozygous. Outer Left Sequence: GCTCCACCAGGAGCTATGAC. Outer Right Sequence: AAATCGAACAAAATTCCCCC. Inner Left Sequence: TGTACATGAAGCCAACCGAA. Inner Right Sequence: CGGTTTGTTTGTAGCCGATT. Inner Primer PCR Length: 2933. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1097 grl-4(ok1076) IV. C. elegans F42C5.7 Homozygous. Outer Left Sequence: AAGCCACGTAACAAAATCCG. Outer Right Sequence: AGTGATCAGAGATGGGCTGG. Inner Left Sequence: TACTGTCCAGGGGAGATTCG. Inner Right Sequence: GGCAATGTCGAGAAGGAAAC. Inner Primer PCR Length: 2926. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1098 hsp-12.6(ok1077) IV. C. elegans F38E11.2 Homozygous. Outer Left Sequence: GTGACGATTCGAGAGCAACA. Outer Right Sequence: CGTGCGAAGATTGAACAGAA. Inner Left Sequence: TTCGAAGCTCAATGAACGAA. Inner Right Sequence: AGCCCAAGATGACAATGGAC. Inner Primer PCR Length: 2303. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1099 F55A12.1(ok1078) I. C. elegans F55A12.1 Homozygous. Outer Left Sequence: GAAAGCCAATAACTCGAGCG. Outer Right Sequence: ACGAACATCAGGAAGAACCG. Inner Left Sequence: GGCAGACTTGCATCCATTTT. Inner Right Sequence: AATTGTTGTTGCCTCGATCC. Inner Primer PCR Length: 2978. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1100 ver-4(ok1079) X. C. elegans F59F3.5 Homozygous. Outer Left Sequence: CCAAAAATGCACATGTACCG. Outer Right Sequence: TGATGAAGAAGCTCCAGCAA. Inner Left Sequence: TCTCCGAGGGGCAATACTAA. Inner Right Sequence: TTCGTTGCAGAACACCAAAA. Inner Primer PCR Length: 2587. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1101 scpl-1(ok1080) I. C. elegans B0379.4 Homozygous. Outer Left Sequence: GAAGAACCGGGAGTCAACTG. Outer Right Sequence: AATTTTGAGGGCAGCTACGA. Inner Left Sequence: TTGAAAATTGGAACGAAGGC. Inner Right Sequence: AAGTATGCGGGAACCACAAC. Inner Primer PCR Length: 2908. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1102 ZK370.3(ok1081) III. C. elegans ZK370.3. Homozygous. Outer Left Sequence: GTGCACAAATTGCTTCGAGA. Outer Right Sequence: CCAACACTCTAGCAGCCACA. Inner Left Sequence: TGGTCCATGCATTGAGTCAT. Inner Right Sequence: TAGAATTCTGCAGGCGATCC. Inner Primer PCR Length: 3308 bp. Deletion Size: 1444 bp. Deletion left flank: GCAGAGCCACAACAAGCGAGTCCATCGAGT. Deletion right flank: AAGAAATTTTGGATAAATGTATTTTTTTTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1103 ceh-18(ok1082) X. C. elegans ZC64.3 Homozygous. Outer Left Sequence: TCGGTCATTTTGGCATGATA. Outer Right Sequence: GCTGACCCCTATTCCCTCAT. Inner Left Sequence: CGATGTTGCGTTCATAGTGG. Inner Right Sequence: CGCCCAAAATTTTTCATCAT. Inner Primer PCR Length: 3110. Estimated Deletion Size: about 2100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1104 hsp-3(ok1083) X. C. elegans C15H9.6 Homozygous. Outer Left Sequence: GGGGTAGGAGAGCCATTTTC. Outer Right Sequence: ACTTGGCCTTTTCCGATTTT. Inner Left Sequence: CGATCGTTTAGAGCTCGTCC. Inner Right Sequence: CCTGCCGTTTCCATAACAGT. Inner Primer PCR Length: 2947. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1105 brp-1(ok1084) III. C. elegans Y79H2A.1 Homozygous. Outer Left Sequence: TTGTGCGCATTGATCTCTTC. Outer Right Sequence: GTATCAGAAACCTCAGCGGC. Inner Left Sequence: CAGCTGATTTCGCATGGTTA. Inner Right Sequence: GAATGCAGTGTTGATGGGTG. Inner Primer PCR Length: 3016. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1106 ape-1(ok1085) V. C. elegans F46F3.4 Homozygous. Outer Left Sequence: CAAACAATTGAAATGTGCGG. Outer Right Sequence: GGATTTCGAAAAATGGGGAT. Inner Left Sequence: CAAAAGCTCCAATTCGCTTC. Inner Right Sequence: AGCGTCTTCGTCTGATTGGT. Inner Primer PCR Length: 2748. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1107 haf-3(ok1086) V. C. elegans F57A10.3. Homozygous. Outer Left Sequence: TTTCGGAAATTTTATTGCGG. Outer Right Sequence: CCGTGCATTGATCACTTGTT. Inner Left Sequence: TTTGCATTCCTTCCAAATCC. Inner Right Sequence: TTGAAAACCCTCCTCGTGTC. Inner Primer PCR Length: 2930 bp. Deletion Size: 1150 bp. Deletion left flank: GTGTTTCAGGGAAAAAAATCTACAAAATTT. Deletion right flank: TATTTTTGAAGAAATTTTCTTAATTTTTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1108 pmp-3(ok1087) V. C. elegans C54G10.3 Homozygous. Outer Left Sequence: AAACGATCGAAAAGCAGGAA. Outer Right Sequence: CACCAAAATGCCAGTGTGAC. Inner Left Sequence: ATTTTTGAAATCGTGCCGAG. Inner Right Sequence: GTCGTTCTGAACTAAGGCGG. Inner Primer PCR Length: 3268. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1109 cit-1.1(ok1088) III. C. elegans F44B9.4 Homozygous. Outer Left Sequence: TTTGGAGCTTTGGAGCAGTT. Outer Right Sequence: CTTCACCAAAGAGGAGGTGC. Inner Left Sequence: ATTCTCCACCAGCTCATTCG. Inner Right Sequence: AGCGAGCATTCAAGAAGGAA. Inner Primer PCR Length: 3011. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1110 C17E4.9(ok1089) I. C. elegans C17E4.9 Homozygous. Outer Left Sequence: AAAATTTGCCCTCCTTCCAT. Outer Right Sequence: CTCATCCACACCGAAAACCT. Inner Left Sequence: CAAACTTCCCCCTCTTCCTC. Inner Right Sequence: ATGAGAAGAGACCTGCCTCG. Inner Primer PCR Length: 2190. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1111 srp-7(ok1090) V. C. elegans F20D6.4 Homozygous. Outer Left Sequence: ATTCGTTCTTTTGACACCGC. Outer Right Sequence: TTTCATCTTTTTCCGGCATC. Inner Left Sequence: CAACATAACCTTTCGTCGCA. Inner Right Sequence: CCGCAACAGCTACAGTACCA. Inner Primer PCR Length: 2226. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1112 C45B2.6(ok1098) X. C. elegans C45B2.6 Homozygous. Outer Left Sequence: ACACAGTCCGACAAAACGTG. Outer Right Sequence: GTTTTCCCCGAAAAGGTTGT. Inner Left Sequence: TACGCGGATGCTCAACATAA. Inner Right Sequence: GAAAGGCACCGGTGATTAAA. Inner Primer PCR Length: 3227. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1113 H25P06.4(ok1099) I. C. elegans H25P06.4 Homozygous. Outer Left Sequence: gcgatccaatattagccgaa. Outer Right Sequence: aggttatgctttgtggtcgg. Inner Left Sequence: aatctctcagggctcaacga. Inner Right Sequence: gattatgagcgtggccattt. Inner Primer PCR Length: 2971. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1114 F35C5.12(ok1103) II. C. elegans F35C5.12 Homozygous. Outer Left Sequence: aagctccacgtgcattctct. Outer Right Sequence: gacagccacgtgctttgata. Inner Left Sequence: aaagtcgatggacaagtcgg. Inner Right Sequence: tgaaagcctaccagagcgtt. Inner Primer PCR Length: 2307. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1115 mec-10(ok1104) X. C. elegans F16F9.5 Homozygous. Outer Left Sequence: tcatttgcagcattttctcg. Outer Right Sequence: atttatcaatcaggcggtcg. Inner Left Sequence: gtccaaggtgtcctccaaaa. Inner Right Sequence: tgaagtttgacacaggcgag. Inner Primer PCR Length: 3339. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1116 egl-4(ok1105) IV. C. elegans F55A8.2b Homozygous. Outer Left Sequence: AAAGTTGGTTGTGGACGGAG. Outer Right Sequence: ACTGCACAAAAATTCGAGGC. Inner Left Sequence: AGAACCGCATCAGTTCAAGC. Inner Right Sequence: TTTTGGACGAATTTTGGAGG. Inner Primer PCR Length: 2432. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1117 Y47G6A.14(ok1106) I. C. elegans Y47G6A.14 Homozygous. Outer Left Sequence: aggtgtcaagaagagccgaa. Outer Right Sequence: cctccttgagacttgaagcg. Inner Left Sequence: cttgagcgaggtgtaggctt. Inner Right Sequence: gccaggaagaatttggtgaa. Inner Primer PCR Length: 3237. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1118 ZK370.4(ok1107) III. C. elegans ZK370.4 Homozygous. Outer Left Sequence: ATCAGATCTTCGATCCGGTG. Outer Right Sequence: GTTTGATCCGTCGTGGAAGT. Inner Left Sequence: ATCACTTCAGCTCGGCTCAT. Inner Right Sequence: CGAGTGGAAGCTTGATCCTC. Inner Primer PCR Length: 3173. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1119 ubr-5(ok1108) I. C. elegans F36A2.13 Homozygous. Outer Left Sequence: ctgcctgataccacccactt. Outer Right Sequence: tcttgcaatggttccacatc. Inner Left Sequence: tggaagctcacaagctcaga. Inner Right Sequence: ggaagctcttggagcagatg. Inner Primer PCR Length: 3184. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1120 amt-3(ok1113) II. C. elegans M195.3 Homozygous. Outer Left Sequence: tctggcggctcttcttttta. Outer Right Sequence: tgcactcgggtaacattcag. Inner Left Sequence: cagccaaaccatgttcaatg. Inner Right Sequence: attatggcacaagggagacg. Inner Primer PCR Length: 3116. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1121 C42C1.13(ok1114) IV. C. elegans C42C1.13 May also hit C42C1.11 Homozygous. Outer Left Sequence: aaacacgaaacactcgcctt. Outer Right Sequence: ccgatcctttttcgtatgga. Inner Left Sequence: ccttaaaagagtctcggccc. Inner Right Sequence: atgaaaaagcgtcatctggg. Inner Primer PCR Length: 2226. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1122 T12B5.3(ok1129) III. C. elegans T12B5.3 Homozygous. Outer Left Sequence: acattccacactttcctggc. Outer Right Sequence: gttgcgatgaagagcacaaa. Inner Left Sequence: ctccactcgcatttttccat. Inner Right Sequence: ggatgcagattgctccaaat. Inner Primer PCR Length: 2203. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1123 Y105E8A.10(ok1130) I. C. elegans Y105E8A.10 Homozygous. Outer Left Sequence: gcgtgacgacggtcttttat. Outer Right Sequence: tttcgagttcaaaattcggg. Inner Left Sequence: tagtcgttgttgttggcagc. Inner Right Sequence: acaacacatttaacgcgcaa. Inner Primer PCR Length: 2600. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1124 exp-1(ok1131) II. C. elegans H35N03.1 Homozygous. Outer Left Sequence: AGATCCAATGAAATCGGTGC. Outer Right Sequence: ACATCGTTTTTATGGCCACC. Inner Left Sequence: TTGCCTTGCAAGACTCAAAA. Inner Right Sequence: CACAGCATCGACCAGAAATG. Inner Primer PCR Length: 2329. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1125 vang-1(ok1142) X. C. elegans B0410.2a Homozygous. Outer Left Sequence: gtcataaacgccgagtcgat. Outer Right Sequence: caaatcaaactgccgactca. Inner Left Sequence: ctggaatgacgacggattct. Inner Right Sequence: ttttcatttccaggtttggc. Inner Primer PCR Length: 3370. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1126 H06H21.9(ok1143) IV. C. elegans H06H21.9 Homozygous. Outer Left Sequence: cccatcattggctttttagc. Outer Right Sequence: ttgtaggcaccggttttagg. Inner Left Sequence: tgtctcgcttttagcgcttt. Inner Right Sequence: cacgcgattttgcagtttta. Inner Primer PCR Length: 2109. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1127 Y54G2A.2(ok1144) IV. C. elegans Y54G2A.2. Homozygous. Outer Left Sequence: TTGTGGTGGAGATACCCCAT. Outer Right Sequence: CGCGGGAATTCAAACATAAT. Inner Left Sequence: GCGAGTTTAGAAATGCTCGG. Inner Right Sequence: CTTTTCATATTCAGGCCCCA. Inner Primer PCR Length: 2962 bp. Deletion Size: 483 bp. Deletion left flank: TTTCGTCCCGTAAATCTACACAGTAATCCC. Deletion right flank: CAAAAAATTATAATTTGTCTTCTTCTTTCA. Insertion Sequence: GGAAAAGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1128 fcd-2(ok1145) IV. C. elegans Y41E3.9 Homozygous. Outer Left Sequence: ttataaatccctgcgccaag. Outer Right Sequence: cgaatttagccagaaatcgc. Inner Left Sequence: gggtcaaagttccccatttt. Inner Right Sequence: caaaacacagaagcgagcaa. Inner Primer PCR Length: 3228. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1129 amt-3(ok1146) II. C. elegans M195.3 Homozygous. Outer Left Sequence: tctggcggctcttcttttta. Outer Right Sequence: tgcactcgggtaacattcag. Inner Left Sequence: cagccaaaccatgttcaatg. Inner Right Sequence: attatggcacaagggagacg. Inner Primer PCR Length: 3116. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1130 pqn-2(ok1149) V. C. elegans AC3.4 Homozygous. Outer Left Sequence: cttgccaacgaaccacctat. Outer Right Sequence: tcacgcgtttttgatgtgat. Inner Left Sequence: cagaacactgctccagtcca. Inner Right Sequence: aatttaggggtggccgtatc. Inner Primer PCR Length: 2917. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1131 lev-10(ok1154) I. C. elegans Y105E8A.7 Homozygous. Outer Left Sequence: ctccacgagattcgtcaaca. Outer Right Sequence: cgtttcgacttcttcttccg. Inner Left Sequence: gagcaatcgagagacgttcc. Inner Right Sequence: tgttataccgcagaacaccg. Inner Primer PCR Length: 3231. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1132 acr-14(ok1155) II. C. elegans T05C12.2 Homozygous. Outer Left Sequence: gtcttcgtccagccaacact. Outer Right Sequence: ggctcctgttcaatctctgc. Inner Left Sequence: attccgatcgaagctgaaaa. Inner Right Sequence: ccatttcaatcgtccatgtg. Inner Primer PCR Length: 2213. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1133 C48E7.6(ok1156) I. C. elegans C48E7.6 Homozygous. Outer Left Sequence: aggacaccatggggaatttt. Outer Right Sequence: tgatggatcggaaagtcaca. Inner Left Sequence: ccgagttgaaggaaagatgc. Inner Right Sequence: cgaggtgcatcatcagaaaa. Inner Primer PCR Length: 3266. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1134 Y105E8A.10(ok1157) I. C. elegans Y105E8A.11 Homozygous. Outer Left Sequence: gcgtgacgacggtcttttat. Outer Right Sequence: tttcgagttcaaaattcggg. Inner Left Sequence: tagtcgttgttgttggcagc. Inner Right Sequence: acaacacatttaacgcgcaa. Inner Primer PCR Length: 2600. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1135 K02F3.5(ok1158) III. C. elegans K02F3.5 Homozygous. Outer Left Sequence: ccgttgcgtaacagaaacaa. Outer Right Sequence: gccgtgtaggcaggtatcat. Inner Left Sequence: ggtttaactgggctgcagag. Inner Right Sequence: tcggttggtattgcagtgaa. Inner Primer PCR Length: 3050. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1136 R05G6.10(ok1159) IV. C. elegans R05G6.10 Homozygous. Outer Left Sequence: tcttcgtcttgccatctgaa. Outer Right Sequence: agcagcatgttgttgtgctc. Inner Left Sequence: gggaacaatgatgagatggg. Inner Right Sequence: ccccttcttcttgacacgag. Inner Primer PCR Length: 3193. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1137 rig-4(ok1160) IV. C. elegans Y42H9B.2. Homozygous. Outer Left Sequence: AATTCAACTGGCTGACTGGG. Outer Right Sequence: CTGAGCCATCTCGATCGTTT. Inner Left Sequence: CTCACTTCTCCCTTCCGTTG. Inner Right Sequence: CAAGTCAACGACTTTTCGCA. Inner Primer PCR Length: 2978 bp. Deletion Size: 1347 bp. Deletion left flank: GGATACGGTATCCAATAGCATCACTGTTCC. Deletion right flank: TCGAAGTTTGTAACCGATCACATCTCCATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1138 F08G2.7(ok1161) II. C. elegans F08G2.7 Homozygous. Outer Left Sequence: gaaatccgagagctcagcag. Outer Right Sequence: agtcaaccacccctcttcct. Inner Left Sequence: actcgatttcctcatcacgg. Inner Right Sequence: tgaaataattccaggaccgc. Inner Primer PCR Length: 3269. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1139 clh-4(ok1162) X. C. elegans T06F4.2 Homozygous. Outer Left Sequence: TGTCTCGAGAGTAGTGCCCC. Outer Right Sequence: AAACGGAAGGTGAGCTGATG. Inner Left Sequence: AGGGTGAATGGGAGACACTG. Inner Right Sequence: AGAAACCACATTCCTGGTGC. Inner Primer PCR Length: 3372. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1141 R13H7.2(ok1167) IV. C. elegans R13H7.2 Homozygous. Outer Left Sequence: tgtgcgctagagacaccact. Outer Right Sequence: ttggctcctcctttttctca. Inner Left Sequence: acacaaaccgtcatgctctg. Inner Right Sequence: tgatcgtcgtcattgctctc. Inner Primer PCR Length: 3343. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1143 F36D4.2(ok1128) V/nT1 [qIs51] (IV;V). C. elegans F36D4.2 Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1128 homozygotes. nT1[qIs51] homozygotes inviable. Outer Left Sequence: agtcatgaacagatccccca. Outer Right Sequence: attgcttggacgagaggaga. Inner Left Sequence: tgcttttattcgcacccagt. Inner Right Sequence: tggatctgcaagtccatctg. Inner Primer PCR Length: 2151. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1144 Y73B6BL.19(ok1168) IV. C. elegans Y73B6BL.19 Homozygous. Outer Left Sequence: tcacttttcgaatggggttc. Outer Right Sequence: ccactttccatttttcccag. Inner Left Sequence: atcttagccagggttgcaga. Inner Right Sequence: tgttgcatacgacgaagagc. Inner Primer PCR Length: 2905. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1145 ags-3(ok1169) X. C. elegans F32A6.4a Homozygous. Outer Left Sequence: ctccggttttaaatttggca. Outer Right Sequence: acgttgggttttgagcattc. Inner Left Sequence: ttcgcgatgctcaatatcag. Inner Right Sequence: caaagacgttttgcgactca. Inner Primer PCR Length: 3203. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1146 dyf-5(ok1170) I. C. elegans M04C9.5. Homozygous. Outer Left Sequence: GCAGAAAAGTGGTGAGAGGC. Outer Right Sequence: GAGCGGTTTGGAACAATTTC. Inner Left Sequence: AATTATGACGCCACGGATTC. Inner Right Sequence: ACCGTACGCATACTCGAACC. Inner Primer PCR Length: 2997 bp. Deletion Size: 2058 bp. Deletion left flank: TGAAAATAGTACTGTAGGATTACTGGAACT. Deletion right flank: AGGCCAAGTATCCAAAGACACTCATCAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1147 F44D12.4(ok1172) IV. C. elegans F44D12.4 Homozygous. Outer Left Sequence: gaaatctagcacctacggcg. Outer Right Sequence: aatgtgtcgtgtggagacca. Inner Left Sequence: gtacggtgtctatcgcggac. Inner Right Sequence: atcaaaatgcggagaaatgg. Inner Primer PCR Length: 2165. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1148 dyf-5(ok1177) I. C. elegans M04C9.5. Homozygous. Outer Left Sequence: GCAGAAAAGTGGTGAGAGGC. Outer Right Sequence: GAGCGGTTTGGAACAATTTC. Inner Left Sequence: AATTATGACGCCACGGATTC. Inner Right Sequence: ACCGTACGCATACTCGAACC. Inner Primer PCR Length: 2997 bp. Deletion Size: 1719 bp. Deletion left flank: ATGGACAATTGGATGCATTTTCTGTAGTTG. Deletion right flank: GACTTGCTCATACCTTATTTGAATTGTGAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1149 scrm-3(ok1178) V. C. elegans C04E12.7 Homozygous. Outer Left Sequence: atttcaccttcagcaccgtc. Outer Right Sequence: acggcagaaaacaatgttcc. Inner Left Sequence: tgcttttcacaaatcaacgg. Inner Right Sequence: ctgcgctttttccttcattc. Inner Primer PCR Length: 2174. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1150 gpr-2(ok1179) III. C. elegans C38C10.4 Homozygous. Outer Left Sequence: ggaagagcattttcccatca. Outer Right Sequence: atatcagaaagcggcgctaa. Inner Left Sequence: gctggcagtctccatctctc. Inner Right Sequence: gatccgcgtgaaatttttgt. Inner Primer PCR Length: 2139. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1151 cft-1(ok1180) V. C. elegans C18C4.2 Homozygous. Outer Left Sequence: gtgggtctcgaagggaattt. Outer Right Sequence: tgagattttcccgatccaac. Inner Left Sequence: aggtgagggaaaccacactg. Inner Right Sequence: tttcaatttttccgtcgtcc. Inner Primer PCR Length: 3299. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1152 K01B6.1(ok1182) III. C. elegans K01B6.1 Homozygous. Outer Left Sequence: tccgtgaggcttagcagaat. Outer Right Sequence: ggaacaggaattgtgaggga. Inner Left Sequence: ccaaaacccgaaacttctca. Inner Right Sequence: tcaaatcgagttcttcgcct. Inner Primer PCR Length: 3303. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1153 Y43B11AR.3(ok1183) IV. C. elegans Y43B11AR.3 Homozygous. Outer Left Sequence: ctgtgactggtgcagttgct. Outer Right Sequence: actggaggacgtaacgttgg. Inner Left Sequence: cgatgtgagttctgctggaa. Inner Right Sequence: aaagtccggctaaggttggt. Inner Primer PCR Length: 2110. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1154 C16C8.16(ok1184) II. C. elegans C16C8.14 Homozygous. Outer Left Sequence: taatatgagcaatgcgcgtc. Outer Right Sequence: ctacggtaggtggcggagta. Inner Left Sequence: gcgtacttcctcgtctaccg. Inner Right Sequence: gcggaatcaggtcaagtgtt. Inner Primer PCR Length: 3202. Estimated Deletion Size: about 2900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1155 scl-1(ok1185) IV. C. elegans F49E11.9 Homozygous. Outer Left Sequence: atatcccaaccatcggaaca. Outer Right Sequence: gacacccgtttgcgtagttt. Inner Left Sequence: tttttctcggcgtacttcgt. Inner Right Sequence: gccacgtaggtaccttttgc. Inner Primer PCR Length: 2195. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1156 C46A5.2(ok1187) IV. C. elegans C46A5.2 Homozygous. Outer Left Sequence: tgtctccgtctccttttgct. Outer Right Sequence: tggcggttctgatatcttcc. Inner Left Sequence: ggcagaagtacgacgagagg. Inner Right Sequence: tggtaaaggccgatacgaac. Inner Primer PCR Length: 2189. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1157 pept-2(ok1192) IV. C. elegans C06G8.2 Homozygous. Outer Left Sequence: acaccttcacgatgaccctc. Outer Right Sequence: acatttgtacggcctggaag. Inner Left Sequence: acatggggaggcataatcaa. Inner Right Sequence: gtcatggacgtcaagagggt. Inner Primer PCR Length: 2873. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1158 C25E10.9a(ok1193) V. C. elegans C25E10.9a Homozygous. Outer Left Sequence: tcacggcattgtttgtgttt. Outer Right Sequence: caggcaaatgcactcttgaa. Inner Left Sequence: aaaaccactggaacactggc. Inner Right Sequence: tgtggagctgacttgtgagg. Inner Primer PCR Length: 2139. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1159 F21C3.2(ok1194) I. C. elegans F21C3.2 Homozygous. Outer Left Sequence: tctcaccctacactgtcccc. Outer Right Sequence: ggaactgaagctgcatccat. Inner Left Sequence: cacatcggtgaatcacaagg. Inner Right Sequence: gctccaactcctgctattcg. Inner Primer PCR Length: 3007. Estimated Deletion Size: about 2250 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1160 ckb-4(ok1195) V. C. elegans F22F7.5 Homozygous. Outer Left Sequence: gaaggaattcagggaaaggg. Outer Right Sequence: tactttttgggggtttgtcg. Inner Left Sequence: tcactggcgataacatccaa. Inner Right Sequence: tctgcgggaaaaatgatctc. Inner Primer PCR Length: 2746. Estimated Deletion Size: about 1350 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1161 tbh-1(ok1196) X. C. elegans H13N06.6 Homozygous. Outer Left Sequence: aagcaggatcaggagcacat. Outer Right Sequence: atgagaagtgccgttgctct. Inner Left Sequence: catgtcattgatggctggac. Inner Right Sequence: gaacgccagttggttgattt. Inner Primer PCR Length: 2851. Estimated Deletion Size: about 850 bp. 12/2004: From Laura DiCaprio: The deletion is 981 base pairs from X: 15500754 - 15501734. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1162 cfz-2(ok1201) V. C. elegans F27E11.3. Homozygous. Outer Left Sequence: TCAGTTTGGCCACATTTTGA. Outer Right Sequence: TCAGCGTGCTGTTCCTATTG. Inner Left Sequence: ATTCCGAAAGCTCGACAAGA. Inner Right Sequence: AAGAAGCCGGATTGGAAGTT. Inner Primer PCR Length: 3182 bp. Deletion Size: 1174 bp. Deletion left flank: CAAACAGCAAATAGCATTTTTCCACGACGA. Deletion right flank: CCCACCAAACCGAGGCAGCCATTCCGAAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1163 amt-4(ok1202) X. C. elegans C05E11.5 Homozygous. Outer Left Sequence: agccaaatttgaacacctgc. Outer Right Sequence: ttcgattccaaaagaggcat. Inner Left Sequence: agattgacgcccattacctg. Inner Right Sequence: cgaaaacctaaaagcatcgg. Inner Primer PCR Length: 2644. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1164 aly-2(ok1203) IV. C. elegans F23B2.6 Homozygous. Outer Left Sequence: atgcggaataacggagtgtc. Outer Right Sequence: atcagtttgcagcttccgat. Inner Left Sequence: cgcgaattcacacacaaagt. Inner Right Sequence: tggcttctggagggatagtg. Inner Primer PCR Length: 2266. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1165 col-99(ok1204) IV. C. elegans F29C4.8 Homozygous. Outer Left Sequence: actgactgccgctgatctct. Outer Right Sequence: cggatgactttttctctcgc. Inner Left Sequence: cgtagctcggagatgtcctc. Inner Right Sequence: tcattgaattgctgctctcg. Inner Primer PCR Length: 2632. Estimated Deletion Size: about 1250 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1166 eor-1(ok1127) IV. C. elegans R11E3.6 Homozygous. Outer Left Sequence: GGCCCAACCTTTGAATTTTT. Outer Right Sequence: CCGTATCGATGTGAAACGTG. Inner Left Sequence: GAAGTTGCTGGAGTTGAGCC. Inner Right Sequence: CTTTGCCGAAGGAAACACAT. Inner Primer PCR Length: 2638. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1167 F52D10.2(ok1205) X. C. elegans F52D10.2 Homozygous. Outer Left Sequence: tggcgagaaggaaagaaaga. Outer Right Sequence: aaacaaacaattgcgccttc. Inner Left Sequence: acaagcttcagagcgacgtt. Inner Right Sequence: tcttccttccttgccttcag. Inner Primer PCR Length: 2109. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1169 oga-1(ok1207) X. C. elegans T20B5.3 Homozygous. Outer Left Sequence: caatgtcgtcaatggctacg. Outer Right Sequence: gttgttgaaggtaagcccca. Inner Left Sequence: taggaaatatccacgcgacc. Inner Right Sequence: cgaatttcaggcttctacgg. Inner Primer PCR Length: 3268. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1170 C04B4.2(ok1212) X. C. elegans C04B4.2 Homozygous. Outer Left Sequence: tggcccttgtttaaatgctc. Outer Right Sequence: tcttaaccgttcggaaatcg. Inner Left Sequence: gtcgcgtcgcaacaatacta. Inner Right Sequence: ccaaggcaacaaaaggagaa. Inner Primer PCR Length: 2268. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1171 cpi-1(ok1213) IV. C. elegans K08B4.6 Homozygous. Outer Left Sequence: ccggaagatgatgaaaggaa. Outer Right Sequence: acgtctcccagagagcgtaa. Inner Left Sequence: aagaacgtagcgcgagtgat. Inner Right Sequence: atacggtgtctatcgcggac. Inner Primer PCR Length: 2182. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1172 acr-15(ok1214) V. C. elegans F25G6.4 Homozygous. Outer Left Sequence: ctctgcgcttcaagctctct. Outer Right Sequence: cagcagggaggtgtaccaat. Inner Left Sequence: gtgatgctcttgcccatttt. Inner Right Sequence: tgctctttttcaggaaggga. Inner Primer PCR Length: 3055. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1173 plc-4(ok1215) IV. C. elegans R05G6.8 Homozygous. Outer Left Sequence: gctgaaacatgccaaggatt. Outer Right Sequence: tcaaaatgtttctctggccc. Inner Left Sequence: ctatgcgaaagaaagggcag. Inner Right Sequence: tggcgttggtgacaataaaa. Inner Primer PCR Length: 2912. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1174 W02H5.7(ok1216) V. C. elegans W02H5.7 Homozygous. Outer Left Sequence: gggatgggggatcagataat. Outer Right Sequence: aaatttgcatttgcctttgg. Inner Left Sequence: gttgctcactttatggggga. Inner Right Sequence: aatgccatgccatgtagtca. Inner Primer PCR Length: 2981. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1175 F55F8.3(ok1115) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F55F8.3 Heterozygotes are WT and GFP+. Segregates very rare homozygous hT2 glowing animals. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: TACCAGTCAGAGTTGCCACG. Outer Right Sequence: GAATTGCGCCAATGAAGATT. Inner Left Sequence: TCAATTGCATTCCGTGATGT. Inner Right Sequence: GCGGAATTCGTGCTTTGTAT. Inner Primer PCR Length: 3397. Estimated Deletion Size: about 1300 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1176 oxi-1(ok1217) III. C. elegans Y39A1C.2 Homozygous. Outer Left Sequence: ttttgaaaccggaaaattcg. Outer Right Sequence: tccaaaatttgttctgcacg. Inner Left Sequence: catcgaaaatccgcttcttt. Inner Right Sequence: agctgcagttccctttctca. Inner Primer PCR Length: 3022. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1177 F23B2.3(ok1226) IV. C. elegans F23B2.3 Homozygous. Outer Left Sequence: tgcttcgattgattgctcac. Outer Right Sequence: ggaggttacgcatccaaaaa. Inner Left Sequence: tcggattttcctttgcattc. Inner Right Sequence: ttcgcctcctatatcccctt. Inner Primer PCR Length: 2845. Estimated Deletion Size: about 2050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1178 wwp-1(ok1102) I. C. elegans Y65B4BR.4a. Homozygous. Outer Left Sequence: AACGAAGAAGCGCAGGAGTA. Outer Right Sequence: CAATCGTCCACATCAACGTC. Inner Left Sequence: AGTTCAGAGGCATCCACGTC. Inner Right Sequence: ATCTCTGTACCGCCCTCCTT. Inner Primer PCR Length: 3219 bp. Deletion Size: 1042 bp. Deletion left flank: GCGGAGACCGGCGACAGCGAAGCGTGACAC. Deletion right flank: ACTCAGCCATTGCCACAGGGATGGGAAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1179 C55C2.1(ok1228) I. C. elegans C55C2.1 Homozygous. Outer Left Sequence: gtcccatatgcttcttccca. Outer Right Sequence: aatccaagattcaaggcacg. Inner Left Sequence: tgtgaattgggtgagagcag. Inner Right Sequence: ttggcgtttttgtgtctctg. Inner Primer PCR Length: 2206. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1180 act-2(ok1229) V. C. elegans T04C12.5 Homozygous. Outer Left Sequence: tggcgagagaagaagagagg. Outer Right Sequence: aaacaatacctgattcggcg. Inner Left Sequence: gcgtgagaaacagtgcaaaa. Inner Right Sequence: aacatgacggtcagcaagtg. Inner Primer PCR Length: 2668. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1181 gld-2(ok1117) I. C. elegans ZC308.1 Homozygous. Outer Left Sequence: TGTTTGAATGGGGTTTCTCC. Outer Right Sequence: ACTTCCTGGTCGTTGTGGTC. Inner Left Sequence: ACAGGTGGTCAACCCATGAT. Inner Right Sequence: ACGAAGACTAGCACACGCAA. Inner Primer PCR Length: 3342. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1182 tba-1(ok1123) I. C. elegans F26E4.8 Homozygous. Outer Left Sequence: gggcacttgaagttgatggt. Outer Right Sequence: cctttcctcgcaccagaata. Inner Left Sequence: tcgggaagttaagcgtcatt. Inner Right Sequence:cagcccgactttcatttctc . Inner Primer PCR Length: 2176. Estimated Deletion Size: about 1100 bp. Received new stock 11/04/04. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1183 prom-1(ok1140) I. C. elegans F26H9.1 Homozygous. Outer Left Sequence: gatcgaagccaaagaacgaa. Outer Right Sequence: tgaggggacattcacacgta. Inner Left Sequence: tgggtactgtagtgggggtg. Inner Right Sequence: aaaggaggaacaaaatgggg. Inner Primer PCR Length: 2240. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1184 Y82E9BR.14(ok1230) II. C. elegans Y82E9BR.14 Homozygous. Outer Left Sequence: ggggttcaggagggtaaaaa. Outer Right Sequence: atttgaagaatttcgcgtgc. Inner Left Sequence: cacgttaagccggaaattgt. Inner Right Sequence: gcgtcacggctagatttttc. Inner Primer PCR Length: 2829. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1185 tba-1(ok1135) I. C. elegans F26E4.8 Homozygous. Outer Left Sequence: gggcacttgaagttgatggt. Outer Right Sequence: cctttcctcgcaccagaata. Inner Left Sequence: tcgggaagttaagcgtcatt. Inner Right Sequence: cagcccgactttcatttctc. Inner Primer PCR Length: 2176. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1186 unc-89(ok1116) I. C. elegans C24G7.5 Homozygous. Outer Left Sequence: GTCCACGTCAAGAGCACTCA. Outer Right Sequence: GACTCGAGCTCTTCGCTGAT. Inner Left Sequence: GAAAACCTGGATTCTTGCCA. Inner Right Sequence: GAACTGGCGACTTTTTGAGC. Inner Primer PCR Length: 3199. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1187 tbx-41(ok1231) X. C. elegans T26C11.1 Homozygous. Outer Left Sequence: ttcaaatgcattgccaaaaa. Outer Right Sequence: ttggcaacaacaaagcagag. Inner Left Sequence: cctccgaattttcccatttt. Inner Right Sequence: aaagctgaaggatctgccaa. Inner Primer PCR Length: 2932. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1188 F23B12.6(ok1232) V. C. elegans F23B12.6 Homozygous. Outer Left Sequence: AGCATTTGGATATTGGCGAG. Outer Right Sequence: AGTGAACGGGAGATTTGTGC. Inner Left Sequence: TTGTGTGAAACCGATGTTGG. Inner Right Sequence: AGCCATCTCATCCTTTCCCT. Inner Primer PCR Length: 2975. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1189 chs-1(ok1120) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T25G3.2 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Segregates very rare homozygous hT2 glowing animals. Outer Left Sequence: tgtggctgtgttgcaaagat. Outer Right Sequence: tggagaagcattccgagagt. Inner Left Sequence: atttgcacttcagctggctt. Inner Right Sequence: ggttcatcggtttcctcgta. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1600 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1190 amx-2(ok1235) I. C. elegans B0019.1 Homozygous. Outer Left Sequence: ttggcggaaatttgaaagtc. Outer Right Sequence: tccaacggacacccaattat. Inner Left Sequence: cagcctcaaccaccttttgt. Inner Right Sequence: tctcagcaaatggacactgc. Inner Primer PCR Length: 2803. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1191 C16A11.4(ok1236) II. C. elegans C16A11.4 Homozygous. Outer Left Sequence: ctaccaagaaaatcgccgaa. Outer Right Sequence: gtggaggcaccgtaacttgt. Inner Left Sequence: catagaaattccgccgaaaa. Inner Right Sequence: tctcgacgcgaaaaggttat. Inner Primer PCR Length: 2747. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1192 C24G7.4(ok1237) I. C. elegans C24G7.4 Homozygous. Outer Left Sequence: ccctttttgacgtgcattct. Outer Right Sequence: ggagcccataaacaccaaaa. Inner Left Sequence: acaagcagtttgccaatcaa. Inner Right Sequence: ttgttttgaagcgaaaaccc. Inner Primer PCR Length: 3185. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1193 F44D12.9(ok1238) IV. C. elegans F44D12.9 Homozygous. Outer Left Sequence: AGCCAAGATTTGGGCCTACT. Outer Right Sequence: TGCACCATATCCGTGTGACT. Inner Left Sequence: ACATGCTTGTTTTTGGGGAA. Inner Right Sequence: AATGGGTGTACTGGCGACTC. Inner Primer PCR Length: 2230. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1194 grk-1(ok1239) X. C. elegans F19C6.1 Homozygous. Outer Left Sequence: AGGAATGAATCGGAGACGTG. Outer Right Sequence: TTGCCACAGCTTCGTAATTG. Inner Left Sequence: CAGGACAAAACGGAGGTGTT. Inner Right Sequence: AACAGTGGAACAAAGGACGG. Inner Primer PCR Length: 2808. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1195 acr-8(ok1240) X. C. elegans ZC504.2 Homozygous. Outer Left Sequence: tcgaccaatcaaaaatgcaa. Outer Right Sequence: cgcttacgtctgtcgtgcta. Inner Left Sequence: actcagccaacatcgtttcc. Inner Right Sequence: caccaggcaagttgagtgaa. Inner Primer PCR Length: 3051. Estimated Deletion Size: about 1050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1196 shn-1(ok1241) II. C. elegans C33B4.3 Homozygous. Outer Left Sequence: AGTGAGAAATGGGGTCGATG. Outer Right Sequence: CCAATTGGACTTACACCGCT. Inner Left Sequence: AGCAAAAATCGGACACAACC. Inner Right Sequence: GCTGTGAACAAGCAAGGACA. Inner Primer PCR Length: 2797. Estimated Deletion Size: about 2300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1197 ctl-1(ok1242) II. C. elegans Y54G11A.6 Homozygous. Outer Left Sequence: cggcgattcttatactccca. Outer Right Sequence: attccccgtataccctgacc. Inner Left Sequence: ggccaattttctgcctgata. Inner Right Sequence: gcctgtccaaaataagcgag. Inner Primer PCR Length: 2994. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1198 Y66D12A.16(ok1243) III. C. elegans Y66D12A.16 Homozygous. Outer Left Sequence: ccattctgcgaggttcttgt. Outer Right Sequence: gtcgttttcgctctttcgtc. Inner Left Sequence: tcatgacgcgttttatccaa. Inner Right Sequence: gtgatcacgtgtacgttggg. Inner Primer PCR Length: 3301. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1199 sax-7(ok1244) IV. C. elegans C18F3.2 Homozygous. Outer Left Sequence: accgggttctgctgtgtatc. Outer Right Sequence: gagaccagacaccgcatttt. Inner Left Sequence: tgggaagctccaatgatttc. Inner Right Sequence: atcaaaatttcgcatctggc. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1200 hst-3.1(ok1249) II. C. elegans F40H3.5 Homozygous. Outer Left Sequence: ATGCACGTGTTCCTCCTTTC. Outer Right Sequence: ACCACCAAACGGTAATGGAA. Inner Left Sequence: TTAAAGCCGATGGGAATCTG. Inner Right Sequence: TAGAGACGAGCAGAGCGTGA. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1201 F38H12.3(ok1250) V. C. elegans F38H12.3 Homozygous. Outer Left Sequence: tacaatcatggttccgggtt. Outer Right Sequence: tttgatgctcggtcattttg. Inner Left Sequence: cccaaccgactactctcgaa. Inner Right Sequence: ttgaacggatcgcttacaca. Inner Primer PCR Length: 2951. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1202 ZK265.1(ok1251) I. C. elegans ZK265.1 Homozygous. Outer Left Sequence: ttgctcaacatcatgcccta. Outer Right Sequence: aatggcggaagtatctgtgg. Inner Left Sequence: tcgaaaatcccaattcaacc. Inner Right Sequence: gagccgatgttttcaagctc. Inner Primer PCR Length: 2972. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1203 T10B11.2(ok1252) I. C. elegans T10B11.2 Homozygous. Outer Left Sequence: GGTTCGGCAAAGCACATAAT. Outer Right Sequence: TAACAACGGCATTGAATGGA. Inner Left Sequence: TCATTCCGACGGTACCATTT. Inner Right Sequence: TGAAGCTTGAAATGCAGTGG. Inner Primer PCR Length: 2465. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1204 old-2(ok1253) II. C. elegans ZK938.5 Homozygous. Outer Left Sequence: GCTGTCCCATACGGTTTGAT. Outer Right Sequence: TATTAGCCACGCCCACTTTC. Inner Left Sequence: AGGGAAGAAAATCAGCAGCA. Inner Right Sequence: TTGCTTTGCTTCATGCTACG. Inner Primer PCR Length: 2110. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1205 R09B5.1(ok1254) V. C. elegans R09B5.1 Homozygous. Outer Left Sequence: ctcattgacttccgggacat. Outer Right Sequence: aatatttttggggaaaggcg. Inner Left Sequence: ctcctcttcctcgtcctcct. Inner Right Sequence: agctttgcagttccggttta. Inner Primer PCR Length: 3218. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1206 rsks-1(ok1255) III. C. elegans Y47D3A.16 Homozygous. Outer Left Sequence: gagatgcggaagctatgctc. Outer Right Sequence: gttgaattcctgctcctcca. Inner Left Sequence: attcaactgtgtgccagtgc. Inner Right Sequence: tggggcttcactatttggtc. Inner Primer PCR Length: 3267. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1207 cpi-2(ok1256) V. C. elegans R01B10.1 Homozygous. Outer Left Sequence: attccgataacattggctgg. Outer Right Sequence: aatctgttgccgacaaaacc. Inner Left Sequence: attttctggccaatttcgtg. Inner Right Sequence: ccacaattccaatcccaatc. Inner Primer PCR Length: 2103. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1208 mrt-2(ok1260) III. C. elegans Y41C4A.14 Homozygous. Outer Left Sequence: tcacgcaatcagtgagcttc. Outer Right Sequence: accgagcattttattcgacg. Inner Left Sequence: gtgcgatggcctacaaaact. Inner Right Sequence: ctcggggatcgaacattaaa. Inner Primer PCR Length: 3107. Estimated Deletion Size: about 2600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1209 brc-1(ok1261) III. C. elegans C36A4.8 Homozygous. Outer Left Sequence: aagccaatgaactggtggtc. Outer Right Sequence: tttgtgtgcaaacaccgatt. Inner Left Sequence: gttgagaccgcagaaatcgt. Inner Right Sequence: caaaccgacacaaaatcacg. Inner Primer PCR Length: 2392. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1210 nob-1(ok1266) III. C. elegans Y75B8A.2 Homozygous. Outer Left Sequence: TGGTGCCAAAATGATAGCAA. Outer Right Sequence: TTTTCTCAGTGGGTCTCGCT. Inner Left Sequence: TTTTCGAGTTCGTTTTGGCT. Inner Right Sequence: CGATATCGAGATTAGCGGGA. Inner Primer PCR Length: 2924. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1211 C34G6.5(ok1267) I. C. elegans C34G6.5 Homozygous. Outer Left Sequence: ccgtatcacacactcatcgg. Outer Right Sequence: attgctaaaacccgcagaaa. Inner Left Sequence: agaaggacaactggctccaa. Inner Right Sequence: caacacagcaagcgagaaaa. Inner Primer PCR Length: 2678. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1212 K07D4.5(ok1268) II. C. elegans K07D4.5 Homozygous. Outer Left Sequence: caggaagaggggaaacatca. Outer Right Sequence: ttttgggaggcatgaatagg. Inner Left Sequence: gggtacatccattgccattc. Inner Right Sequence: gcacccgacattttcagttt. Inner Primer PCR Length: 3286. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1213 fkb-4(ok240) V. C. elegans ZC455.10 Homozygous. Outer Left Sequence: GGATAATCGTTGCAGCTGGT. Outer Right Sequence: AACACAAGGCATTTTCGGTC. Inner Left Sequence: TCGAAGAAAAGACGAGCACC. Inner Right Sequence: CAGGAATCACAGCGTCGATA. Inner Primer PCR Length: 3198. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1214 xpo-3(ok1271) IV. C. elegans C49H3.10 Homozygous. Outer Left Sequence: ATTTAGTTGGAGTGGGTGCG. Outer Right Sequence: GGCGATAGCACGAACTCTTC. Inner Left Sequence: ATCAGAATCGATTTGCGAGC. Inner Right Sequence: CGCTGATATCTTGCGAACAA. Inner Primer PCR Length: 2251. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1215 old-1(ok1273) II. C. elegans C08H9.5 Homozygous. Outer Left Sequence: AGACCCACAAGTTTTGTCGC. Outer Right Sequence: GAATTCCCTGGTGAACGAGA. Inner Left Sequence: TGTTGTGGACGGAACGTAAA. Inner Right Sequence: ATCAGCGCATTCGATCTTCT. Inner Primer PCR Length: 2643. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1217 F25G6.2(ok1233) V/nT1 [qIs51] (IV;V). C. elegans F25G6.2 Heterozygotes are WT and GFP+ in the pharynx. ok1233 homozygotes arrest at the L1 stage. Outer Left Sequence: TGAACTCACGAAAATGACGG. Outer Right Sequence: ATACAGGTTCCAATGAGCGG. Inner Left Sequence: CTCGGTGCACGAAGTGTAAA. Inner Right Sequence: GCCAAAAAGGAATTGCAAAA. Inner Primer PCR Length: 3056. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1218 F56B3.9(ok1275) IV. C. elegans F56B3.9 Homozygous. Outer Left Sequence: taagagagcggacgcatttt. Outer Right Sequence: gttaacggaatttcggggtt. Inner Left Sequence: cgtggaggacgatctgaaat. Inner Right Sequence: attcgactgccagtgagctt. Inner Primer PCR Length: 2116. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1219 ZC449.3a(ok1276) X. C. elegans ZC449.3a Homozygous. Outer Left Sequence: aagaaatagaggcggtcggt. Outer Right Sequence: ggtgcatgggaatttgtttc. Inner Left Sequence: tttcaaccacacgccaaata. Inner Right Sequence: aagttgagacggacgaggaa. Inner Primer PCR Length: 2725. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1220 chp-1(ok1277) I. C. elegans Y110A7A.13 Y110A7A.12 Homozygous. Outer Left Sequence: gaccgggtagtttttgcgta. Outer Right Sequence: ggtccgtatttccatgatgc. Inner Left Sequence: gaaacacacaggaacgggat. Inner Right Sequence: aggatgtacgcgtggaaaac. Inner Primer PCR Length: 3175. Estimated Deletion Size: about 2900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1221 his-74(ok1219) V/nT1 [qIs51] (IV;V). C. elegans W05B10.1 Heterozygotes are WT and GFP+. Outer Left Sequence: ttggcttatcggacagatcc. Outer Right Sequence: gtgagctcgtaatatccggc. Inner Left Sequence: aaaatgagaattgatcgcgg. Inner Right Sequence: accttgtgtgatttgcgatg. Inner Primer PCR Length: 2255. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1222 R09B5.1(ok1280) V. C. elegans R09B5.1 Homozygous. Outer Left Sequence: ctcattgacttccgggacat. Outer Right Sequence: aatatttttggggaaaggcg. Inner Left Sequence: ctcctcttcctcgtcctcct. Inner Right Sequence: agctttgcagttccggttta. Inner Primer PCR Length: 3218. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1223 sph-1(ok1199) IV/nT1 [qIs51] (IV;V). C. elegans F42G8.10 Heterozygotes are WT and GFP+. Outer Left Sequence: aaagtgaacagcaggccaac. Outer Right Sequence: attgtccatcccatcgaaga. Inner Left Sequence: aggaaaccatggctttaggc. Inner Right Sequence: gcttgtgctttcgactttcc. Inner Primer PCR Length: 2101. Estimated Deletion Size: about 1350 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1224 C34G6.2(ok1227) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C34G6.2 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: agatgggatgatggagcaag. Outer Right Sequence: caagaggtccggatcaaaag. Inner Left Sequence: gctgaggttgcttaggttgc. Inner Right Sequence: atctccgaaatcgtcacgtc. Inner Primer PCR Length: 3245. Estimated Deletion Size: about 2250 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1225 pxf-1(ok1186) IV/nT1 [qIs51] (IV;V). C. elegans T14G10.2a Heterozygotes are WT and GFP+. Outer Left Sequence: ttgaaatttcgaagatcccg. Outer Right Sequence: catgcccgattatctccact. Inner Left Sequence: acccaccacatttcacgatt. Inner Right Sequence: ttcgattgaccctcatctcc. Inner Primer PCR Length: 3196. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1226 acr-18(ok1285) V. C. elegans F28F8.1 Homozygous. Outer Left Sequence: tcccacatctctcacccttc. Outer Right Sequence: gcactctccgctcatctctc. Inner Left Sequence: gtgctcttcaccgaatccat. Inner Right Sequence: atgtcaaagaaatccgaccg. Inner Primer PCR Length: 3125. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1227 Y49E10.20(ok1286) III. C. elegans Y49E10.20 Homozygous. Outer Left Sequence: cttcttttcgcgtgctctct. Outer Right Sequence: gacaagactagtccgccagc. Inner Left Sequence: gcgggatttcgtcaaaataa. Inner Right Sequence: tcagcaagattttctcggct. Inner Primer PCR Length: 3106. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1228 arx-2(ok1269) V/nT1 [qIs51] (IV;V). C. elegans K07C5.1 Heterozygotes are WT and GFP+. Outer Left Sequence: tccaatttggcttcaacaca. Outer Right Sequence: catcgacttccgcgtatttt. Inner Left Sequence: tttgaatgagagtgggggag. Inner Right Sequence: ttttcaggcgaaatggattc. Inner Primer PCR Length: 2734. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1229 cyc-1(ok1258) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C54G4.8 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: ccgaagaattccgaatcaaa. Outer Right Sequence: tatcggcgcaagctactttt. Inner Left Sequence: tttggcgtcgaagaataacc. Inner Right Sequence: atgctgaggatcggattttg. Inner Primer PCR Length: 2598. Estimated Deletion Size: about 1600 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1230 F49D11.9(ok1190) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F49D11.9 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: aattgccaactgccgattat. Outer Right Sequence: tcggggagtacacaggctac. Inner Left Sequence: aagaacttcagagttgccgc. Inner Right Sequence: cgagctccataaaatcgcat. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 900 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1231 pde-4(ok1290) II. C. elegans R153.1a Homozygous. Outer Left Sequence: acagcaccggcaaatatagc. Outer Right Sequence: tcgacacgctaatcgaagtg. Inner Left Sequence: agcagaacgtgcattgactg. Inner Right Sequence: ttgagcttccagacgatgtg. Inner Primer PCR Length: 3136. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1232 K04F10.1(ok1291) I. C. elegans K04F10.1 Homozygous. Outer Left Sequence: TGGTGAAATTCCATCAAGCA. Outer Right Sequence: GCATTGAGCTGTGCTGAAAA. Inner Left Sequence: AGTGGAAACCGAAGTTGTGC. Inner Right Sequence: CTCGAGCGAGTCGAGTTTTT. Inner Primer PCR Length: 2128. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1233 T22H9.4(ok1294) V. C. elegans T22H9.4 Homozygous. Outer Left Sequence: gtggctgaaaattcggaaaa. Outer Right Sequence: tactgatccgcgtaaaaccc. Inner Left Sequence: aaaatcaatcggtttcagcg. Inner Right Sequence: gcggagacgttagacatggt. Inner Primer PCR Length: 2135. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1234 clk-1(ok1247) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans ZC395.2 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. ok1247 animals are homozygous viable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: CGGGTTTCGCACTATTTTGT. Outer Right Sequence: CAGCTACCGTACCCGACATT. Inner Left Sequence: GCTGGCCCAGTACATTTGTT. Inner Right Sequence: CAGTGTTCCGGATTTCAGGT. Inner Primer PCR Length: . Estimated Deletion Size: about 1250 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1235 T28C6.1(ok1264) IV/nT1 [qIs51] (IV;V). C. elegans T28C6.1 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms as the balancer may break down. ok1264 animals are homozygous viable. Outer Left Sequence: TCCCTGTTCCATTTTTGAGC. Outer Right Sequence: CATCACCTCTACCACCCCAT. Inner Left Sequence: AAGCCAAGAATTCGCAAAAA. Inner Right Sequence: CAACACCACCATGACCTGAA. Inner Primer PCR Length: 2241. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1236 Y110A7A.12(ok1054) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y110A7A.12 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. ok1054 animals are homozygous viable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: GAAACACACAGGAACGGGAT. Outer Right Sequence: AATCGGCGTTTTTCAGAATG. Inner Left Sequence: TGGCAGAAGATGATCCAGTG. Inner Right Sequence: GCGTGGATCTCGATTACGAT. Inner Primer PCR Length: 2442. Estimated Deletion Size: about 1300 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1237 B0416.1(ok1302) X. C. elegans B0416.1 Homozygous. Outer Left Sequence: gcttcaaaaatagggcctcc. Outer Right Sequence: tttatttggatcagcccagc. Inner Left Sequence: cgtcagcacgcttttaatca. Inner Right Sequence: aggtacaaattggcgacctg. Inner Primer PCR Length: 3349. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1238 hmg-11(ok1303) II. C. elegans T05A7.4 Homozygous. Outer Left Sequence: ctcgtggaagccctagacag. Outer Right Sequence: catcgggaaagtacggaaga. Inner Left Sequence: tcagatggtatgatcgccaa. Inner Right Sequence: tcagactgtcacatcgctcc. Inner Primer PCR Length: 2185. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1239 F36A2.4(ok1304) I. C. elegans F36A2.4 Homozygous. Outer Left Sequence: ATGTGGATATCGACCCGAAA. Outer Right Sequence: CAGTCCTGATTTTGGAGGGA. Inner Left Sequence: GTCGAATCGAAGATCAGGGA. Inner Right Sequence: AGTTGGCAAATGATTCGGAG. Inner Primer PCR Length: 2524. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1240 C23F12.2(ok1305) X. C. elegans C23F12.2 Homozygous. Outer Left Sequence: atcagcactatctcgcccat. Outer Right Sequence: acgcaaacattgcaaaaatg. Inner Left Sequence: aaaaacgaaaccacagccac. Inner Right Sequence: cagtaacctagtcacgcgca. Inner Primer PCR Length: 3203. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1241 ZK337.2(ok1306) I. C. elegans ZK337.2 Homozygous. Outer Left Sequence: GGGGAGCCAGAGGTTAAAAG. Outer Right Sequence: TTCTCTCTCACTTCTCCGGC. Inner Left Sequence: ATACGAGCAAGCTCCCTCAA. Inner Right Sequence: GAAGGGTGAAGACACGGAAA. Inner Primer PCR Length: 2572. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1242 C56E6.2(ok1307) II. C. elegans C56E6.2 Homozygous. Outer Left Sequence: ccctttactcttcatccgca. Outer Right Sequence: cgtcgttcaaaacaagagca. Inner Left Sequence: aagagggtgcaagaatcacg. Inner Right Sequence: atcgtcgatgataaggcagg. Inner Primer PCR Length: 2177. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1243 T22H2.5a(ok1308) I. C. elegans T22H2.5a Homozygous. Outer Left Sequence: aactagaagaaatgggcggg. Outer Right Sequence: catttttgtgcaagctcacg. Inner Left Sequence: ttaacaaggaaatgtgggcg. Inner Right Sequence: ccagaactttcctcctgctg. Inner Primer PCR Length: 2122. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1244 W04B5.5(ok1309) III. C. elegans W04B5.5 Homozygous. Outer Left Sequence: gaagcgaggtctacagtccg. Outer Right Sequence: cgtcgaaaagaacccaaaaa. Inner Left Sequence: gtggtgggacccatattgag. Inner Right Sequence: tctgcctgaaaaggctgatt. Inner Primer PCR Length: 2929. Estimated Deletion Size: about 330 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1245 rga-1(ok204) II. C. elegans W02B12.6. Homozygous. Outer Left Sequence: TCCGGTTGAATACACGTTGA. Outer Right Sequence: CTTGCGCTGATGTATCCAGA. Inner Left Sequence: TAAACTGGTAATCCCCGTCG. Inner Right Sequence: AAACTTCGGCAGTTGGAAGA. Inner Primer PCR Length: 3083 bp. Deletion Size: 994 bp. Deletion left flank: ATTGAAATGACATTTTTGGCGAGCGCCGCG. Deletion right flank: GCAGGCCAATTGTTGTCGTATATGCTTATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1246 nxf-1(ok1281) V/nT1 [qIs51] (IV;V). C. elegans C15H11.3 Heterozygotes are WT and GFP+. ok1281 animals arrest as larvae. Outer Left Sequence: gagcttctgcaggacacaca. Outer Right Sequence: ctgcgaagatgggaaaagag. Inner Left Sequence: tgaaaagctcagtgacggtg. Inner Right Sequence: ctcgtctgcatttttgcgta. Inner Primer PCR Length: 3153. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1247 ZK669.1a(ok1311) II. C. elegans ZK669.1a Homozygous. Outer Left Sequence: atgaactgtgcacgcttttg. Outer Right Sequence: attggattctggattgcgag. Inner Left Sequence: tcgttcgactacgctttcct. Inner Right Sequence: aaagccagttttcgtcatgc. Inner Primer PCR Length: 3252. Estimated Deletion Size: about 2600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1248 B0285.8(ok1312) III. C. elegans B0285.8 Homozygous. Outer Left Sequence: aaatcgccaacttccaagaa. Outer Right Sequence: tcgcgaaacattcacttgac. Inner Left Sequence: ttccaaaactctttggctcc. Inner Right Sequence: gaatccggggatttttcagt. Inner Primer PCR Length: 2183. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1249 scrm-2(ok1313) I. C. elegans ZK1053.5 Homozygous. Outer Left Sequence: ttgcagatcaaaccatccaa. Outer Right Sequence: ttggaaaatcttgggctcac. Inner Left Sequence: cttccctcttcgtctatgcg. Inner Right Sequence: tttgaaagaattgggttcgg. Inner Primer PCR Length: 2112. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1250 acr-21(ok1314) III. C. elegans F27B3.2 Homozygous. Outer Left Sequence: caaaagagggtgtcgggtaa. Outer Right Sequence: aaacaccacaagcaggaagc. Inner Left Sequence: aaactgcagacggagctcat. Inner Right Sequence: tgaaattttgggaggattcg. Inner Primer PCR Length: 2667. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1251 T09B9.4(ok1315) X. C. elegans T09B9.4 Homozygous. Outer Left Sequence: tcgagtaaatgtgcatggga. Outer Right Sequence: tccctctctctctcgtctgc. Inner Left Sequence: tcatcgggggatatggtcta. Inner Right Sequence: cagtcgttcgtgtgctcatt. Inner Primer PCR Length: 2287. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1252 C01F4.2(ok1316) I. C. elegans C01F4.2 Homozygous. Outer Left Sequence: actgattttgaggtggtggc. Outer Right Sequence: taaaaccgggaatggagttg. Inner Left Sequence: gtctcgccacgacgaattat. Inner Right Sequence: aaatttcagttcgcattccg. Inner Primer PCR Length: 3272. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1253 ifb-1(ok1317) II. C. elegans F10C1.2b Homozygous. Outer Left Sequence: aaaaatgggcgtgttcagtc. Outer Right Sequence: aaccgtcgaccaattctgac. Inner Left Sequence: ccgaaggatgcagaaacatt. Inner Right Sequence: gtgggcggagtcaactaaag. Inner Primer PCR Length: 3015. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1254 C52B11.3(ok1321) X. C. elegans C52B11.3 Homozygous. Outer Left Sequence: attttagcctgtgtgcgctt. Outer Right Sequence: atgagaaaaatttgcgagcg. Inner Left Sequence: cggaattcgcaatgtctttt. Inner Right Sequence: tactgaaaaaggcaggcagg. Inner Primer PCR Length: 3300. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1255 arf-1.2(ok1322) III. C. elegans B0336.11 Homozygous. Outer Left Sequence: cttgcaaacagttcaacgga. Outer Right Sequence: gagatgacggcttcgaaaag. Inner Left Sequence: tgttgacgataactcctgcg. Inner Right Sequence: tcaggtaatcggatcttggc. Inner Primer PCR Length: 2704. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1256 cdh-4(ok1323) III. C. elegans F25F2.2 Homozygous. Outer Left Sequence: tgagaattcacctgcaaacg. Outer Right Sequence: gcatgagtggtgattccaga. Inner Left Sequence: gttgaagccactgatgcaga. Inner Right Sequence: tcaatcgaacttctccggtc. Inner Primer PCR Length: 3381. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1257 T18D3(ok1324) X. C. elegans T18D3. Homozygous. Outer Left Sequence: TTCCCGATATCTCAAAACGC. Outer Right Sequence: TGAATTCCCAAAATTCTCGC. Inner Left Sequence: TGACAAACAAAATGGCCAAA. Inner Right Sequence: CTCAAAGCGGATTAACCCAA. Inner Primer PCR Length: 3055 bp. Deletion Size: 1026 bp. Deletion left flank: AGTCACACAGACAAAAATTGGCATTTACAC. Deletion right flank: AAATAAACAGTCAGAGACTATTTGCGGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1258 C33H5.11(ok1326) IV. C. elegans C33H5.14 Homozygous. Outer Left Sequence: tcccaagcctggttaagatg. Outer Right Sequence: tgccatcccaaacatcacta. Inner Left Sequence: ctgggtccatcatcactcct. Inner Right Sequence: ccactcctctccgtcttctg. Inner Primer PCR Length: 2936. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1259 dmd-3(ok1327) V. C. elegans Y43F8C.10 Homozygous. Outer Left Sequence: ggctcctcgaacagattttg. Outer Right Sequence: catgacctccttgtttccgt. Inner Left Sequence: ataaggcagttttcgagcca. Inner Right Sequence: gctgttcttcaaggccaaag. Inner Primer PCR Length: 3320. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1260 csn-2(ok1288) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans B0025.2 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. ok1288 is homozygous viable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: ttttatcgattttcccaccg. Outer Right Sequence: cctcgcccatttactggtta. Inner Left Sequence: agacccaggaaaagttcggt. Inner Right Sequence: accatcatccaaaattgcgt. Inner Primer PCR Length: 3177. Estimated Deletion Size: about 1800 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1261 C50B6.1(ok1343) V. C. elegans C50B6.1 Homozygous. Outer Left Sequence: cctctcgtcgggtaacacat. Outer Right Sequence: gtggagtcgactgaagagcc. Inner Left Sequence: ggtgcttcagaatactcggc. Inner Right Sequence: accagccaaccattcacttt. Inner Primer PCR Length: 2105. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1262 cpr-1(ok1344) V. C. elegans C52E4.1 Homozygous. Outer Left Sequence: agtagcaggagcagcaggag. Outer Right Sequence: ttcaacggtacaactgtcgc. Inner Left Sequence: gagtagctccagttggggtg. Inner Right Sequence: tgcatttagaccttggcctt. Inner Primer PCR Length: 2562. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1263 acr-11(ok1345) I. C. elegans D2092.3 Homozygous. Outer Left Sequence: tctccaatccgtttgaatcc. Outer Right Sequence: aagtgtgtcgcagcccttat. Inner Left Sequence: ttttcggcattttgtcagtg. Inner Right Sequence: cgcagagtaatcaaccagca. Inner Primer PCR Length: 2967. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1264 elo-4(ok1346) III. C. elegans C40H1.4 Homozygous. Outer Left Sequence: caatcacgtacccagtcacg. Outer Right Sequence: tgtgtcgatttgagtttggc. Inner Left Sequence: atttcaagcctctttgggct. Inner Right Sequence: tctacggaccgaatcacaca. Inner Primer PCR Length: 2156. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1265 F45H7.6(ok1347) III. C. elegans F45H7.6 Homozygous. Outer Left Sequence: cgcctttttctgacacatca. Outer Right Sequence: ccgtctcatccaactccatt. Inner Left Sequence: tctccaccgggtacaagttc. Inner Right Sequence: tttctcgcatagtcacgtcg. Inner Primer PCR Length: 3251. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1266 pct-1(ok1348) IV. C. elegans C07G1.3 Homozygous. Outer Left Sequence: tgtatgtggatgtgcgtgtg. Outer Right Sequence: aaaagcaagctgaaacggaa. Inner Left Sequence: aaatccgtttggagctgttg. Inner Right Sequence: gttttggttgagggagcttg. Inner Primer PCR Length: 2758. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1267 D1009.3(ok1349) X. C. elegans D1009.3 Homozygous. Outer Left Sequence: tgaggaatttccattctgcc. Outer Right Sequence: tggcctctccacaactctct. Inner Left Sequence: tgctcttgtagagccccagt. Inner Right Sequence: ggtctgtgatgaggggagaa. Inner Primer PCR Length: 2454. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1268 osm-12(ok1351) III. C. elegans Y75B8A.12 Homozygous. Outer Left Sequence: gcagaaaagaaaccaggcag. Outer Right Sequence: gcacccccacagtttttcta. Inner Left Sequence: ttccacgtcaccagatacca. Inner Right Sequence: ccccacagtgctcctacaat. Inner Primer PCR Length: 2849. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1269 mrp-8(ok1360) III. C. elegans Y75B8A.26 Homozygous. Outer Left Sequence: tggttttgccctttttgttc. Outer Right Sequence: gcttcggctgcaataaactc. Inner Left Sequence: acgtcaatttccgtccactc. Inner Right Sequence: ttctgactcgtgaggtgtcg. Inner Primer PCR Length: 2994. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1270 C03G6.13(ok1361) V. C. elegans C03G6.13 Homozygous. Outer Left Sequence: tgcaaaacgtcacgctctta. Outer Right Sequence: atttccgggtcctcaatacc. Inner Left Sequence: tgtcgtcacccgtagtgtgt. Inner Right Sequence: aacaaaacagatcggccaac. Inner Primer PCR Length: 2599. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1271 ceh-33(ok1362) V. C. elegans C10G8.7 Homozygous. Outer Left Sequence: ggaaaacaaaaccagggtca. Outer Right Sequence: cacgatcaagaagaatgcca. Inner Left Sequence: gaacggttgttcccagaaaa. Inner Right Sequence: cccgtgcagaggaatctaaa. Inner Primer PCR Length: 2241. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1272 K08E3.1(ok1363) III. C. elegans K08E3.1 Homozygous. Outer Left Sequence: atgggtccacaatccatcat. Outer Right Sequence: gacaggggaatagggcaaat. Inner Left Sequence: agcgatgaaaagcgactgat. Inner Right Sequence: ggttttgggaaactgggatt. Inner Primer PCR Length: 3154. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1273 T05F1.4(ok1364) I. C. elegans T05F1.4 Homozygous. Outer Left Sequence: tgctgatgtagtcgacggag. Outer Right Sequence: acaataacccagacgcgaac. Inner Left Sequence: attcttggcaaagctcctga. Inner Right Sequence: gcaaaacttcgtgtttgggt. Inner Primer PCR Length: 2312. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1274 F31C3.6(ok1365) I. C. elegans F31C3.6 Homozygous. Outer Left Sequence: ttcagctgattgaagcatcg. Outer Right Sequence: taaggcgcaggaaaacaatc. Inner Left Sequence: gggagctgtcgtccgtaata. Inner Right Sequence: tttacgttccgtccacaaca. Inner Primer PCR Length: 2843. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1275 cwp-3(ok1366) V. C. elegans C37H5.4 Homozygous. Outer Left Sequence: tggcttcctgaatttctgct. Outer Right Sequence: ttgatgccaagtgctgaaag. Inner Left Sequence: ttgggtaggtgaagacctcg. Inner Right Sequence: tttctgagcaagtcctcggt. Inner Primer PCR Length: 2173. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1276 sun-1(ok1282) V/nT1 [qIs51] (IV;V). C. elegans F57B1.2 Heterozygotes are WT and GFP+. Outer Left Sequence: tgattcccaggaaccaaaaa. Outer Right Sequence: tctgtgcctgccaaatcata. Inner Left Sequence: aaaacgaaaacggcactttg. Inner Right Sequence: aattacaattccgcacaggc. Inner Primer PCR Length: 2136. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1277 gcy-6(ok1293) V/nT1 [qIs51] (IV;V). C. elegans B0024.6 Heterozygotes are WT and GFP+. ok1293 animals arrest in the larval stage. Outer Left Sequence: agggagagggataaggggtt. Outer Right Sequence: tgcaatgccagttttcattc. Inner Left Sequence: gtccgccaaggatttaacaa. Inner Right Sequence: gggggataacttcatcagca. Inner Primer PCR Length: 3239. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1278 let-502(ok1283) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C10H11.9 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: tcaatgaagcgtcgaagttg. Outer Right Sequence: gatcgagataatgcgggaga. Inner Left Sequence: cgagttcacgagagagaccc. Inner Right Sequence: gccgaagacatttaacggaa. Inner Primer PCR Length: 3323. Estimated Deletion Size: about 1800 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1279 rfs-1(ok1372) III. C. elegans C30A5.2 Homozygous. Outer Left Sequence: cttccaaatcagcagcaaca. Outer Right Sequence: tctggttgtcgaatgagcag. Inner Left Sequence: ttgcacaaatcgctaatcca. Inner Right Sequence: tgggagtcttgtagtgggct. Inner Primer PCR Length: 2227. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1280 F15B9.4(ok1296) V/nT1 [qIs51] (IV;V). C. elegans F15B9.4 Heterozygotes are WT and GFP+. Outer Left Sequence: gactcaaggcgattgctgat. Outer Right Sequence: tgacgcggtaataaatgcaa. Inner Left Sequence: cgatcgttcccctcaaagta. Inner Right Sequence: ttcttgttgcgatgaagtcg. Inner Primer PCR Length: 3243. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1282 C25E10.11(ok1380) V. C. elegans C25E10.11 Homozygous. Outer Left Sequence: cttggtgagaccggagagag. Outer Right Sequence: tggcatgcaatgtcattttt. Inner Left Sequence: agccgaccggaatatttctt. Inner Right Sequence: actaattttcgaatgccccc. Inner Primer PCR Length: 2466. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1283 M04G12.1a(ok1339) V/nT1 [qIs51] (IV;V). C. elegans M04G12.1a Heterozygotes are WT and GFP+. Outer Left Sequence: tgggaccgaagagagagaga. Outer Right Sequence: ttttcggagccaattttgag. Inner Left Sequence: agtgcagctttgaacggttt. Inner Right Sequence: caatgcgtcactcagtgctt. Inner Primer PCR Length: 2875. Estimated Deletion Size: about 2100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1284 C30F12.6(ok1381) I. C. elegans C30F12.6 Homozygous. Outer Left Sequence: gtataacacaagcctccgcc. Outer Right Sequence: ggagttccagccattgatgt. Inner Left Sequence: ttttcggtctctaaccacgg. Inner Right Sequence: ttggttcaaagctgttgctg. Inner Primer PCR Length: 3260. Estimated Deletion Size: about 2200 bp. Breakpoint data provided by Neline Kriek 10/2004: TTCTTTGTAAATAACTTTTTACTTTACGTTTTTGAAAACATTCTCGATCTCCAAATCTT CbreakpointATTGGTAATTAAAATCAATAATTTCGATTCAGTGTGATCCCACTTAAA TTTTATACATTG. [NOTE: (March 2019) The Moerman lab confirms that diagnostic PCR with one primer internal to the deletion and one external yields the expected product from N2 and no product from RB1284. Primer sequences (5'->3') were ttttcggtctctaaccacgg and gaaacaagcccactcactac.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1285 lys-7(ok1384) V. C. elegans C02A12.4 Homozygous. Outer Left Sequence: ggtttccaaaaagccaacaa. Outer Right Sequence: gtattcagaacgtggcggtt. Inner Left Sequence: tccatcaaaattggcaacaa. Inner Right Sequence: cggcgaaataaattttggaa. Inner Primer PCR Length: 2354. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1286 lys-7(ok1385) V. C. elegans C02A12.4 Homozygous. Outer Left Sequence: ggtttccaaaaagccaacaa. Outer Right Sequence: gtattcagaacgtggcggtt. Inner Left Sequence: tccatcaaaattggcaacaa. Inner Right Sequence: cggcgaaataaattttggaa. Inner Primer PCR Length: 2354. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1287 VZC374L.1(ok1386) X. C. elegans VZC374L.1 Homozygous. Outer Left Sequence: tttgcttttcgaggcatttt. Outer Right Sequence: tgaatcagcaagattgacgg. Inner Left Sequence: gcgtaaatttccggttacga. Inner Right Sequence: tcaagctctctgctcgactg. Inner Primer PCR Length: 2166. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1288 C48C5.1(ok1387) X. C. elegans C48C5.1 Homozygous. Outer Left Sequence: ttgccttgcattcaattgtc. Outer Right Sequence: tgctgaatgagcttcttgga. Inner Left Sequence: agtcattcggaaagcgaaaa. Inner Right Sequence: agcagatgaagaaagccgaa. Inner Primer PCR Length: 2844. Estimated Deletion Size: about 1200 bp. Breakpoint data provided by Neline Kriek 10/2004: GATACAGGTTTTAAGAAAACACCACTTGAAAAACGCAGACAACGTAAGATTTAAAACAT GACTCGTTbreakpointAGTCTAGTGGTCTAGTGAACCAGTTTGCAATTTATGGTTTG AATATTTTAATTACTTTTAATAGTTTGTACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1289 C43C3.2(ok1388) X. C. elegans C43C3.2 Homozygous. Outer Left Sequence: catacccaagtacgcgtgaa. Outer Right Sequence: tgaaagtcaactggtggcag. Inner Left Sequence: ccacgtcgcctgttaagttt. Inner Right Sequence: acagttgcagaagcgagaca. Inner Primer PCR Length: 2850. Estimated Deletion Size: about 900 bp. Breakpoint data provided by Neline Kriek 10/2004: AAGTCANCACTGGAATGCATCTGTATAAGTGTGTCGATGATCTTGGTCGCGAGTTGTTT GTTGTATTTACTTTGTACTbreakpointACGACGAACACCCGACCTGAATATAGCGAG CTAATCGCAATACGTAAGTTGTTATCATTCAAGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1290 npp-14(ok1389) I. C. elegans C03D6.4 Homozygous. Outer Left Sequence: ccaccaaaaagccatgaact. Outer Right Sequence: aatcggaaaatttggtgctg. Inner Left Sequence: cttcggtgcaaacggattat. Inner Right Sequence: attcgctgggaaaaattgtg. Inner Primer PCR Length: 3334. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1291 C05D10.1(ok1390) C. elegans C05D10.1 Homozygous. Outer Left Sequence: gcctccctcattcattttca. Outer Right Sequence: atcgggtggtctgttttgag. Inner Left Sequence: aataaaatttgccgctgtgg. Inner Right Sequence: gtcccgagttgttgtcgttt. Inner Primer PCR Length: 3047. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1292 aex-3(ok1391). C. elegans C02H7.3 Homozygous. Outer Left Sequence: gtcaacgcgtgaaaaactga. Outer Right Sequence: cagcgtgacagatgcagatt. Inner Left Sequence: gctggagagtaaagttgccg. Inner Right Sequence: ccggtttcttgtagacccaa. Inner Primer PCR Length: 2891. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1293 C35E7.1(ok1392) I. C. elegans C35E7.1 Homozygous. Outer Left Sequence: gctcaagaaagccaatggag. Outer Right Sequence: catggagtttgctcgtctga. Inner Left Sequence: atgagcaagttgccgagagt. Inner Right Sequence: gtgggagtactgtaggggca. Inner Primer PCR Length: 2849. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1294 C49G7.8(ok1393) V. C. elegans C49G7.8 Homozygous. Outer Left Sequence: gccaaactttgctaacgctc. Outer Right Sequence: ttagccgaagtagccgaaaa. Inner Left Sequence: aagccttcagacacgctttc. Inner Right Sequence: gaccgattgattttagccga. Inner Primer PCR Length: 2372. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1295 F10C1.5(ok1394) II. C. elegans F10C1.5 Homozygous. Outer Left Sequence: acacacccagaagaccatcc. Outer Right Sequence: tgagcattccttttgggaac. Inner Left Sequence: tgcttttcccgttcaaactt. Inner Right Sequence: cagaatgcctgtttctccgt. Inner Primer PCR Length: 2208. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1296 C17H12.9(ok1395) IV. C. elegans C17H12.9 Homozygous. Outer Left Sequence: agttcctctgccgcttgtaa. Outer Right Sequence: aagttcggggaatttcgtct. Inner Left Sequence: gcaaccacgtagcttcacaa. Inner Right Sequence: ttggaaatggaatcacccat. Inner Primer PCR Length: 3028. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1297 rhy-1(ok1402) II. C. elegans W07A12.7 Homozygous. Outer Left Sequence: cgtcagcatacccagtgttg. Outer Right Sequence: tcaatggcattagcaactcg. Inner Left Sequence: ctccccgttacattttgcat. Inner Right Sequence: tgggtggcaaaagaaaacat. Inner Primer PCR Length: 2148. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1298 C25E10.11(ok1405) V. C. elegans C25E10.11 Homozygous. Outer Left Sequence: cttggtgagaccggagagag. Outer Right Sequence: tggcatgcaatgtcattttt. Inner Left Sequence: agccgaccggaatatttctt. Inner Right Sequence: actaattttcgaatgccccc. Inner Primer PCR Length: 2466. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1299 C24H12.9(ok1406) II. C. elegans C24H12.9 Homozygous. Outer Left Sequence: tcaattccttgtttttgggc. Outer Right Sequence: gtcttgctcgcctctttctg. Inner Left Sequence: gtgcctccaaattacgcact. Inner Right Sequence: atcatccgagatccatttgc. Inner Primer PCR Length: 2113. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1300 cdc-14(ok1407) II. C. elegans C17G10.4 Homozygous. Outer Left Sequence: cagtcgtggatgaacactcg. Outer Right Sequence: caccacaaatgactgttccg. Inner Left Sequence: gagacacttttctcggacgg. Inner Right Sequence: tgaatcgaaatcgtgaacca. Inner Primer PCR Length: 3306. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1301 unc-23(ok1408) V. C. elegans H14N18.1 Homozygous. Outer Left Sequence: tgaaagcaaacgagacatcg. Outer Right Sequence: accaccacctgatctcttgc. Inner Left Sequence: ttttctgtctcacggagcct. Inner Right Sequence: ccagaaaagggacaaccgta. Inner Primer PCR Length: 2756. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1302 Y2C2A.1(ok1409) IV. C. elegans Y2C2A.1 Homozygous. Outer Left Sequence: tcccatcattctccgaaaag. Outer Right Sequence: gaagaggtggtcgatcagga. Inner Left Sequence: ttgaatgcgtatcggatgaa. Inner Right Sequence: agctcgaggggttttctctc. Inner Primer PCR Length: 3007. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1303 D2096.12(ok1410) IV. C. elegans D2096.12 Homozygous. Outer Left Sequence: aaacgaggagggaaacctgt. Outer Right Sequence: ttcatatgcaaaaccggtca. Inner Left Sequence: gatgagaacgcaacaagcaa. Inner Right Sequence: gggcggcaattaaaaacata. Inner Primer PCR Length: 3247. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1304 wdr-5.1(ok1417) III. C. elegans C14B1.4 Homozygous. Outer Left Sequence: acgctgaagacgaggatgat. Outer Right Sequence: aatatcggcaattacgcagg. Inner Left Sequence: attgtgtgttcgctgtgcat. Inner Right Sequence: cgtatttgctctcggtcgat. Inner Primer PCR Length: 2239. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1305 egl-1(ok1418) V. C. elegans F23B12.9 Homozygous. Outer Left Sequence: caagtcaagacaaggcgaca. Outer Right Sequence: cttccgacactgtaagggga. Inner Left Sequence: ttgtgcctactcctgccttt. Inner Right Sequence: tcacagtcgtttcagcgaac. Inner Primer PCR Length: 2163. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1306 str-182(ok1419) V. C. elegans C12D8.1 Homozygous. Outer Left Sequence: aacatggctttttctggcac. Outer Right Sequence: aaagggaaaattgggcaaag. Inner Left Sequence: acggtgcaaacattggtaca. Inner Right Sequence: ttcgaccttgcttcgaaagt. Inner Primer PCR Length: 2264. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1307 F52D1.1(ok1423) X. C. elegans F52D1.1 Homozygous. Outer Left Sequence: tagcggtatgggcgatttac. Outer Right Sequence: ccggcaagtagattgagagc. Inner Left Sequence: cactgcgaccaaagtcttga. Inner Right Sequence: caatatcacgcaggttgtgg. Inner Primer PCR Length: 2819. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1308 rnp-3(ok1424) IV. C. elegans K08D10.3 Homozygous. Outer Left Sequence: cctttttggcgaatttttca. Outer Right Sequence: gacgctccgatattccgata. Inner Left Sequence: ttcaggttaaaatggccgac. Inner Right Sequence: ggtcttggcacgaatttgat. Inner Primer PCR Length: 2346. Estimated Deletion Size: about 1050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1309 C02C2.1(ok1425) III. C. elegans C02C2.1 Homozygous. Outer Left Sequence: cggcacactggcagttatta. Outer Right Sequence: cgtgcttgttccagatctca. Inner Left Sequence: cagacatggtccaaacatgc. Inner Right Sequence: gggaaggaaaacgacacgta. Inner Primer PCR Length: 2920. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1310 clc-2(ok1426) X. C. elegans C01C10.1 Homozygous. Outer Left Sequence: ctccggttgcatcagaaaat. Outer Right Sequence: cctgccaagctggtgttatt. Inner Left Sequence: tgttcaaatttttgctgcca. Inner Right Sequence: tttgtttgtcagcagtccgt. Inner Primer PCR Length: 2117. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1311 R05D11.8(ok1427) I. C. elegans R05D11.8 Homozygous. Outer Left Sequence: gctgcgtgaacatcaagaaa. Outer Right Sequence: attccaacgacttgccaaag. Inner Left Sequence: tttgaccatggcgaatgtta. Inner Right Sequence: tagagggatcgctggagaaa. Inner Primer PCR Length: 2546. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1312 C54E4.2(ok1428) IV. C. elegans C54E4.2 Homozygous. Outer Left Sequence: aaaatgcccacttgcgatac. Outer Right Sequence: gggggaaaactgtttccatt. Inner Left Sequence: aatgcgaatttctttggacg. Inner Right Sequence: aatgcaacaaaccaccaaca. Inner Primer PCR Length: 2878. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1313 C05C10.2(ok1429) II. C. elegans C05C10.2 Homozygous. Outer Left Sequence: gatgtcatgcgagagatgga. Outer Right Sequence: tggtggcagttgatgaatgt. Inner Left Sequence: gccaaattcgcaacaagaat. Inner Right Sequence: ccaaagcttgcattgttgaa. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1314 C05C10.2(ok1430) II. C. elegans C05C10.2 Homozygous. Outer Left Sequence: gatgtcatgcgagagatgga. Outer Right Sequence: tggtggcagttgatgaatgt. Inner Left Sequence: gccaaattcgcaacaagaat. Inner Right Sequence: ccaaagcttgcattgttgaa. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1315 C49G7.1(ok1431) V. C. elegans C49G7.1 Homozygous. Outer Left Sequence: cttatgggtttcaccacgct. Outer Right Sequence: cggctggaaaaagttaccaa. Inner Left Sequence: gcaaactcgaaagcagttcc. Inner Right Sequence: agtagcgggcaaaagactga. Inner Primer PCR Length: 2650. Deletion Size: 1045 bp. Deletion left flank: AAAAATGCAACGACCGACTTCAACGGCCACC. Deletion right flank: TTTGTACTGAACTTTCTTAACCAGGTACTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1316 unc-105(ok1432) II. C. elegans C41C4.5 Homozygous. Outer Left Sequence: gttatgacgaagagcgaggc. Outer Right Sequence: cgaagaccataattcgctcc. Inner Left Sequence: cgtttgagcacaccttcaaa. Inner Right Sequence: catctctccaactgcgaaca. Inner Primer PCR Length: 3052. Estimated Deletion Size: about 950 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1317 srp-3(ok1433) V. C. elegans Y32G9 Homozygous. Outer Left Sequence: ttcacctctttcaattgccc. Outer Right Sequence: gaaaatcgaaattcggcaaa. Inner Left Sequence: ctaagtggtgccactgacga. Inner Right Sequence: tatatcgacccgagccaaac. Inner Primer PCR Length: 2659. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1318 Y66D12A.5(ok1436) III. C. elegans Y66D12A.5 Homozygous. Outer Left Sequence: caagcttctcacaccgatca. Outer Right Sequence: gctacgcttcaagaaatccg. Inner Left Sequence: attgctcgaaaagctggaaa. Inner Right Sequence: cggacctcttcatcgtcatt. Inner Primer PCR Length: 2138. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1319 C34D4.14(ok1437) IV. C. elegans C34D4.14 Homozygous. Outer Left Sequence: ttttgcctcccttcttctga. Outer Right Sequence: atttcttcatcggcaccaac. Inner Left Sequence: attggtggtagcgtctttgg. Inner Right Sequence: ggatggagttcacacggagt. Inner Primer PCR Length: 3257. Estimated Deletion Size: about 1150 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1320 Y67D8A.3(ok1438) IV. C. elegans Y67D8A.3 Homozygous. Outer Left Sequence: aatttgtgcaaacaccgtca. Outer Right Sequence: gacaacctttgcgctttttc. Inner Left Sequence: ttttgtcaacaaattcggca. Inner Right Sequence: gccactctacttttcgccac. Inner Primer PCR Length: 2198. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1321 C56G3.1(ok1439) X. C. elegans C56G3.1 Homozygous. Outer Left Sequence: atagaaaggcaaccgggatt. Outer Right Sequence: cggtaagaaagcggaaatga. Inner Left Sequence: gtttgctctttttggtggga. Inner Right Sequence: catcgtccaatacaatgcga. Inner Primer PCR Length: 2408. Deletion Size: 838 bp deletion with a 1 bp insertion. Sequence across breakpoint from Neline Kriek: tggattggtgataatggctgtagtattgattattaataaccatattccaggaa. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1322 F33H2.6(ok1440) I. C. elegans F33H2.6 Homozygous. Outer Left Sequence: acggtgctagattcggaaaa. Outer Right Sequence: tgttcgaaaaaggttttggc. Inner Left Sequence: agatccggaatttcaccaga. Inner Right Sequence: cgggatttttcaccatctgt. Inner Primer PCR Length: 2165. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1323 C06G1.5(ok1441) X. C. elegans C06G1.5 Homozygous. Outer Left Sequence: gcatagcaccgtgaatgaga. Outer Right Sequence: gcgtaggatggattgaagga. Inner Left Sequence: ttcgtgaacatttggggaat. Inner Right Sequence: ctggcagtgcgaatcaacta. Inner Primer PCR Length: 3306. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1324 ssr-2(ok1375) X. C. elegans C14A11.7 Homozygous. Outer Left Sequence: ttctttcacccccttttcct. Outer Right Sequence: cgccttatttcagcttttgc. Inner Left Sequence: ttttgcaatcactctcgtcg. Inner Right Sequence: gcaaggaaggcattttggta. Inner Primer PCR Length: 2887. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1325 C53C7.1(ok1442) X. C. elegans C53C7.1 Homozygous. Outer Left Sequence: ggatcgtcttgtggtgcttt. Outer Right Sequence: ggggcctcttaacctttttg. Inner Left Sequence: ctggattgccctgaaattgt. Inner Right Sequence: gcagacaaagcatgacctga. Inner Primer PCR Length: 3020. 11/18/04: From Neline Kriek: This has a 788 bp deletion with a 13 bp insertion (TTCTTTTTTTTGA). The sequence across the breakpoint is: actacgacgtggtgtctttTTCTTTTTTTTGAtgacgtgagtttt. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1326 unc-129(ok1443) IV. C. elegans C53D6.2 Homozygous. Outer Left Sequence: agtcgtttctaccgcttcca. Outer Right Sequence: acctttgccggttcctctat. Inner Left Sequence: aacaaaacatcgggacgaag. Inner Right Sequence: tggtcaccgatatgggaact. Inner Primer PCR Length: 2891. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1327 K04G11.4(ok1444) X. C. elegans K04G11.4 Homozygous. Outer Left Sequence: aaccctccacttttgtcacg. Outer Right Sequence: gttaagggcagcaaccaaaa. Inner Left Sequence: tctggcagtgtgcaaatgat. Inner Right Sequence: ggggccttgagaccttatgt. Inner Primer PCR Length: 2137. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1328 dsh-1(ok1445) II. C. elegans C34F11.9. Homozygous. Outer Left Sequence: ATTCTTCCATCCAATGCCAC. Outer Right Sequence: AGTGCATCATGAGCCACAAG. Inner Left Sequence: TGCTCTAGAGGGTTTTCGGA. Inner Right Sequence: GAGAACGACACGATTGCTCA. Inner Primer PCR Length: 3156 bp. Deletion Size: 1132 bp. Deletion left flank: CGGATTCGGAGCCAATTGTTGATTCTTCGA. Deletion right flank: AATGGTGCCTCAGACTCCGGCTCCACACGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1329 C56G3.1(ok1446) X. C. elegans C56G3.1 Homozygous. Outer Left Sequence: atagaaaggcaaccgggatt. Outer Right Sequence: cggtaagaaagcggaaatga. Inner Left Sequence: gtttgctctttttggtggga. Inner Right Sequence: catcgtccaatacaatgcga. Inner Primer PCR Length: 2408. Estimated Deletion Size: about 779 bp. Sequence across the breakpoint: GGTATGTAGAACTTTTTTTTTGAA-breakpoint-AACAAAATGAGCAAAACTCGTGC . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1330 npr-1(ok1447) X. C. elegans C39E6.6 Homozygous. Outer Left Sequence: tcagcaaaattcccgatttc. Outer Right Sequence: gaacctgttagtgggccaag. Inner Left Sequence: gatcaattcttccggctcag. Inner Right Sequence: ggccaaatggaagttgaaaa. Inner Primer PCR Length: 2687. 11/24/04: From Neline Kriek: ok1447 is a 1263 bp deletion with a 1 bp insertion (T). The sequence is: gtatcagcattttcgtatgcacTacgttttgagaagtttcatt. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1331 end-3(ok1448) V. C. elegans F58E10.5 Homozygous. Outer Left Sequence: cgggaatagcggtaatttga. Outer Right Sequence: gtgatgtgcgtggctgtaac. Inner Left Sequence: cactctcgcacgtgaaaaac. Inner Right Sequence: caatgcctgtcttttgagca. Inner Primer PCR Length: 2119. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1332 trx-1(ok1449) II. C. elegans B0228.5 Homozygous. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1333 hrpr-1(ok1278) I/ ? hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) ?. C. elegans F58D5.1 Heterozygous. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP ok1278 homozygotes (larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: (04/2019) RB1333 was originally described as a homozygous strain carrying an unknown GFP transgene in the background. It was recently reported by a user that the strain is heterozygous for ok1278. Their characterization of the strain found that the deletion is balanced by a GFP-marked balancer, most likely hT2[qIs48], though the identity of the balancer has not been molecularly confirmed. Outer Left Sequence: tccaaatcctgaaaatccca. Outer Right Sequence: cagatcccagttttgcgaat. Inner Left Sequence: ttgtgtgtgcgtccaatttt. Inner Right Sequence: acattccaacggacgtcttc. Inner Primer PCR Length: 3310. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1334 C34D4.14(ok1450) IV. C. elegans C34D4.14 Homozygous. Outer Left Sequence: ttttgcctcccttcttctga. Outer Right Sequence: atttcttcatcggcaccaac. Inner Left Sequence: attggtggtagcgtctttgg. Inner Right Sequence: ggatggagttcacacggagt. Inner Primer PCR Length: 3257. Estimated Deletion Size: about 1550 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1335 T21C9.1(ok1451) V. C. elegans T21C9.1 Homozygous. Outer Left Sequence: aatattcccaccactcgcac. Outer Right Sequence: ccacggaatgtcttgaaggt. Inner Left Sequence: ccgagaagctgggagttcta. Inner Right Sequence: gaaaaagaaggttccggctc. Inner Primer PCR Length: 2126. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1336 C53A5.4(ok1452) V. C. elegans C53A5.4 Homozygous. Outer Left Sequence: cttgcactcattctcaccca. Outer Right Sequence: gacaggctcgaggtgaagtc. Inner Left Sequence: tccgtttttggttccagttc. Inner Right Sequence: ctttgaacacacgtagccga. Inner Primer PCR Length: 2366. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1337 hlh-26(ok1453) II. C. elegans C17C3.8 Homozygous. Outer Left Sequence: ccagttccgcctgtaacatt. Outer Right Sequence: ttgccacgactggatattga. Inner Left Sequence: actcacctctgcaactgcct. Inner Right Sequence: agtgtcacacgctgagatgg. Inner Primer PCR Length: 2179. Deletion Size: 983 bp. Additional information from Casonya Johnson 3/2005: the deletion is 983 bases, from base 2254 to 3237 on the cosmid C17C3. The gene C17C3.8 is on the opposite strand, and its coding region is from bases 3237 to 3616. The deletion occurs within the second exon of the gene, so that the first 105 amino acids of the protein are still made. This region contains one of the two HLH domains produced by this protein but eliminates the second one. The first stop codon would allow another 19 amino acids to be added to the peptide. I have pasted the sequence below (the red, underlined sequences are the new nucleotides). MSSSPTSSSS GSPSSHGHRS ETEKQRRDDT NDLLNEFKKI VQKSESEKLS KEEVLFRIVK LLSGIQLHHE SFSTSPGPIR SIKKIKSDRE QVRRNKRVAA YRELR tiknkhlehvfnffelki stop Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1338 C13G3.3(ok1467) V. C. elegans C13G3.3 Homozygous. Outer Left Sequence: gatgtgcaaagagtggggtt. Outer Right Sequence: ttggtttgttacgcctttcc. Inner Left Sequence: aaagtcgcatttggatttgc. Inner Right Sequence: tttccccaacttcacgaaac. Inner Primer PCR Length: 2336. Estimated Deletion Size: about 550 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1339 C01G5.6(ok1468) IV. C. elegans C01G5.6 Homozygous. Outer Left Sequence: caaacattttgcgtcggaat. Outer Right Sequence: tcggaatttcttgtccgttc. Inner Left Sequence: tccttgtcatcgttttgcac. Inner Right Sequence: tcagcttgaacattgctgct. Inner Primer PCR Length: 2131. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1340 nlp-1(ok1469) X. C. elegans C01C4.1 Homozygous. Outer Left Sequence: gaaacattgtgctccaccct. Outer Right Sequence: attcagaagcggaaagagca. Inner Left Sequence: gtgcgtacccagagcatttt. Inner Right Sequence: caattgtgtcctccccctaa. Inner Primer PCR Length: 2212. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1341 nlp-1(ok1470) X. C. elegans C01C4.1 Homozygous. Outer Left Sequence: gaaacattgtgctccaccct. Outer Right Sequence: attcagaagcggaaagagca. Inner Left Sequence: gtgcgtacccagagcatttt. Inner Right Sequence: caattgtgtcctccccctaa. Inner Primer PCR Length: 2212. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1342 ogt-1(ok1474) III. C. elegans K04G7.3 Homozygous. Outer Left Sequence: gccaaagaattgatttcgga. Outer Right Sequence: tgctcttgcaccacaaccta. Inner Left Sequence: acctgtccgagaccattctg. Inner Right Sequence: ccaacgctattgctcctctc. Inner Primer PCR Length: 2730. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1343 T06A10.4(ok1475) IV. C. elegans T06A10.4 Homozygous. Outer Left Sequence: ttctatgggcggagtttagc. Outer Right Sequence: aaaatgcaatttttccgtgc. Inner Left Sequence: gcgggaaatctttggttttt. Inner Right Sequence: ccgaattgtaagggcatgtt. Inner Primer PCR Length: 2193. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1344 zig-3(ok1476) X. C. elegans C14F5.2 Homozygous. Outer Left Sequence: tggttacccatctgcgtgta. Outer Right Sequence: gcatgttccttcatttccgt. Inner Left Sequence: ttcgcgcacattttgagtag. Inner Right Sequence: gacaagatcattggcgaggt. Inner Primer PCR Length: 2296. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1345 coq-4(ok1490) I. C. elegans T03F1.2. Homozygous. Outer Left Sequence: ATGAAGTTGTCAAGGCCACC. Outer Right Sequence: CGTTTCAATGAGCCTGGAGT. Inner Left Sequence: ATTGGAGGAGGTGACACTGC. Inner Right Sequence: AGAGTTGAAGAGAATGCGGC. Inner Primer PCR Length: 2182 bp. Deletion Size: 1210 bp. Deletion left flank: AACACACGACTTCACCCACATCGCATTGGA. Deletion right flank: TTTAGCACGTGTCTCAGCTTCTGCCGCATT. Insertion Sequence: CG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1346 EEED8.16(ok1492) II. C. elegans vEEED8.16 Homozygous. Outer Left Sequence: acgcgaaagaaagcgaataa. Outer Right Sequence: cttgacacacctgccacatc. Inner Left Sequence: caattttctcgacgaggagg. Inner Right Sequence: tttcatgccagtctattgcg. Inner Primer PCR Length: 2911. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1347 set-2(ok1493) III. C. elegans C26E6.11 Homozygous. Outer Left Sequence: tggatgggtcaaatggtagc. Outer Right Sequence: attgtctgtgtggtgcgaag. Inner Left Sequence: tggcgagtttcacaagaatg. Inner Right Sequence: aattcgctggttcgaagttg. Inner Primer PCR Length: 2404 Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1348 M195.2(ok1503) II. C. elegans M195.2 Homozygous. Outer Left Sequence: acgaggtatctgccaacgac. Outer Right Sequence: ctccaagagccttatcaccg. Inner Left Sequence: tagactgatgcgaaatcccc. Inner Right Sequence: gtttctggcttcaatttcgg. Inner Primer PCR Length: 2246. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1349 F57H12.4(ok1504) IV. C. elegans F57H12.4 Homozygous. Outer Left Sequence: atttgccccctttgagactt. Outer Right Sequence: tgctttttccgaaattccat. Inner Left Sequence: tgccccctaagaacattgac. Inner Right Sequence: taacatgctgctggcatttc. Inner Primer PCR Length: 2957. Estimated Deletion Size: about 1300 bp. The breakpoint sequence from Neline Kriek is: atccatcaatgcatca - breakpoint - agcgcaatattcaag. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1350 trpl-5(ok1507) II. C. elegans T16A1.7 Homozygous. Outer Left Sequence: cccattttgtgaattctggg. Outer Right Sequence: ccggtttgccaattttctta. Inner Left Sequence: tcattttggccattttgtga. Inner Right Sequence: aaatgttcaattccggcaac. Inner Primer PCR Length: 3057. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1351 F28A12.1(ok1508) V. C. elegans F28A12.1 Homozygous. Outer Left Sequence: ctgtatgccggacgttcttt. Outer Right Sequence: ttcgcgaagacaacaatcag. Inner Left Sequence: atctgtcaagtttcccgtgg. Inner Right Sequence: ttgcttgggtttctgctttt. Inner Primer PCR Length: 2355. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1352 C32B5.7(ok1509) II. C. elegans C32B5.7 Homozygous. Outer Left Sequence: cggactggacaaaacaacct. Outer Right Sequence: aacttgaacgtcccaacagg. Inner Left Sequence: tgggaatctgcaattgttca. Inner Right Sequence: tctcagaaatacggctggct. Inner Primer PCR Length: 2221. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1353 spv-1(ok1498) II. C. elegans ZK669.1a Homozygous. Outer Left Sequence: atcggtgttggctctacgtc. Outer Right Sequence: aggagctcttccagacacca. Inner Left Sequence: gaaatcctcttctgcggttg. Inner Right Sequence: gagttatgccggtcgaacat. Inner Primer PCR Length: 2929. Estimated Deletion Size: about 1050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1354 trpl-5(ok1499) II. C. elegans T16A1.7 Homozygous. Outer Left Sequence: cccattttgtgaattctggg. Outer Right Sequence: ccggtttgccaattttctta. Inner Left Sequence: tcattttggccattttgtga. Inner Right Sequence: aaatgttcaattccggcaac. Inner Primer PCR Length: 3057. Estimated Deletion Size: about 2050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1355 T04C9.1a(ok1510) III. C. elegans T04C9.1a Homozygous. Outer Left Sequence: tcttcgcttgtccatatccc. Outer Right Sequence: gcgttttgcaaacaaaaaca. Inner Left Sequence: gactctgcgctcatcacaaa. Inner Right Sequence: ggtctccgtgagcatgattt. Inner Primer PCR Length: 3187. Estimated Deletion Size: about 2150 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1356 Y69H2.2(ok1522) V. C. elegans Y69H2.2 Homozygous. Outer Left Sequence: atgccgtgagctcaactttt. Outer Right Sequence: gatggcaaggaagacgttgt. Inner Left Sequence: gttttggcgtcatcgatttt. Inner Right Sequence: agagcacggacgacaagact. Inner Primer PCR Length: 3009. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1357 acdh-1(ok1514) I. C. elegans C55B7.4 [NOTE: This strain has been reported to be heterozygous for the deletion. It is recommended that VC1087 be used instead.] Outer Left Sequence: gtcacctcaaaccaagggaa. Outer Right Sequence: ggtgggatgtacggtaggag. Inner Left Sequence: cttcagcaatattccagccc. Inner Right Sequence: aacggaaggcgaatcaatta. Inner Primer PCR Length: 2235. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1358 C06A8.3(ok1525) II. C. elegans C06A8.3 Homozygous. Outer Left Sequence: ctggtcaacttcagcgaaca. Outer Right Sequence: ttggcactcacatcagaagc. Inner Left Sequence: ggacatccctcatcagtcgt. Inner Right Sequence: gtcctttttcaaatccgcaa. Inner Primer PCR Length: 2211. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1359 B0024.9(ok1526) V. C. elegans B0024.9 Homozygous. Outer Left Sequence: tcaattgcaatactcgctgc. Outer Right Sequence: aaaaaggctctcgacgtgaa. Inner Left Sequence: gatatattccaggcggctca. Inner Right Sequence: gcaagaagaagacccagtcg. Inner Primer PCR Length: 2109. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1360 SSSD1.1(ok1527) X. C. elegans SSSD1.1 Homozygous. Outer Left Sequence: cgaatttcccatgtcagctt. Outer Right Sequence: cgtattcctggctcttcgag. Inner Left Sequence: ggcaagcatgaaaataggga. Inner Right Sequence: acacttgcgaagccaagaat. Inner Primer PCR Length: 2954. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1361 Y75B7AL.2(ok1528) V. C. elegans Y75B7AL.2 Homozygous. Outer Left Sequence: tatgccgttatgccgttatg. Outer Right Sequence: aagactcgagagcggatgaa. Inner Left Sequence: cttttaaagcaatttcgccg. Inner Right Sequence: tcacatgtcaagggatcgag. Inner Primer PCR Length: 2173. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1362 H22K11.4(ok1529) X. C. elegans H22K11.4 Homozygous. Outer Left Sequence: ttgggcttctattggaccac. Outer Right Sequence: atcaatcaaccccaccacat. Inner Left Sequence: ttccatcggaattccttcac. Inner Right Sequence: tcgaacgtcgaaatcattca. Inner Primer PCR Length: 2341. Estimated Deletion Size: about 1450 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1363 3R5.1(ok1530) III. C. elegans 3R5.1 Homozygous. Outer Left Sequence: gacagcgaaacaattgagca. Outer Right Sequence: attattaaacgcgcgaccag. Inner Left Sequence: cgaaggaggatcgttgaaaa. Inner Right Sequence: attgtggaagatcactcggc. Inner Primer PCR Length: 2475. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1364 K09E2.4(ok1540) X. C. elegans K09E2.4 Homozygous. Outer Left Sequence: cactgaatcaaacagcaccg. Outer Right Sequence: cacacaaaacgggacttcct. Inner Left Sequence: tatccggccaaagaaacaac. Inner Right Sequence: ggaacgctccgatttgataa. Inner Primer PCR Length: 3027. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1365 npr-16(ok1541) X. C. elegans F56B6.5 Homozygous. Outer Left Sequence: acaaatcgcaattttccagc. Outer Right Sequence: acaagtccgcaaggtcacat. Inner Left Sequence: caagggtcttcacaatcggt. Inner Right Sequence: tttgatttctcatcgggagg. Inner Primer PCR Length: 3344. Estimated Deletion Size: about 1450 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1366 F14D12.5(ok1551) X. C. elegans F14D12.5 Homozygous. Outer Left Sequence: tttagttacgcgggtatggg. Outer Right Sequence: tgaaaaagttggcaatgcac. Inner Left Sequence: tcttttctggcggcatactt. Inner Right Sequence: ggacttacgatgggcgttta. Inner Primer PCR Length: 2705. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1367 Y73E7A.4(ok1552) I. C. elegans Y73E7A.4 Homozygous. Outer Left Sequence: ctcaatagagcgcgatttcc. Outer Right Sequence: gaggggcacggttaattttt. Inner Left Sequence: tcgccatagttttcgctttt. Inner Right Sequence: tttttgatgggtgggaatgt. Inner Primer PCR Length: 2695. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1368 K07H8.2(ok1553) IV. C. elegans K07H8.2 Homozygous. Outer Left Sequence: ttctcccctttcaggaggat. Outer Right Sequence: ttttcttggcccatcttgtc. Inner Left Sequence: ttttagatgaaaggtggcgg. Inner Right Sequence: gcggaaaatgcaaaatgtct. Inner Primer PCR Length: 2972. Estimated Deletion Size: about 2100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1369 F14D12.5(ok1554) X. C. elegans F14D12.5 Homozygous. Outer Left Sequence: tttagttacgcgggtatggg. Outer Right Sequence: tgaaaaagttggcaatgcac. Inner Left Sequence: tcttttctggcggcatactt. Inner Right Sequence: ggacttacgatgggcgttta. Inner Primer PCR Length: 2705. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1370 F01F1.4(ok1555) III. C. elegans F01F1.4 Homozygous. Outer Left Sequence: ctactgggcgaaagttcgag. Outer Right Sequence: caacgacgaaactgtgatcg. Inner Left Sequence: tttgggtcctggaaagaaaa. Inner Right Sequence: ttctagcacacggatgatgc. Inner Primer PCR Length: 2295. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1371 hil-3(ok1556) X. C. elegans F22F1.1 Homozygous. Outer Left Sequence: ccaagaaacgatcggactgt. Outer Right Sequence: attgtgtgttgcgttggaaa. Inner Left Sequence: cacgttggagaaacagacga. Inner Right Sequence: ttgggagggtgagaagacac. Inner Primer PCR Length: 2159. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1372 nlp-18(ok1557) II. C. elegans F33A8.2 Homozygous. Outer Left Sequence: agtggaatcggatgatcgac. Outer Right Sequence: cccaacaatccatgatttcc. Inner Left Sequence: gcaaagaaattaggcgaacg. Inner Right Sequence: aaagctcacggagccaagta. Inner Primer PCR Length: 2326. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1373 F47G4.3(ok1558) I. C. elegans F47G4.3 Homozygous. Outer Left Sequence: cccagttgttttggctgaat. Outer Right Sequence: acgttcggttcctgtttcac. Inner Left Sequence: ccctcttcaggattcttccc. Inner Right Sequence: tccgctagatccatttccag. Inner Primer PCR Length: 2578. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1374 ocr-3(ok1559) X. C. elegans T10B10.7 Homozygous. Outer Left Sequence: aaacgaaaggcgaagtagca. Outer Right Sequence: agagttccaccagcgagaaa. Inner Left Sequence: caactcctcagatgtcccgt. Inner Right Sequence: aatttttcactgtggggctg. Inner Primer PCR Length: 2338. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1375 C44H4.6(ok1560) X. C. elegans C44H4.6 Homozygous. Outer Left Sequence: catctgtttgcggactttga. Outer Right Sequence: ctctgtgcatgtttgcgttt. Inner Left Sequence: ctttgtcgccttcctcactc. Inner Right Sequence: caatggctaggatcccaaaa. Inner Primer PCR Length: 2778. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1377 acs-17(ok1562) X. C. elegans C46F4.2 Homozygous. Outer Left Sequence: ggtcgattcttcgatttcca. Outer Right Sequence: tggggagcataggtttttca. Inner Left Sequence: cctaaaacatatggccaccg. Inner Right Sequence: tgaacgcacggtatgtttgt. Inner Primer PCR Length: 3216. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1379 F11C7.1(ok1564) X. C. elegans F11C7.1 Homozygous. Outer Left Sequence: gcaaacgccaataactggat. Outer Right Sequence: atgtgaaagcctacgccaac. Inner Left Sequence: tgcctgatctctcattgtgc. Inner Right Sequence: atccaattcggtggactcag. Inner Primer PCR Length: 3214. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1380 C11D2.2(ok1565) IV. C. elegans C11D2.2 Homozygous. Outer Left Sequence: aggccgattgcattgataag. Outer Right Sequence: ggggcaattttcaacaaaaa. Inner Left Sequence: ggtttgatcgacttgttggg. Inner Right Sequence: cccgatccgtttattcttga. Inner Primer PCR Length:3169. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1381 F52B5.1(ok1566) I. C. elegans F52B5.1 Homozygous. Outer Left Sequence: agtggggaaggctttcaaat. Outer Right Sequence: ctattggccccaattgtcac. Inner Left Sequence: gacaaagaggcggagtgaag. Inner Right Sequence: ccgattctgggttcatgtct. Inner Primer PCR Length: 3124. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1382 C08G5.5(ok1567) II. C. elegans C08G5.5 Homozygous. Outer Left Sequence: attgggggattttccaagac. Outer Right Sequence: actagttttgggcatggtgc. Inner Left Sequence: ccgcgagcaaaatacctaaa. Inner Right Sequence: gctttaagcttcggctgttg. Inner Primer PCR Length: 2200. Estimated Deletion Size: about 750 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1383 C47E8.8(ok1568) V. C. elegans C47E8.8 Homozygous. Outer Left Sequence: cgtctggcaaaacttttcgt. Outer Right Sequence: atcattcgctcgagttctgg. Inner Left Sequence: aaaatcattccgatgatgcc. Inner Right Sequence: tcagcttcttcctggtcgat. Inner Primer PCR Length: 3215. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1389 F35D2.5(ok1578) II. C. elegans F35D2.5 Homozygous. Outer Left Sequence: gacgaagagttcgtggaagg. Outer Right Sequence: tcatttcctttttctgcgct. Inner Left Sequence: aataacgggtctgttggcac. Inner Right Sequence: aagcattcattgctcggact. Inner Primer PCR Length: 3332. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1390 Y75B8A.16(ok1579) III. C. elegans Y75B8A.16 Homozygous. Outer Left Sequence: aaggcaattgtcaatggagc. Outer Right Sequence: acaatagaagagacggcgga. Inner Left Sequence: aatgcaatgaggaaggcaag. Inner Right Sequence: taggacgctcgaaacgaagt. Inner Primer PCR Length: 3408. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1391 san-1(ok1580) I. C. elegans ZC328.4 Homozygous. Outer Left Sequence: cgcaaatttttgctgtcttg. Outer Right Sequence: tggattctgcatggatttca. Inner Left Sequence: ggcgtggagaaagctacaac. Inner Right Sequence: ttcagctgccaattgttttg. Inner Primer PCR Length: 2133. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1392 ZK1321.2(ok1581) II. C. elegans ZK1321.2 Homozygous. Outer Left Sequence: aactgctcccacatccattc. Outer Right Sequence: ccggaattccaaatcagaga. Inner Left Sequence: aaatgttgcctgtctccacc. Inner Right Sequence: ggggagaatcgatgacaaga. Inner Primer PCR Length: 3202. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1393 npr-5(ok1583) V. C. elegans Y58G8A.4 Homozygous. Outer Left Sequence: ccgggtttgctgtaggatta. Outer Right Sequence: atgaccgagagatgtctgcc. Inner Left Sequence: cagtccggaacgtttttgtt. Inner Right Sequence: ccctctcctcccctacactc. Inner Primer PCR Length: 2613. Deletion Size: about 784 bp. Sequence across the breakpoint: AGTTGGAGCCTCACTGCAAT-breakpoint-GTCTTTCGAGCACGTCGATGGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1394 ZK563.4(ok1584) X. C. elegans ZK563.4 Homozygous. Outer Left Sequence: tctgcgtgttctggtggtta. Outer Right Sequence: tgggggatgtcttcttaacg. Inner Left Sequence: aaaagcattttgccctgttg. Inner Right Sequence: tttacccatcccatttttcg. Inner Primer PCR Length: 2129. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1396 nlp-20(ok1591) IV. C. elegans F45E4.8 Homozygous. Outer Left Sequence: caacggggaggaagactgta. Outer Right Sequence: atgtcgtcctccagaaatgg. Inner Left Sequence: tgttgatttacgcgaagctg. Inner Right Sequence: tgtacaattggcagacccaa. Inner Primer PCR Length: 2482. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1397 F23B2.7(ok261) IV. C. elegans F23B2.7 Homozygous. Outer Left Sequence: atcggaagctgcaaactgat. Outer Right Sequence: ccttcgatttttccgattca. Inner Left Sequence: tacatgtcgtgcatggttcc. Inner Right Sequence: cgccagaatatccttttcca. Inner Primer PCR Length: 1915. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1400 tre-3(ok394) V. C. elegans W05E10.4 Homozygous. Outer Left Sequence: ccttatcttgcatttcggga. Outer Right Sequence: cttcttcttttgcggtttcg. Inner Left Sequence: gactccatccatttgggaaa. Inner Right Sequence: cattcctagaacctccctgg. Inner Primer PCR Length: 2813. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1402 far-4(ok317) V. C. elegans F15B9.2 Homozygous. Outer Left Sequence: acggagaagaaccaagcaga. Outer Right Sequence: ttcaaacgtgtgatgaggga. Inner Left Sequence: ggcggttcaattcttccata. Inner Right Sequence: agagtggtggcattacctcg. Inner Primer PCR Length: 3041. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1403 Y18D10A.10(ok1596) I. C. elegans Y18D10A.10 Homozygous. Outer Left Sequence: gtttgatgcgggaagttgtt. Outer Right Sequence: tctcgttaggaattggtggc. Inner Left Sequence: aatcccattagcaatctgcg. Inner Right Sequence: cttgaaaacgggggaaaaat. Inner Primer PCR Length: 2308. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1404 lec-1(ok1597) II. C. elegans W09H1.6a Homozygous. Outer Left Sequence: tttcaggaaccaccgaaaag. Outer Right Sequence: gtagcaaacaaaatgcgggt. Inner Left Sequence: cgaagagccaaagtcctacg. Inner Right Sequence: ggagcatcgttgtttcgttt. Inner Primer PCR Length: 3198. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1405 Y59H11AL.1(ok1598) IV. C. elegans Y59H11AL.1 Homozygous. Outer Left Sequence: tggaacacttccccaaactc. Outer Right Sequence: tgatacgggaaaagctacgc. Inner Left Sequence: ggaagcagtttgctctccag. Inner Right Sequence: aattggcagagttgtttcgg. Inner Primer PCR Length: 3299. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1406 npp-11(ok1599) I. C. elegans F53F10.5 Homozygous. Outer Left Sequence: ttttaggccatcattttcgc. Outer Right Sequence: cgacgagttgttcgttttca. Inner Left Sequence: ctgctaccacaacagcctca. Inner Right Sequence: tgtggtcatccttcagcttg. Inner Primer PCR Length: 3168. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1409 R07B1.3(ok1606) X. C. elegans R07B1.3. Homozygous. Outer Left Sequence: TGCAATTGATCACTGGGAAA. Outer Right Sequence: TACCCCAGCTTAAGGCATTG. Inner Left Sequence: GCTTTTTGGCCAATTTTCAA. Inner Right Sequence: ACTGACACCGTTCCCTTGAC. Inner Primer PCR Length: 3169 bp. Deletion Size: 1278 bp. Deletion left flank: CACTATAGCGAAGTAGATAATGATGCGGGA. Deletion right flank: CTTTCACTAGTTCATTTATTGAAAACTGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1410 Y45F10B.8(ok1607) IV. C. elegans Y45F10B.8 Homozygous. Outer Left Sequence: cgaaaagcttgcattcacaa. Outer Right Sequence: aggagacccaggaaaccact. Inner Left Sequence: aatcacacctggtctggagg. Inner Right Sequence: gtctcgatgcgtcttgatga. Inner Primer PCR Length: 2233. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1412 ifp-1(ok1609) X. C. elegans C43C3.1. Homozygous. Outer Left Sequence: TAATTGAATCGGGGCAAGTG. Outer Right Sequence: AGCCGGCACGAACTACTAAA. Inner Left Sequence: GATGGTCTGCATCTCCGATT. Inner Right Sequence: AGAAGCCGAACAACTTTGGA. Inner Primer PCR Length: 3216 bp. Deletion Size: 1135 bp. Deletion left flank: CAGTTCTGGACGACGAGGAATCTCTCACAG. Deletion right flank: ATGTACCTACTGAATATATTTCAACAATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1413 Y51F10.2(ok1610) I. C. elegans Y51F10.2. Homozygous. Outer Left Sequence: CTTCAGAGCCGTAGGTCAGG. Outer Right Sequence: ACGTTGCACCATGTTCAAAA. Inner Left Sequence: AAAACTGGCGGTATTGATGC. Inner Right Sequence: TTCTGATCCTCCCCCTTCTT. Inner Primer PCR Length: 2508 bp. Deletion Size: 1161 bp. Deletion left flank: CAATTTGCACAAAGTGCAACGCGATTTTCG. Deletion right flank: AATTTTGAGTATAAAATATAATTATCTTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1414 twk-9(ok1611) IV. C. elegans ZK1251.8 Homozygous. Outer Left Sequence: aagtgcagcttccacattcc. Outer Right Sequence: atacaacaggcggtgtaggc. Inner Left Sequence: ctgacggctttgctcttttc. Inner Right Sequence: attgttgagccgattggaac. Inner Primer PCR Length: 3116. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1415 C09H5.2(ok1612) V. C. elegans C09H5.2. Homozygous. Outer Left Sequence: GCGTCGAGAAGTGATGTCAA. Outer Right Sequence: GCCATTCCGTGAACAAAGAT. Inner Left Sequence: TGCACATTGCTCAACTCTCC. Inner Right Sequence: AAGACTTGTTGCTCGGCATT. Inner Primer PCR Length: 3115 bp. Deletion Size: 1027 bp. Deletion left flank: GACGCTCCACTTAAAGATATTTTAAGTGTG. Deletion right flank: TTGCTATGGGTCTTGCCGGAAGTGATGTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1416 nhr-83(ok1613) V. C. elegans F48G7.3. Homozygous. Outer Left Sequence: GCAAATGAGCATCAAGTCCA. Outer Right Sequence: TTTTTCTTTCAGCTCCCGAA. Inner Left Sequence: GGCTTTGTCGATCAGATGGT. Inner Right Sequence: ATCATTTTCGTCAAGCGGTC. Inner Primer PCR Length: 3189 bp. Deletion Size: 773 bp. Deletion left flank: GCAAGCATCCTCGGGCGGCCTGAACTAATT. Deletion right flank: TTTTTAAATTCAGATTTCTCCTTGCCGGGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1417 cul-6(ok1614) IV. C. elegans K08E7.7. Homozygous. Outer Left Sequence: TGTTCGTTTTCTGATCGACG. Outer Right Sequence: TGGAAATCAGGCCTTTCAAC. Inner Left Sequence: AATGAGCAATGTGTGGGTGA. Inner Right Sequence: AAAAACCTTCAACCAGGGGT. Inner Primer PCR Length: 3040 bp. Deletion Size: 1059 bp. Deletion left flank: TGGCCATGCACCAGTTGTTTGAAGAATAAC. Deletion right flank: TCCAAAAGACGTTCAAACTCGCTATGCAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1419 srw-140(ok1616) V. C. elegans C03A7.3. Homozygous. Outer Left Sequence: CTGGCACTGTTGCTGACATT. Outer Right Sequence: GGCAATTTTGCCGAATAAAA. Inner Left Sequence: GTCTGGCATTCGTTTGGAAT. Inner Right Sequence: TCGCATAGAGAATCACGCTG. Inner Primer PCR Length: 2118 bp. Deletion Size: 654 bp. Deletion left flank: TTTATTTCAGAGCTTATTACAACACAGTAT. Deletion right flank: CCTATTTTCACACTTTTTCTTGTGTCAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1421 ZC116.3(ok1618) V. C. elegans ZC116.3. Homozygous. Outer Left Sequence: TCCCAAAATTGGTGTCCATT. Outer Right Sequence: GAGCATGTCTCGGAACACAA. Inner Left Sequence: ACCCTTCGGCATATCTTCCT. Inner Right Sequence: TGCGAAAGGATATGGGAAAC. Inner Primer PCR Length: 3155 bp. Deletion Size: 1502 bp. Deletion left flank: GATTCAATTTTAAATAACGTAAGAGAGTAA. Deletion right flank: TCGATTCTCTGAACTTGTGGAAACACACAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1422 cpx-2(ok1619) X. C. elegans K03A11. Homozygous. Outer Left Sequence: ACAACGCCAAATTCGGTTAG. Outer Right Sequence: TGGTCTAGAGCAAATGCGTG. Inner Left Sequence: TCTATGCTTTGCAAATCCCC. Inner Right Sequence: TCATGTGCTCTACGCGTTTC. Inner Primer PCR Length: 2374 bp. Deletion Size: 773 bp. Deletion left flank: TCTTCTATGCTTGTCCTTGCGACGCTTCTC. Deletion right flank: GTGGACATTGGGAACAAAGCTTCAGTATTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1423 C49A9.7(ok1620) IV. C. elegans C49A9.7. Homozygous. Outer Left Sequence: GACAACGTGTCCCCTACCAC. Outer Right Sequence: CCCCCATGCTTAGAAAGTCA. Inner Left Sequence: GACGAAATGGATCTGCGATT. Inner Right Sequence: AGGTACCGTATTTTTGGGGC. Inner Primer PCR Length: 2963 bp. Deletion Size: 737 bp. Deletion left flank: ACACGGGATTCTCATGGTCTTATAATTATT. Deletion right flank: TTCCAGCATTTCTTGCGTCAAAGGTATGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1424 Y37A1C.1a(ok1621) IV. C. elegans Y37A1C.1a Homozygous. Outer Left Sequence: cgccggatttccactaagta. Outer Right Sequence: gtgacgcttgtgacgagaaa. Inner Left Sequence: aaagtgacgagagccgagaa. Inner Right Sequence: ggcttcacgtgctaaaggag. Inner Primer PCR Length: 3196. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1426 brd-1(ok1623) III. C. elegans K04C2.4. Homozygous. Outer Left Sequence: CGAGCCACTGTGAAACTGAA. Outer Right Sequence: AAAAACCGAGGGGAGACTTG. Inner Left Sequence: GATTCGGATTGCTCGGATAA. Inner Right Sequence: CTCGGATCATCTTGCAAACA. Inner Primer PCR Length: 3161 bp. Deletion Size: 1031 bp. Deletion left flank: AGTTTCAGCGAATTTCTTTCTGATTATCAT. Deletion right flank: TCAAAAAAAAAAGTCAAGCCACCTAGGGGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1427 C55B7.6(ok1624) I. C. elegans C55B7.6 Homozygous. Outer Left Sequence: cacgtggtactggcagaaaa. Outer Right Sequence: cgggtacaccagccaatagt. Inner Left Sequence: aaacacggaacttgccaaac. Inner Right Sequence: caaatgtccgttcacacctg. Inner Primer PCR Length: 2950. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1429 T27D1.3(ok1626) III. C. elegans T27D1.3 Homozygous. Outer Left Sequence: tgccctgttgtataccgtga. Outer Right Sequence: agcggcttcaacagacattt. Inner Left Sequence: aatcagttgggatcaccgag. Inner Right Sequence: acctttcccctactgtgcct. Inner Primer PCR Length: 2710. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1431 mps-2(ok1631) II. C. elegans K01A2.8. Homozygous. Outer Left Sequence: AAACTCCTCATTGGACACGG. Outer Right Sequence: ACATGAAGGTACCACCGAGC. Inner Left Sequence: TGGATGTTGCACGGAAAATA. Inner Right Sequence: CGCAGGTTCCAAAATTGTTT. Inner Primer PCR Length: 2892 bp. Deletion Size: 1297 bp. Deletion left flank: AATGGTGAAAAGTTTTATTTGGGGTAGCAC. Deletion right flank: TCAGATTCCCAAAAAGAAAAATAACAGATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1432 sel-10(ok1632) V. C. elegans F55B12.3. Homozygous. Outer Left Sequence: CAGTGACCATCGAACACCTG. Outer Right Sequence: TACGAGATCCGACTGCACAC. Inner Left Sequence: ATCAAGTGAACAAACGTGCG. Inner Right Sequence: AATACAGCCACCATTGCCTC. Inner Primer PCR Length: 3118 bp. Deletion Size: 901 bp. Deletion left flank: ATGGATGATGGATCGATGACACCGGAGGAC. Deletion right flank: TTAGTATTATCTTTTCAGAGACCGAGTTAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1433 rab-37(ok1633) X. C. elegans W01H2.3 Homozygous. Outer Left Sequence: ctgcctctcccattcttttg. Outer Right Sequence: actcgattcgctttcctcag. Inner Left Sequence: acaaaaatagcgttcgcgtc. Inner Right Sequence: cgccagtctcttttgctctc. Inner Primer PCR Length: 3317. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1434 mmcm-1(ok1637) III. C. elegans ZK1058.1 Homozygous. Diminished ablility to incorporate C14 labled propionate into protein (data provided by Randy Chandler). Outer Left Sequence: cgcgaaaattaacgagaagc. Outer Right Sequence: cagccaattttctgtgggtt. Inner Left Sequence: cggtcttcccaatttcttga. Inner Right Sequence: ttcccaaaatttcgttgctc. Inner Primer PCR Length: 3097. Deletion size: 990 bp. Left flank: TAGTCTCAAAATCAGATATACACAAAAATC. Right flank: ATGGCAAGTACTGGAACGACAGCTCCGTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1435 F13G3.5(ok1638) I. C. elegans F13G3.5 Homozygous. Outer Left Sequence: ggctcgaaatcgacatgagt. Outer Right Sequence: ttcacaatctggagtgctgg. Inner Left Sequence: cagataaatcgcgtccgagt. Inner Right Sequence: attgaacgaaaaggctggaa. Inner Primer PCR Length: 2192. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1436 sulp-1(ok1639) I. C. elegans C55B7.6. Homozygous. Outer Left Sequence: CACGTGGTACTGGCAGAAAA. Outer Right Sequence: CGGGTACACCAGCCAATAGT. Inner Left Sequence: AAACACGGAACTTGCCAAAC. Inner Right Sequence: CAAATGTCCGTTCACACCTG. Inner Primer PCR Length: 2950 bp. Deletion Size: 1004 bp. Deletion left flank: ATTTTTTATTCCTCTACATGGGATGCGGTT. Deletion right flank: ACCCTTCTTCAGCAAAAATAATATTTTTTT. Insertion Sequence: CCTCTACATGGGAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1438 ketn-1(ok1641) V. C. elegans F54E2.3 Homozygous. Outer Left Sequence: atacgctcccatgaaactgg. Outer Right Sequence: caagatgacggtgtaaggca. Inner Left Sequence: gattgcgtttccgaactcat. Inner Right Sequence: aactgtgggcatactggagg. Inner Primer PCR Length: 3177. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1439 F54B3.1(ok1642) II. C. elegans F54B3.1 Homozygous. Outer Left Sequence: tcctccacccctaacaatca. Outer Right Sequence: tcagcagacgacatttttgc. Inner Left Sequence: ctccacctccaccttcacat. Inner Right Sequence: tcaaatccgcaaaaatgaca. Inner Primer PCR Length: 3119. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1440 F54B3.1(ok1643) II. C. elegans F54B3.1 Homozygous. Outer Left Sequence: tcctccacccctaacaatca. Outer Right Sequence: tcagcagacgacatttttgc. Inner Left Sequence: ctccacctccaccttcacat. Inner Right Sequence: tcaaatccgcaaaaatgaca. Inner Primer PCR Length: 3119. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1442 T26C11.3(ok1645) X. C. elegans T26C11.3 Homozygous. Outer Left Sequence: aaaatcgaaccacggtcttg. Outer Right Sequence: tctctgcgacaaatgtctgg. Inner Left Sequence: agggcacggaaatgtgatag. Inner Right Sequence: tactccctgtgtccctttgc. Inner Primer PCR Length: 2921. Deletion size: 905 bp. Left flank: AGGGGAAAAAGGGAAAAAACGGCTGAAATT. Right flank: TTTTTCCATTTCTAAACTCGCGTAGTTGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1443 K02G10.3(ok1646) X. C. elegans K02G10.3. Homozygous. Outer Left Sequence: TCGTGTGCTTGTTCACATCA. Outer Right Sequence: AGGTTCAACAACAGCGTTCC. Inner Left Sequence: CGCTCTTTCAAAACTGGCTC. Inner Right Sequence: CGTCGTGATTGCGTAAAGAA. Inner Primer PCR Length: 3123 bp. Deletion Size: 1139 bp. Deletion left flank: ACAAAATGTCATTATTATGAATAAATTGCC. Deletion right flank: AGAATTATCCAAATCGGTCAACTTCTCTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1444 ifp-1(ok1647) X. C. elegans C43C3.1 Homozygous. Outer Left Sequence: taattgaatcggggcaagtg. Outer Right Sequence: agccggcacgaactactaaa. Inner Left Sequence: gatggtctgcatctccgatt. Inner Right Sequence: agaagccgaacaactttgga. Inner Primer PCR Length: 3216. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1445 Y71G12B.11(ok1648) I. C. elegans Y71G12B.11 Homozygous. Outer Left Sequence: tgaagtggtggctcttgttg. Outer Right Sequence: aagttccgtttgttggttgc. Inner Left Sequence: tggtttctaaggggttgcag. Inner Right Sequence: gcgcttctctcaatttgtcc. Inner Primer PCR Length: 3151. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1447 chd-3(ok1651) X. C. elegans T14G8.1. Homozygous. Outer Left Sequence: TCTCGGATAGGACGAACCAG. Outer Right Sequence: GGGCTGCACTAGTCGTTGAT. Inner Left Sequence: GTTCATCATCAGGCGACAAA. Inner Right Sequence: TACCGTGTGCTTCTCACTGG. Inner Primer PCR Length: 3222 bp. Deletion Size: 1081 bp. Deletion left flank: AGTACGCCTTGAACACTTTTTCCGATTTGT. Deletion right flank: AACTGATGTGATTCTTTCTTCAACTGATCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1449 T22H2.2(ok245) I. C. elegans T22H2.2 Homozygous. Outer Left Sequence: tgaaccttgtatgcgctcag. Outer Right Sequence: cagatgggttactcgccaat. Inner Left Sequence: gcgagaagcacgctaaaact. Inner Right Sequence: attgcagttctcggtttcca. Inner Primer PCR Length: 3023. Estimated Deletion Size: about 2700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1450 csp-3(ok1653) I. C. elegans Y47H9C.6. Homozygous. Outer Left Sequence: GGAATCGGAATTGGAACTCA. Outer Right Sequence: CTTCATCGCCACTCACTCAA. Inner Left Sequence: TAATTTCAGCCAATTTGCCC. Inner Right Sequence: CAAACGCCACTGGATTCTCT. Inner Primer PCR Length: 2153 bp. Deletion Size: 1249 bp. Deletion left flank: TCTTTTGAGAGAGCCAATAAGTTTTATTTT. Deletion right flank: TCCGCTTGCGACGACGAGGTTTGGTGTGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1452 F56G4.5(ok1654) I. C. elegans F56G4.5 Homozygous. Outer Left Sequence: atcatgcctaggtttggacg. Outer Right Sequence: attaagagcggcaagcagaa. Inner Left Sequence: aaaaatttctgggtcccacc. Inner Right Sequence: gaaacaattggcccattcac. Inner Primer PCR Length: 3230. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1453 rbg-1(ok1660) X. C. elegans F20D1.6 Homozygous. Outer Left Sequence: gcagcaaacacagcttggta. Outer Right Sequence: ttgcatcaagtggaccttca. Inner Left Sequence: gcagtgccaaaccttcattt. Inner Right Sequence: gtccgctgcttttgtttctc. Inner Primer PCR Length: 3087. Deletion ize: 1077 bp. Left flank: ATCAGTAAAAATTTATGTTCAGAATGATGT. Right flank: CATTCAGATTTTGATATCAACTATTCTTCG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1454 K04G2.7(ok1661) I. C. elegans K04G2.7 Homozygous. Outer Left Sequence: ttatggtcgagccgtttacc. Outer Right Sequence: tgcgatagcaatggacagag. Inner Left Sequence: ctccgtcccattccagtaaa. Inner Right Sequence: gaatggatgaggcgtgagat. Inner Primer PCR Length: 2190. Deletion size: 1825 bp. Left flank: ATGTTTAGATTATCCTATTGGTAAATATAT. Right flank: AGAAGATGTAGAAGTCCTCACCGGATTCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1455 Y39G10AR.3(ok1662) I. C. elegans Y39G10AR.3 Homozygous. Outer Left Sequence: aaaaaggtaaccgaggtggc. Outer Right Sequence: tcataggctggaggtggttc. Inner Left Sequence: agtcgtcgatttctcggttg. Inner Right Sequence: atttgattgcggtgaccttc. Inner Primer PCR Length: 3341. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1456 T26C11.4(ok1663) X. C. elegans T26C11.4. Homozygous. Outer Left Sequence: CCAGACATTTGTCGCAGAGA. Outer Right Sequence: AATTCAAAGTTCCGCCAAGA. Inner Left Sequence: AGTATTGGCACGGACGAATC. Inner Right Sequence: CAGATGGACATCAGCCATTG. Inner Primer PCR Length: 3154 bp. Deletion Size: 870 bp. Deletion left flank: CATCGATGTTTGAGTGTTCTGAAAATGTGA. Deletion right flank: TCCTCCATTATAGCCGTCTGAATCCACATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1457 R06F6.2(ok1664) II. C. elegans R06F6.2 Homozygous. Outer Left Sequence: gtcatgggcctcgttaggta. Outer Right Sequence: ccacaaattccatttttgcc. Inner Left Sequence: caaatttacgactttgccgc. Inner Right Sequence: gattcaaattcccgcaaaaa. Inner Primer PCR Length: 3189. Deletion size: 1927 bp. Left flank: CGTCCTCATTCTTTTTATTAATAAATCGAT. Right flank: TGTCCAGTACTTTCATCAAAAGTCCAACAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1458 rsr-1(ok1665) I. C. elegans F28D9.1 Homozygous. Outer Left Sequence: aaaaagcagggaattgcaga. Outer Right Sequence: cgctgcgtttttattggttt. Inner Left Sequence: cttcttatgcttcttggcgg. Inner Right Sequence: atgaagtttgagccgcagtt. Inner Primer PCR Length: 2889. Deletion size: 698 bp. Left flank: ACTGCCAATTTGCTGCAAAAAATTCAAAAA. Right flank: TTCAAATTCTTATCATCAATCTGTGATAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1459 F49E10.2(ok1666) X. C. elegans F49E10.2. Homozygous. Outer Left Sequence: AAGCATGGGATGGAGACAAG. Outer Right Sequence: AGAGCGCGAACGTACAAGAT. Inner Left Sequence: GACGGTTATTTCCTCTGCCA. Inner Right Sequence: CCAGCACAACTCATTCGAGA. Inner Primer PCR Length: 3209 bp. Deletion Size: 783 bp. Deletion left flank: AAAACCCAACACGAGGTGTGAATCTTCAAA. Deletion right flank: TTTAGAATTCCGCGCAGAGCCAACATTAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1460 F45E1.7(ok1667) X. C. elegans F45E1.7 Homozygous. Outer Left Sequence: tacaccatcccaacgaatca. Outer Right Sequence: ttatgcacttcgatgcctca. Inner Left Sequence: ttttgccgagtctggagttt. Inner Right Sequence: caggattctgggaagttgga. Inner Primer PCR Length: 3331. Estimated Deletion Size: about 2600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1461 F52H2.4(ok1674) X. C. elegans F52H2.4 Homozygous. Outer Left Sequence: tctgcatgacgattgaaagc. Outer Right Sequence: ccgaaaattgcttcccatta. Inner Left Sequence: agcactgaccaagctccaat. Inner Right Sequence: gccgcaattgctcattttat. Inner Primer PCR Length: 3170. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1462 F37C4.6(ok1675) IV. C. elegans F37C4.6 Homozygous. Outer Left Sequence: ttcgtacttgctgtgttggc. Outer Right Sequence: tttgctcttgccgacttttt. Inner Left Sequence: ggtcaccgcaactaaatcgt. Inner Right Sequence: ggcggacacaatggtcttac. Inner Primer PCR Length: 2946. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1463 C18E3.6(ok1676) I. C. elegans C18E3.6 Homozygous. Outer Left Sequence: acagtcaacgtggagcaatg. Outer Right Sequence: cgtcataaactgctctggca. Inner Left Sequence: tcgcttcttggacaattcct. Inner Right Sequence: ccgtgtactcatcgtctcca. Inner Primer PCR Length: 3031. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1466 rbg-1(ok1694) X. C. elegans F20D1.6 Homozygous. Outer Left Sequence: gcagcaaacacagcttggta. Outer Right Sequence: ttgcatcaagtggaccttca. Inner Left Sequence: gcagtgccaaaccttcattt. Inner Right Sequence: gtccgctgcttttgtttctc. Inner Primer PCR Length: 3087. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1467 chtl-1(ok1695) X. C. elegans F35C8.7 Homozygous. Outer Left Sequence: atatgcacagggatgggtgt. Outer Right Sequence: ttcggagttcagacgatgtg. Inner Left Sequence: gggggatgtcatttttgttg. Inner Right Sequence: attttagcaagcgcccctat. Inner Primer PCR Length: 3191. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1468 T25E12.4(ok1704) V. C. elegans T25E12.4 Homozygous. Outer Left Sequence: gcggaaagatcgttcatgtt. Outer Right Sequence: tcaggagcagcagggttaat. Inner Left Sequence: cttcaggttccccacacatt. Inner Right Sequence: cggctccattgttatgcttt. Inner Primer PCR Length: 3330. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1470 cul-5(ok1706) V. C. elegans ZK856.1 Homozygous. Outer Left Sequence: gacgaagaatggagcaaagc. Outer Right Sequence: atggtggttagaggccaatg. Inner Left Sequence: gtagatgacgggcctttgaa. Inner Right Sequence: ttcgaccaactccattgtga. Inner Primer PCR Length: 2993. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1471 pct-1(ok1707) IV. C. elegans C07G1.3 Homozygous. Outer Left Sequence: tgcttgcttccaatgacttg. Outer Right Sequence: ggccattgtcagtacgtgtg. Inner Left Sequence: gaaagtcggaaccattgtgg. Inner Right Sequence: gtagtcggtgggcagaaatg. Inner Primer PCR Length: 3332. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1473 tli-1(ok1724) I. C. elegans F25H2.1 Homozygous. Outer Left Sequence: tccagcaagaccttcgaaac. Outer Right Sequence: tgctgaacgtcgtagacagg. Inner Left Sequence: gagccaacaccaagcagaat. Inner Right Sequence: ttacaggtgctcgttggaga. Inner Primer PCR Length: 2848. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1474 F19G12.3(ok1725) X. C. elegans F19G12.3 Homozygous. Outer Left Sequence: ccgagctccttcaaagtcac. Outer Right Sequence: gcctgcaactgcactaatca. Inner Left Sequence: gctcattttcataacgggga. Inner Right Sequence: agtgtaccctgcattttggc. Inner Primer PCR Length: 2138. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1475 cln-3.1(ok1726) V. C. elegans F07B10.1 Homozygous. Outer Left Sequence: catgtcaacgagctccagaa. Outer Right Sequence: ccatgtgctgctgctgtatt. Inner Left Sequence: cataggcaggagcccataaa. Inner Right Sequence: gataagccggtttgtcgtgt. Inner Primer PCR Length: 2662. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1476 T02C5.1(ok1727) X. C. elegans T02C5.1 [NOTE (06/12/2013): This strain has been reported not to carry the described mutation and is being examined by the originating laboratory.] Homozygous. Outer Left Sequence: tccctcgcaactcagaaaat. Outer Right Sequence: tggtgttttaccccgacatt. Inner Left Sequence: tcgctgagataagagcgtca. Inner Right Sequence: aaatgaaatggaaaatgcgg. Inner Primer PCR Length: 3310. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1477 C26E6.3(ok1728) III. C. elegans C26E6.3 Homozygous. Outer Left Sequence: aacaaactgcggtaccttcg. Outer Right Sequence: ggcgagacccattcaaataa. Inner Left Sequence: ggtaccatgtcggcacttct. Inner Right Sequence: tgtcaggacattcaatggga. Inner Primer PCR Length: 2990. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1478 F13B12.3(ok1729) IV. C. elegans F13B12.3 Homozygous. Outer Left Sequence: tgggctaaatgcgagtatcc. Outer Right Sequence: tcccacgagttagatgctca. Inner Left Sequence: tgaggaaattgttttcggga. Inner Right Sequence: ctcggtgaattggctcctac. Inner Primer PCR Length: 3098. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1479 F13B12.3(ok1730) IV. C. elegans F13B12.3 Homozygous. Outer Left Sequence: tgggctaaatgcgagtatcc. Outer Right Sequence: tcccacgagttagatgctca. Inner Left Sequence: tgaggaaattgttttcggga. Inner Right Sequence: ctcggtgaattggctcctac. Inner Primer PCR Length: 3098. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1480 T05F1.1(ok1731) I. C. elegans T05F1.1 Homozygous. Outer Left Sequence: cttcaagagtggccatttcc. Outer Right Sequence: cttcaagagtggccatttcc. Inner Left Sequence: tttaatgcgggaaagtgacc. Inner Right Sequence: catgcgtgtgcctttaactg. Inner Primer PCR Length: 2592. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1481 ubc-25(ok1732) I. C. elegans F25H2.8 Homozygous. Outer Left Sequence: ggtcgtgaatcgcaatcttt. Outer Right Sequence: ggtcttcgaggtgacagagc. Inner Left Sequence: aatcagaagaggatggcgtg. Inner Right Sequence: agagccgagacagctgagag. Inner Primer PCR Length: 2158. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1482 K11H3.1(ok1733) III. C. elegans K11H3.1 Homozygous. Outer Left Sequence: ttataccgaagacttgccgc. Outer Right Sequence: atcaacaatcgccacaatga. Inner Left Sequence: tttttgccaatccgaaagtc. Inner Right Sequence: gaattttgggcttttgtgga. Inner Primer PCR Length: 3255. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1483 ifa-4(ok1734) X. C. elegans K05B2.3 Homozygous. Outer Left Sequence: atgtttcactttggcggttc. Outer Right Sequence: agagcgaataccgaagctca. Inner Left Sequence: cgagagtaattccgggttca. Inner Right Sequence: tcgcaagatggagaaggact. Inner Primer PCR Length: 2608. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1484 ath-1(ok1735) I. C. elegans K04G2.5 Homozygous. Outer Left Sequence: gaagtacgaatgccggaaaa. Outer Right Sequence: cacccatattcccctttgtg. Inner Left Sequence: atcgaatggaggttggacag. Inner Right Sequence: ctgaatgcattgtttcccct. Inner Primer PCR Length: 2134. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1485 csp-2(ok1742) IV. C. elegans Y73B6BL.7. Homozygous. Outer Left Sequence: GCGACGAAGAATGTTCAGGT. Outer Right Sequence: TTATGTCTTGGTGCGTCTCG. Inner Left Sequence: AGATTGATCGGCTTTGCACT. Inner Right Sequence: AGATGCCGACGTCAATTTTC. Inner Primer PCR Length: 3112 bp. Deletion Size: 1722 bp. Deletion left flank: TTTCCAAATTCATAGGAAAAATACTCTGAA. Deletion right flank: TTGCAAATTCTTGAAAGTAAAGTCAACTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1487 asm-3(ok1744) IV. C. elegans W03G1.7 Homozygous. Outer Left Sequence: aagccagaattccgtgtttg. Outer Right Sequence: tcgtcctttctctcgcattt. Inner Left Sequence: cttgcactcctcctttccac. Inner Right Sequence: ggtgacagaatgcgaggaat. Inner Primer PCR Length: 3344. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1488 R02D3.7(ok1745) IV. C. elegans R02D3.7 Homozygous. Outer Left Sequence: acccgttttcaacaaaacca. Outer Right Sequence: cagtggaattgatgacgtgg. Inner Left Sequence: ttcagccatcagcatacagc. Inner Right Sequence: tgacttttccgccatttttc. Inner Primer PCR Length: 2461. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1489 D1037.1(ok1746) I. C. elegans D1037.1. Homozygous. Outer Left Sequence: AAACGGAGCGTCGTTTGTATC. Outer Right Sequence: GACTGGGACTCAGAAATCGC. Inner Left Sequence: TGATGTGAAATCGTCGGAAA. Inner Right Sequence: GTGCTCGATGAGCATCAAAA. Inner Primer PCR Length: 3141 bp. Deletion Size: 1397 bp. Deletion left flank: AGCTTCAAAGACGACAAGAACGAGAGAAAC. Deletion right flank: AACGAACAGAAGCACAACGAAAAGTTTTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1490 F47A4.3(ok1747) X. C. elegans F47A4.3 Homozygous. Outer Left Sequence: gactggctcgagaagattcg. Outer Right Sequence: tgtagatccgcaaaatgcac. Inner Left Sequence: tgtttgtggctggaaattga. Inner Right Sequence: gtatcaacgtgcctttggct. Inner Primer PCR Length: 3357. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1491 smf-1(ok1748) X. C. elegans K11G12.4. Homozygous. Outer Left Sequence: TCGTGGTGTCAAAATAGCCA. Outer Right Sequence: GTGAAGATTGCCGGAAGAAC. Inner Left Sequence: TCAGTTTGGCACCACGTTAG. Inner Right Sequence: CGACAATCACCCACTGTTTG. Inner Primer PCR Length: 3158 bp. Deletion Size: 959 bp. Deletion left flank: ATTTTCAGATTGTAGGCGGATATCATTGTC. Deletion right flank: GACTCAAGTGTGAAATATTTGTTGGCCTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1492 hcp-2(ok1757) V. C. elegans T06E4.1 Homozygous. Outer Left Sequence: aactcgcattgagccagact. Outer Right Sequence: tgctcctcaagttccgctat. Inner Left Sequence: ttcctcagctcatgatgtcg. Inner Right Sequence: gcttcttctagagccgctga. Inner Primer PCR Length: 3382. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1493 F55F3.3(ok1758) X. C. elegans F55F3.3. Homozygous. Outer Left Sequence: GGAAATAAGGCGCTACGACA. Outer Right Sequence: AAGCAACACACAACGTCAGG. Inner Left Sequence: ATTGCAGTTGATGTGTGGGA. Inner Right Sequence: AGTACTCGGCAGGACAGGAA. Inner Primer PCR Length: 2609 bp. Deletion Size: 1366 bp. Deletion left flank: TGTTTCACATATGGCTCCCAGGATTTGGAG. Deletion right flank: ACAAAACTTACACCAAGAGGTTCCTGTCCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1494 R09B5.11(ok1759) V. C. elegans R09B5.11 Homozygous. Outer Left Sequence: ctgtcgcaagtcctgattga. Outer Right Sequence: gtttccggaacaaacttcca. Inner Left Sequence: gaacgagtgtttctgggacg. Inner Right Sequence: atgaggaaggcgtactggtg. Inner Primer PCR Length: 3113. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1496 plc-2(ok1761) V. C. elegans Y75B12B.6 Homozygous. Outer Left Sequence: cttaatgcgggctctcaaag. Outer Right Sequence: aagtggcggacatattacgg. Inner Left Sequence: agagcttgccgtgagcttag. Inner Right Sequence: gcaaatattggacgcttcgt. Inner Primer PCR Length: 3106. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1497 F44F1.1(ok1765) I. C. elegans F44F1.1 Homozygous. Outer Left Sequence: gttgagtcttttaccccgca. Outer Right Sequence: cattgattgcacggatgaag. Inner Left Sequence: caaaattgtctactgcgcca. Inner Right Sequence: cttcgcgacaatcctaggtc. Inner Primer PCR Length: 3063. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1498 hyl-2(ok1766) X. C. elegans K02G10.6 Homozygous. Outer Left Sequence: acgcagtttccaagcatttc. Outer Right Sequence: tccttttcctcctcggtttt. Inner Left Sequence: gggggagtgatggaagaaat. Inner Right Sequence: ttgcaaaccaattgcaagaa. Inner Primer PCR Length: 3075. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1499 cnt-2(ok1767) III. C. elegans Y39A1A.15 Homozygous. Outer Left Sequence: acgtggggttgtataccgaa. Outer Right Sequence: cggagaggtgaaatggttgt. Inner Left Sequence: tttttcgggttagggaaaca. Inner Right Sequence: gtaacccattccccgttttt. Inner Primer PCR Length: 2823. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1500 ulp-1(ok1768) III. C. elegans T10F2.3 Homozygous. Outer Left Sequence: ccacagtcactgccattttg. Outer Right Sequence: caaaaatgatctgcagccaa. Inner Left Sequence: tccaatgattcagcttccaa. Inner Right Sequence: ctccgcttctatcccattca. Inner Primer PCR Length: 3283. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1501 frm-8(ok1769) III. C. elegans H09G03.2 Homozygous. Outer Left Sequence: cgaatcctccgtatcagagc. Outer Right Sequence: gcgcaaggacgagtaggata. Inner Left Sequence: agccaccattttgaatttcg. Inner Right Sequence: aatttggaatcagctcacgg. Inner Primer PCR Length: 3038. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1502 Y58G8A.1(ok1770) V. C. elegans Y58G8A.1 Homozygous. Outer Left Sequence: ggtcccctgcttgaaaactt. Outer Right Sequence: aaaagacgcgacaagatgct. Inner Left Sequence: tgcaaatttgatggcacagt. Inner Right Sequence: cctctgcgatggaatgaaat. Inner Primer PCR Length: 3202. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1503 cpb-2(ok1772) II. C. elegans C30B5.3 Homozygous. Outer Left Sequence: aacagcaaaatgccaaatcc. Outer Right Sequence: aaaacgtctccgaacaccac. Inner Left Sequence: ggaattccagcactccattg. Inner Right Sequence: agatttcggtcgcttcaaga. Inner Primer PCR Length: 2117. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1504 R06B10.1(ok1773) III. C. elegans R06B10.1 Homozygous. Outer Left Sequence: cagtgaacaatgactggcgt. Outer Right Sequence: tcccgcattatcaatggaat. Inner Left Sequence: ctcgattgtgaattccggtt. Inner Right Sequence: tgagagggttggatggaaag. Inner Primer PCR Length: 3204. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1505 F53G12.3(ok1775) I. C. elegans F53G12.3. Homozygous. Outer Left Sequence: GAATGCTGGAAGGAGGTGAA. Outer Right Sequence: ATGGGAATGGTGACCCTGTA. Inner Left Sequence: AAACACCCGTTGGTGATGAT. Inner Right Sequence: GTCCATGGTCCAACTGCTTT. Inner Primer PCR Length: 3310 bp. Deletion Size: 1066 bp. Deletion left flank: AACAAGGTACTCCGAAAGGATCTCGCAGAA. Deletion right flank: TGCCAAAGTTCACTAGAAGAGCATATCACG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1506 R07E3.1(ok1776) X. C. elegans R07E3.1. Homozygous. Outer Left Sequence: AGATGTGGCGTGTAGGAACC. Outer Right Sequence: AAGTCCCCGCTCTTTGATTT. Inner Left Sequence: AGCTGAAACCCCAGTTGAGA. Inner Right Sequence: GCTTCGTCTCTTCATGACCC. Inner Primer PCR Length: 2102 bp. Deletion Size: 927 bp. Deletion left flank: AATTCACTAGCCAGTTAATGATAGAATCCT. Deletion right flank: AAAAGTACCAAGTGTCTTTTCTGTCTGTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1508 taf-7.1(ok1778) X. C. elegans F54F7.1. Homozygous. Outer Left Sequence: GTCAGCCGAATCAAAAGCTC. Outer Right Sequence: TTTCCTTCCTCTCCCGATTT. Inner Left Sequence: CCACTCTGTTGCCAATTTGA. Inner Right Sequence: GGACGAAGAGCGTCCAAATA. Inner Primer PCR Length: 2248 bp. Deletion Size: 1022 bp. Deletion left flank: TGAAACGGTTACAAAAAATTTCCTGCATTT. Deletion right flank: TCTAATTTGAACAGTTCGGTTATCCTCTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1509 clp-6(ok1779) IV. C. elegans Y77E11A.10. Homozygous. Outer Left Sequence: TGCTTTCTAGGCCCACTTGT. Outer Right Sequence: CCTTGTTGGGTCATTTCCAC. Inner Left Sequence: TCGAAATTTGGACCTTCTCG. Inner Right Sequence: ATTTTCCAGCCAACAACTCG. Inner Primer PCR Length: 3274 bp. Deletion Size: 2386 bp. Deletion left flank: TTTTTTTGGGACGAAAAAATTCGCAAAAAA. Deletion right flank: GGATCCTTGTCTAACATCGAATCGGCTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1511 F21D9.2(ok1802) V. C. elegans F21D9.2. Homozygous. Outer Left Sequence: tgcacggctgtttttgatac. Outer Right Sequence: gatcctgccttccaaatgaa. Inner Left Sequence: gcatgtcgcgaatacagaaa. Inner Right Sequence: tttggctgccttagcatttt. Inner Primer PCR Length: 2215. Deletion Size: 1629. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1512 Y57A10A.24(ok1803) II. C. elegans Y57A10A.24. Homozygous. Outer Left Sequence: aaaattccgcaccagtaacg. Outer Right Sequence: ccgtaaatttggcctgaaaa. Inner Left Sequence: gccgagggactgtaacaaga. Inner Right Sequence: aacaatcatccacgtcacca. Inner Primer PCR Length: 3356. Deletion Size: 1984. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1513 F28E10.4(ok1804) IV. C. elegans F28E10.4. Homozygous. Outer Left Sequence: agtggacttctccaggggtt. Outer Right Sequence: ttagcgagttatcggctcgt. Inner Left Sequence: aaaaatgagcattgttcccg. Inner Right Sequence: aatttgttttcggcaactgg. Inner Primer PCR Length: 2105. Deletion Size: 1016. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1514 Y71F9B.6(ok1810) I. C. elegans Y71F9B.6. Homozygous. Outer Left Sequence: gttctgccatttctcgcttc. Outer Right Sequence: ggtactcgacagcttcctgc. Inner Left Sequence: cgcctcgaaatcctcattta. Inner Right Sequence: atggaagccacaatgacaca. Inner Primer PCR Length: 2720. Deletion Size: 980. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1516 F45E6.3(ok1812) X. C. elegans F45E6.3. Homozygous. Outer Left Sequence: acgtcttgcaaaaatcgagg. Outer Right Sequence: cttgcacgtattgaactccg. Inner Left Sequence: acatttttggccgaacagag. Inner Right Sequence: atcaacacagggcacaaaca. Inner Primer PCR Length: 2930. Deletion Size: 2681. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1517 W01C8.3(ok1813) X. C. elegans W01C8.3 Homozygous. Outer Left Sequence: ttactaatgacggcgtgtgg. Outer Right Sequence: aatgatttccgagttgccag. Inner Left Sequence: cacacttggaattgtccgtg. Inner Right Sequence: agcgagtctgcaaaagaagc. Inner Primer PCR Length: 3338. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1518 F30H5.3(ok1814) III. C. elegans F30H5.3. Homozygous. Outer Left Sequence: ccgttgcgaacaaaaagaat. Outer Right Sequence: gttacccgtgcctgtgagat. Inner Left Sequence: tacttgtcacgacagacgcc. Inner Right Sequence: ccagaacacttgcgagaaca. Inner Primer PCR Length: 2995. Deletion Size: 1766. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1519 T01H10.8(ok1815) X. C. elegans T01H10.8. Homozygous. Outer Left Sequence: ggttccgacgcaaataaaaa. Outer Right Sequence: tcacgcaatctcatccaaaa. Inner Left Sequence: aatctccacgttttggttgg. Inner Right Sequence: agcaccgtcgtagctcagtt. Inner Primer PCR Length: 3120. Deletion Size: 884. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1520 F15E6.6(ok1816) IV. C. elegans F15E6.6. Homozygous. Outer Left Sequence: tcctctcacaacatgccaaa. Outer Right Sequence: tcagtagcaacccgtaaccc. Inner Left Sequence: agtgctgcagtcaacaatgg. Inner Right Sequence: aaaatccagaaaccgtggtg. Inner Primer PCR Length: 3224. Deletion Size: 950. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1521 Y95B8A.12(ok1820) I. C. elegans Y95B8A.12. Homozygous. Outer Left Sequence: ggacgatgtagtgctcggat. Outer Right Sequence: cgcgttggagacttctaagg. Inner Left Sequence: gcggaggaactggaattgta. Inner Right Sequence: ggaagttggtgggggataat. Inner Primer PCR Length: 2777. Deletion Size: 2252. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1522 F56H1.5(ok1821) I. C. elegans F56H1.5. Homozygous. Outer Left Sequence: cgcttcgagaccacgtattt. Outer Right Sequence: cggcaccgattaaaagagaa. Inner Left Sequence: aatttttcagctcatcgcgt. Inner Right Sequence: attttgttcctcccaggctt. Inner Primer PCR Length: 2659. Deletion Size: 1770. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1523 C24G7.1(ok1822) I. C. elegans C24G7.1 Homozygous. Outer Left Sequence: gcgtgagagagcatgtgaac. Outer Right Sequence: cttcaaattcccgttccaaa. Inner Left Sequence: cttgtttgccaatgcctttt. Inner Right Sequence: ttttccggtcgaattttcag. Inner Primer PCR Length: 3302. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1524 F55A3.7(ok1829) I. C. elegans F55A3.7. Homozygous. Outer Left Sequence: catccgctggatacggtact. Outer Right Sequence: ggttaaagggacatcggctt. Inner Left Sequence: gaaacttccgatgggtctca. Inner Right Sequence: ttgtggttttgcgttgttgt. Inner Primer PCR Length: 2891. Deletion Size: 1342. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1525 klo-2(ok1830) III. C. elegans E02H9.5. Homozygous. Outer Left Sequence: atattgtcgcttcgcctgtt. Outer Right Sequence: ctgttgttctccccctgtgt. Inner Left Sequence: gaaggtgccaaggatttgaa. Inner Right Sequence: ggcattttagtcccaaagca. Inner Primer PCR Length: 2708. Deletion Size: 1249. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1526 srd-44(ok1831) X. C. elegans F17A2.8. Homozygous. Outer Left Sequence: gtggacgactaccaatggct. Outer Right Sequence: tcagacatgggcgaatacaa. Inner Left Sequence: cttgatcagtcgctctcgtg. Inner Right Sequence: cgcaaccattttggagagac. Inner Primer PCR Length: 2335. Deletion Size: 2064. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1527 pnk-4(ok1832) X. C. elegans C42D8.3. Homozygous. Outer Left Sequence: ggaaggttctggatgtggag. Outer Right Sequence: aatgtagcattcagcggctt. Inner Left Sequence: cttgtcaacggaacctcgtt. Inner Right Sequence: aaggtttattaagggcccga. Inner Primer PCR Length: 3106. Deletion Size: 1034. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1528 ceh-28(ok1833) X. C. elegans K03A11.3. Homozygous. Outer Left Sequence: gattccaacgagccacaagt. Outer Right Sequence: taacacccgggagtctgttc. Inner Left Sequence: aagtgaagtgatccaaccgc. Inner Right Sequence: taggtatcgcctcccacaac. Inner Primer PCR Length: 2366. Deletion Size: 783. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1531 T23F11.2(ok1836) III. C. elegans T23F11.2. Homozygous. Outer Left Sequence: cacctttctgtaggcgcttc. Outer Right Sequence: ccgtgtgtggttctcctttt. Inner Left Sequence: tcaagaaacccgaccaagtc. Inner Right Sequence: tcctagatggatggacggac. Inner Primer PCR Length: 2160. Deletion Size: 1356. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1533 amx-3(ok1838) V. C. elegans F25C8.2. Homozygous. Outer Left Sequence: GCACCAACGGTTGTTTGATA. Outer Right Sequence: TCCAGACGTTTCCAGATTCC. Inner Left Sequence: TCCCCAGCAAAGCAAATAAC. Inner Right Sequence: AAATAATGCAAACGCGCTCT. Inner Primer PCR Length: 3228 bp. Deletion Size: 1581 bp. Deletion left flank: CCTTATTGTAATTTTTGCAAAATCCTTAAA. Deletion right flank: TGCAAAAGTTTGTCAGACAGTTTCTTAGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1536 dep-1(ok1844) II. C. elegans F44G4.8 Homozygous. Outer Left Sequence: ctccatgaattgaggggttg. Outer Right Sequence: aatttcgacaatgacgctcc. Inner Left Sequence: ggagtcacggaagagatgga. Inner Right Sequence: tcgaacaaagaaagcgaggt. Inner Primer PCR Length: 3098. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1538 cgp-1(ok1846) V. C. elegans Y38C9A.2 Homozygous. Outer Left Sequence: gtctgacgaaccgatccaat. Outer Right Sequence: tgaccagtttcgctattccc. Inner Left Sequence: tcgccttgtatcagttgcag. Inner Right Sequence: tttgtgtctgcgtcctcttg. Inner Primer PCR Length: 2721. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1539 T07A5.2(ok1847) III. C. elegans T07A5.2. Homozygous. Outer Left Sequence: CCTGGAAATACTCCACCGAA. Outer Right Sequence: TAGCCAGTTTTCTCACCGGA. Inner Left Sequence: CTTATCTCGGGTGGTGGTTG. Inner Right Sequence: TGCCTGAAAATTGACAAACG. Inner Primer PCR Length: 2220 bp. Deletion Size: 966 bp. Deletion left flank: AAGTTGTCTTCAAAAAAAATATGAAAAATG. Deletion right flank: AAAAGTCGGGAAATTTTGGCTTTGAAAAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1540 F14F3.2(ok1848) X. C. elegans F14F3.2 Homozygous. Outer Left Sequence: agcaaaaggaatgcgatgac. Outer Right Sequence: gttcccctatcatgccaaaa. Inner Left Sequence: ttctccgttgttttcccaag. Inner Right Sequence: acacgttccgaacctttcac. Inner Primer PCR Length: 3329. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1541 pab-2(ok1851) X. C. elegans F18H3.3. Homozygous. Outer Left Sequence: TTTGTTCTGAGCTTGGGCTT. Outer Right Sequence: AATTTTCATGCCCATTCCAA. Inner Left Sequence: GGCCGAACAAATTACCATGT. Inner Right Sequence: AAATGTGGGCGAAAGATGAG. Inner Primer PCR Length: 3336 bp. Deletion Size: 1835 bp. Deletion left flank: AGATTTTTAAATTTTTTTGGGGTTTTTTGT. Deletion right flank: CCTTTGCTGTTTCCTTCATCGTCGGTGGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1542 C31H1.6(ok1852) IV. C. elegans C31H1.6. Homozygous. Outer Left Sequence: CCAAAGTCTCCTGCCCATTA. Outer Right Sequence: ACATACCACCCGCTTTCTTG. Inner Left Sequence: TTCAAACAATGATACCCGCA. Inner Right Sequence: TTTTGAGGGAAATGCGAAAC. Inner Primer PCR Length: 2666 bp. Deletion Size: 1117 bp. Deletion left flank: TATCAAAGTTTTTTTTTAATGAACTCTATA. Deletion right flank: AAAAGTAGTTTGAAGGTTTAAATTTGATTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1543 C38D9.2(ok1853) V. C. elegans C38D9.2. Homozygous. Outer Left Sequence: TCCCAGGTGAGCAAAAATTC. Outer Right Sequence: TGGTTGTACAGTCCGCAAAA. Inner Left Sequence: GTGTTGTCGATTCAGCCCTT. Inner Right Sequence: GCTTCTTTTGGAGCCTCCTT. Inner Primer PCR Length: 3346 bp. Deletion Size: 801 bp. Deletion left flank: TCAGCTCGACCGCACCGTTGAGCATTACTC. Deletion right flank: TATCAAAATTCCTTTTTTTACCTAAAAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1545 tba-9(ok1858) X. C. elegans F40F4.5. Homozygous. Outer Left Sequence: TGTACCACGCGCTATAATGG. Outer Right Sequence: ACAGAAAACTGTGGAACGGG. Inner Left Sequence: CTATTGGAAGCGATTCGAGC. Inner Right Sequence: CCATGAGCGCGACAGTATTA. Inner Primer PCR Length: 3018 bp. Deletion Size: 1341 bp. Deletion left flank: AAAATGCGGGAGGTTAGACGCAGACTTTTC. Deletion right flank: TTTTTATTCCGTTTCAAAATGTGGTCTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1546 T13G4.3(ok1859) X. C. elegans T13G4.3. Homozygous. Outer Left Sequence: TCCGTAAAAAGCACTGACCC. Outer Right Sequence: TTCTTTCCACCAGCCAATTC. Inner Left Sequence: AAAATCCCAAGTGCAAGACG. Inner Right Sequence: CTTCCCGGAGACCTCTTACC. Inner Primer PCR Length: 3029 bp. Deletion Size: 2025 bp. Deletion left flank: AATGGAAAATTATCATCCGAGAACCGCGTT. Deletion right flank: CAGAGACCATTCAAATGTCTGAAGCAGCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1547 sta-2(ok1860) V. C. elegans F58E6.1. Homozygous. [NOTE (N. Pujol - 12/02/13): This strain reportedly contains an unidentified lethal mutation in the background. See IG1241 for a strain that has been outcrossed to remove this background mutation.] Outer Left Sequence: GCAAAACGAGTTTCTCGACC. Outer Right Sequence: TTGTGATTCCTGACCCCTTC. Inner Left Sequence: CTCTTCTGCATTCTCCCCAG. Inner Right Sequence: GCCAAATGATGTCTCCGATT. Inner Primer PCR Length: 3148 bp. Deletion Size: 864 bp. Deletion left flank: ATTGTTAAATGTGGTGAAGCAGAGAATCAT. Deletion right flank: GAAATGAAATTTCAAGCAATCATAGAAACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1548 F53C3.13(ok1861) II. C. elegans F53C3.13. Homozygous. Outer Left Sequence: TTCGGCAATTTCCAGCTAAC. Outer Right Sequence: AAAAGTCACCCGACAGATGC. Inner Left Sequence: CCGTAATCCACGAGGAGAGA. Inner Right Sequence: TACCGAACTATTCCGAACGC. Inner Primer PCR Length: 3292 bp. Deletion Size: 2238 bp. Deletion left flank: TGAAAAAAATTCCGAAAATTTTTTTTTTGA. Deletion right flank: GCCGATTTTTGGGCTTTTTAAGCTGAATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1549 klo-2(ok1862) III. C. elegans E02H9.5 Homozygous. Outer Left Sequence: atattgtcgcttcgcctgtt. Outer Right Sequence: ctgttgttctccccctgtgt. Inner Left Sequence: gaaggtgccaaggatttgaa. Inner Right Sequence: ggcattttagtcccaaagca. Inner Primer PCR Length: 2708. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1550 K08D12.2(ok1863) IV. C. elegans K08D12.2. Homozygous. Outer Left Sequence: AGTGGAATTTGTGGTCTCGC. Outer Right Sequence: AGAAGAGGGCTCGGAAAAAG. Inner Left Sequence: ATTTCGCTGCAAGACCTGTT. Inner Right Sequence: AGGTCGTTCTCGGACATCAC. Inner Primer PCR Length: 2681 bp. Deletion Size: 1137 bp. Deletion left flank: CCAGGACTCAACAATCCTGTACCTCTACCA. Deletion right flank: TCGAACTTCTTCACGCGATCTACAAGTCGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1551 F49H6.5(ok1864) V. C. elegans F49H6.5. Homozygous. Outer Left Sequence: TTGCTCGTTGCCATAAAGTG. Outer Right Sequence: TCGTCGCTGGAGAAGAGATT. Inner Left Sequence: CAGGAGTGTGCCAAGACTCA. Inner Right Sequence: GCAAGTTTTTCAGAGCGTCC. Inner Primer PCR Length: 2165 bp. Deletion Size: 761 bp. Deletion left flank: TATTGAACAGACGTTATCATTATTCGTCAT. Deletion right flank: TCGGAATGATCTTGTGCAGATTGTTGGTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1552 T08G5.15&T08G5.16(ok1870) V. C. elegans T08G5.2. Homozygous. Outer Left Sequence: AACGGATTTCGCATCGTAGT. Outer Right Sequence: GCCTGCGGTAAGAAACAGAG. Inner Left Sequence: ATTTTTGAAAGCAGCAACGC. Inner Right Sequence: TCAAATTCTTTGGAATCGCC. Inner Primer PCR Length: 3004 bp. Deletion Size: 860 bp. Deletion left flank: CATGATGGTTTTCATTGTCGTGTGTGGAGT. Deletion right flank: TTGAAACAAAAATGAGCAAGTATTAGAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1553 K02E10.1(ok1871) X. C. elegans K02E10.1. Homozygous. Outer Left Sequence: AATCATGCATATTGCTGCGA. Outer Right Sequence: TTAAATCAGACAAAGGCGGG. Inner Left Sequence: TGAGAACAGTTTTCGCATGG. Inner Right Sequence: ATACTGCCAGCCGTTATTCG. Inner Primer PCR Length: 3219 bp. Deletion Size: 1668 bp. Deletion left flank: GTACATTCAAATACGCATAGTAGTGTTGTA. Deletion right flank: AACGAGATGAATTGATCTGTGTAAAAATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1554 R186.7(ok1872) V. C. elegans R186.7. Homozygous. Outer Left Sequence: GCAGCGTGTTTGCGTACTTA. Outer Right Sequence: TCGCCATGTTCTATTCCCAT. Inner Left Sequence: CCAAAACATGGCGTTTTCTT. Inner Right Sequence: AGCTTCGCATTGACACACAG. Inner Primer PCR Length: 2124 bp. Deletion Size: 833 bp. Deletion left flank: AGACAAACTGAGGAGTATTGATGACAAAGT. Deletion right flank: CACATATTTTCTGGCAACCGGTCAAGCATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1555 T08G5.15(ok1883) V. C. elegans T08G5.15. Homozygous. Outer Left Sequence: AACGGATTTCGCATCGTAGT. Outer Right Sequence: GCCTGCGGTAAGAAACAGAG. Inner Left Sequence: ATTTTTGAAAGCAGCAACGC. Inner Right Sequence: TCAAATTCTTTGGAATCGCC. Inner Primer PCR Length: 3004 bp. Deletion Size: 1240 bp. Deletion left flank: AGGTTAATTATTTTCCGAAAACTCTGTAAC. Deletion right flank: CTACAAATCATCTTTTTATCGTCAAAAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1556 shw-3(ok1884) V. C. elegans R186.5. Homozygous. Outer Left Sequence: ACCGGAGCATGTTTTACCTG. Outer Right Sequence: AGTACCGAGCCTCCCAATCT. Inner Left Sequence: ACGAATGCCTCCCCTAGAAT. Inner Right Sequence: CCCTTCATTCTCTGCTCTGG. Inner Primer PCR Length: 3307 bp. Deletion Size: 1112 bp. Deletion left flank: AAACTTTAAAATGAAGCTTCAAAATTTCAA. Deletion right flank: TCACTTTGGAGTCGACTACGGTAGGAGGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1557 hum-5(ok1885) III. C. elegans T02C12.1. Homozygous. Outer Left Sequence: AGGGGATGGGAGAGGAAGTA. Outer Right Sequence: TCGAATTGGTGTTGAAGCAG. Inner Left Sequence: GGCATCAAACACACGAATTG. Inner Right Sequence: TGACCTTGTGGAAATCCCTC. Inner Primer PCR Length: 2991 bp. Deletion Size: 1523 bp. Deletion left flank: CGTCACAAGATAAAACTAATCTCCAAGCTA. Deletion right flank: GGCCAAGATATCTGACCTGAAAATAAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1558 E01A2.7(ok1886) I. C. elegans E01A2.7. Homozygous. Outer Left Sequence: CAACGATCCAACTCCATTCC. Outer Right Sequence: GGTTGTAAATGCTCTCGGCT. Inner Left Sequence: ACTCAGTTTGGGTGCGAAAG. Inner Right Sequence: TTGTTGGGTGTTTCCATTCA. Inner Primer PCR Length: 2347 bp. Deletion Size: 1265 bp. Deletion left flank: CATTCATTGTGATATTTTTAAGTGAACCGT. Deletion right flank: ATTGTTCAAAATCCAATGAGACAATCCGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1560 R02F2.2(ok1894) III. C. elegans R02F2.2. Homozygous. Outer Left Sequence: TTTTGCAGAGGAGCAAAGGT. Outer Right Sequence: CTTGTTAGGATGGTCTCGGC. Inner Left Sequence: ATATCATTGGCTCCCCTGTG. Inner Right Sequence: TTCAAATGCGTGCTTCTGTC. Inner Primer PCR Length: 3399 bp. Deletion Size: 1673 bp. Deletion left flank: CAAAAAACATACAATTGATGAAATGTGGCA. Deletion right flank: ATTTTGTTATGGAAGAAGAGGAGTCGGGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1562 D1086.4(ok1896) V. C. elegans D1086.4. Homozygous. Outer Left Sequence: TGACGTCAAACGTTTTCAGC. Outer Right Sequence: GATGACGTTCCGAGACCAAT. Inner Left Sequence: AGCAATCAGGTGCCATTTGT. Inner Right Sequence: AAGGCCCTGAGAGCGTTTAT. Inner Primer PCR Length: 2194 bp. Deletion Size: 518 bp. Deletion left flank: TAATTTTTTTTCAGCTGAAAAGTCTGTTAT. Deletion right flank: GTTTATTTTTGAGGAAAACAACTCTATAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1565 ZK1073.1(ok1899) X. C. elegans ZK1073.1 Homozygous. Outer Left Sequence: accgtgtggagatgagaagc. Outer Right Sequence: cacgcgtgactgtgactttt. Inner Left Sequence: caaaagtgcgtccactctga. Inner Right Sequence: taacttgcaaatggtggtcg. Inner Primer PCR Length: 3260. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1566 F09A5.2(ok1900) X. C. elegans F09A5.2. Homozygous. Outer Left Sequence: TGAATTCGCAGAGATCAACG. Outer Right Sequence: AGCACAAGTTCCTTGCGAGT. Inner Left Sequence: AAACAGCCCACCCCTATCTC. Inner Right Sequence: TCATAATCCCCGTCTTCGTC. Inner Primer PCR Length: 3232 bp. Deletion Size: 1135 bp. Deletion left flank: GCTATGTATACATTTTTGCTGAAGATTGTA. Deletion right flank: CGAGCAGAACCATTTGGATTTTTTCCATGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1567 gly-6(ok1912) III. C. elegans H38K22.5. Homozygous. Outer Left Sequence: CAGTGGTCCAAATTGCTTCC. Outer Right Sequence: TTCAAAAAGGCGCTGAAAAT. Inner Left Sequence: ATCGAAAATGTCCGGTGAAG. Inner Right Sequence: TCGTCGATCCAGAAGATGTG. Inner Primer PCR Length: 2814 bp. Deletion Size: 1281 bp. Deletion left flank: ATTCCAATTGAATCCACCTCGAAACATTTC. Deletion right flank: AACTCTTCTCTTACCATATCACTCAAAAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1568 cpg-1(ok1913) III. C. elegans C07G2.1. Homozygous. Outer Left Sequence: AACCTCGTAAATATCGCGCA. Outer Right Sequence: AGCGTGCTGGATACACCTCT. Inner Left Sequence: GCAGCGACCGTAGCTAATTT. Inner Right Sequence: ATGGCACTGGGATGAGTAGG. Inner Primer PCR Length: 2170 bp. Deletion Size: 766 bp. Deletion left flank: GAGACGACAACTGTTGCAGAGGATGTTCCA. Deletion right flank: CTGCAATCGAGCCATGCTCTCAACACTACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1569 cpg-1(ok1914) III. C. elegans C07G2.1. Homozygous. Outer Left Sequence: AACCTCGTAAATATCGCGCA. Outer Right Sequence: AGCGTGCTGGATACACCTCT. Inner Left Sequence: GCAGCGACCGTAGCTAATTT. Inner Right Sequence: ATGGCACTGGGATGAGTAGG. Inner Primer PCR Length: 2170 bp. Deletion Size: 722 bp. Deletion left flank: TGTGACTACGTTATGAATGTTCCAGAGTGC. Deletion right flank: CAACCACAACTATCGGTTACGCTCCAATTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1570 C18H9.8(ok1915) II. C. elegans C18H9.8. Homozygous. Outer Left Sequence: CTGCTGGTGTAGGACATGGA. Outer Right Sequence: ATCAATCAAAAAGATCGCCG. Inner Left Sequence: AAACACGCATCAACCACAAA. Inner Right Sequence: GGGTAAAACGACGGAAACAA. Inner Primer PCR Length: 3267 bp. Deletion Size: 1372 bp. Deletion left flank: ATTTGAATGGCGATATGTCGGATATTGAGT. Deletion right flank: CAATTGAGGATATGGAATTGGCGTTAAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1571 R08E3.4(ok1916) X. C. elegans R08E3.4. Homozygous. Outer Left Sequence: CTTGGGATGTTTTCTCCGAA. Outer Right Sequence: CGCTTCTATTGCGTTTCACA. Inner Left Sequence: AGTTATCGGAGGTGTCGGTG. Inner Right Sequence: AAACGAGCACAGCAGGTCTT. Inner Primer PCR Length: 3130 bp. Deletion Size: 1005 bp. Deletion left flank: AATTTACAATTTTCTCTGGTTTTCTCCTCG. Deletion right flank: TTTTAAAAATTGCTCACCTTCTGGCTGAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1572 mlh-1(ok1917) III. C. elegans T28A8.7. Homozygous. Outer Left Sequence: TTGGCACTGCTTGTAAAACG. Outer Right Sequence: CCGTAACCCAATACCCAACA. Inner Left Sequence: TATGTTCCACATCGCTCGAA. Inner Right Sequence: CAGTTGCTAGATGGGTGCAA. Inner Primer PCR Length: 3200 bp. Deletion Size: 1100 bp. Deletion left flank: ACGCCGATATTTTCTTATCGAGTGTGATGA. Deletion right flank: TTTTAAATTTTGGGATTCTAGGCCACCAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1573 dod-22(ok1918) IV. C. elegans F55G11.5. Homozygous. Outer Left Sequence: GGTCGAGCTCACACTTCTCC. Outer Right Sequence: AGCTGGTAAAAGCACTCCCA. Inner Left Sequence: GCTTTCCTGCGTCTTTTGAG. Inner Right Sequence: AAGGCAAGGCTGTATTCACG. Inner Primer PCR Length: 2425 bp. Deletion Size: 1426 bp. Deletion left flank: ATGGATCGGGATACATATTTTCAGACAATT. Deletion right flank: TGTGGTCAGTAGTGGAAAAGCTGATTTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1574 cut-6(ok1919) III. C. elegans M142.2. Homozygous. Outer Left Sequence: TAATTGGCAGCCCAAATGAT. Outer Right Sequence: CAAAAAGTATTTTCCCGCCA. Inner Left Sequence: AATCCTTATCTGCTCCGCAA. Inner Right Sequence: TGGGATAACCTGGCTCTACG. Inner Primer PCR Length: 3255 bp. Deletion Size: 1492 bp. Deletion left flank: TACGCATCCTATGAATGTTCCTACATTTAT. Deletion right flank: AAAACGGAAACACTAAAAACTTTGAAACTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1575 aly-1(ok1920) IV. C. elegans C01F6.5. Homozygous. Outer Left Sequence: ATCTGTTGAGTGCGCAGTTG. Outer Right Sequence: GCGGAAACGAAGAAAGAGTG. Inner Left Sequence: TCAAATGTGTACGGGTGTGG. Inner Right Sequence: AACGTTCGCATCCCTAATTG. Inner Primer PCR Length: 2337 bp. Deletion Size: 1447 bp. Deletion left flank: TCGATCTATATGCATTAATTCATTCTATCA. Deletion right flank: ATTTTACTTGTTTGTTCTCATGTTTTCATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1576 rgl-1(ok1921) X. C. elegans F28B4.2. Homozygous. Outer Left Sequence: GCAACGACGATTCTCCACTT. Outer Right Sequence: GTCGAACGGCTTGTGGTAAT. Inner Left Sequence: GTAGGGAAACAGCGAAGACG. Inner Right Sequence: CGCAACTTATCGTTCGTTCA. Inner Primer PCR Length: 2731 bp. Deletion Size: 680 bp. Deletion left flank: CACGCGCAGAACATTCGATCCATCGGGATA. Deletion right flank: CATCCCTGGCACTGGTGTATTAATAATTCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1577 ckb-2(ok1922) III. C. elegans B0285.9. Homozygous. Outer Left Sequence: GGATTCCGAGCAAGTTCTGT. Outer Right Sequence: CGAGCTTCTCGTGTTCTGTG. Inner Left Sequence: TGAATGTTTCGCGAGTTCAG. Inner Right Sequence: CATTCGACCTTCGGCTTAAT. Inner Primer PCR Length: 2161 bp. Deletion Size: 772 bp. Deletion left flank: TTTCGCAAAATAAATGTTTTCTTCTCAAAA. Deletion right flank: ATGATTTGCAACTAACATGTATACTTATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1578 nhr-69(ok1926) I. C. elegans T23H4.2. Homozygous. Outer Left Sequence: TGCTTTAACGGACGAGTTCA. Outer Right Sequence: ACACCCATCATACGCTCTCC. Inner Left Sequence: AAAGCACAAAAGAAATCCGC. Inner Right Sequence: TCTATGTTTTCCACCCTGGC. Inner Primer PCR Length: 2476 bp. Deletion Size: 1329 bp. Deletion left flank: GTCATTTTTTAAAAAAGAAAGTATGAAACA. Deletion right flank: GAATATATCGCATTTTTTGTTTTATTGGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1579 sptl-3(ok1927) V. C. elegans T22G5.5. Homozygous. Outer Left Sequence: TACTTTGCGCTTCTTACCCG. Outer Right Sequence: GCAGAATTGGTGGGAAATGT. Inner Left Sequence: CTTGGTGTCCCTTTCGTGTT. Inner Right Sequence: AGGGCAAGAATTGGGGTAAT. Inner Primer PCR Length: 3244 bp. Deletion Size: 1585 bp. Deletion left flank: GTATTTTGGCTTGTCCAATTGAATATTACA. Deletion right flank: GTTTTGAAAAATTACGAGCTTGTTCCAATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1580 T08D2.2(ok1933) X. C. elegans T08D2.2. Homozygous. Outer Left Sequence: ACTTGGCGCGTTAGATGACT. Outer Right Sequence: GCAAAAACGACGAAAAGAGC. Inner Left Sequence: ACCTTCATGGCTCGTCATTC. Inner Right Sequence: TAGCGTTTTCTGCCGATTTT. Inner Primer PCR Length: 2847 bp. Deletion Size: 2212 bp. Deletion left flank: ACACTTTCCGGCCCGAAAAATCTTAATTTT. Deletion right flank: TTTTGTACCAAAATTTGAGTTTTAATATAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1581 ife-5(ok1934) II. C. elegans Y57A10A.30 Homozygous. Outer Left Sequence: gtggggaccaaaatttgaga. Outer Right Sequence: tttgcgaaatcggaaaaatc. Inner Left Sequence: ccgataggcatccaaaaatg. Inner Right Sequence: tttcgagcgaattttaacgc. Inner Primer PCR Length: 2111. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1583 plk-2(ok1936) I. C. elegans Y71F9B.7 Homozygous. Outer Left Sequence: aacgaggtgaatcggatttg. Outer Right Sequence: ttttgtgtccttttcccgtc. Inner Left Sequence: cccgaatgtttgttcgttct. Inner Right Sequence: atttcttttcgccgtgtgac. Inner Primer PCR Length: 2714. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1584 K02B9.2(ok1937) X. C. elegans K02B9.2 Homozygous. Outer Left Sequence: tttttcccgcttacctctga. Outer Right Sequence: tctgcagttgttgcgaaatc. Inner Left Sequence: ggttcagatcatcttcggga. Inner Right Sequence: tcttcgaccaacatgcgtag. Inner Primer PCR Length: 2826. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1585 ser-7(ok1944) X. C. elegans C09B7.1. Homozygous. Outer Left Sequence: AGCGTTTCGCGTCATTAACT. Outer Right Sequence: GATCCACATGCCGAAAGACT. Inner Left Sequence: CCGAAAAGAAGTTCTCGCAG. Inner Right Sequence: GGCAAGAATGAAGAATGGGA. Inner Primer PCR Length: 3393 bp. Deletion Size: 1313 bp. Deletion left flank: TCAGAGTCATGAGGGTATGTAAGTTGACTT. Deletion right flank: ACAGATTCGGCAGACGGAGAAAAGTGAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1588 mxl-3(ok1947) X. C. elegans F46G10.6. Homozygous. Outer Left Sequence: CAGATTTGGCAAACCCACTT. Outer Right Sequence: TACAGTCCCCTAGGCCACAC. Inner Left Sequence: TTTCTCTTGCTGGGCAATTT. Inner Right Sequence: CTAAGTCAAGGCAGCCAAGG. Inner Primer PCR Length: 2270 bp. Deletion Size: 955 bp. Deletion left flank: CAAATCAGTGAGTAAAAAAAACTGAAATAA. Deletion right flank: CTTACATCGGAAGAATCCGAGTGATGGCGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1591 ddr-1(ok1956) X. C. elegans C25F6.4. Homozygous. Outer Left Sequence: CACAACAACCCCTGTCATCA. Outer Right Sequence: GTTTCTCACCGCATTTGGTT. Inner Left Sequence: AAGAACTGTGTGCATGCGAG. Inner Right Sequence: GTTGAGCATGATGTGATGGC. Inner Primer PCR Length: 3271 bp. Deletion Size: 1681 bp. Deletion left flank: AGATGGTCGCATCACGATATTGTTCGAGTT. Deletion right flank: GGTACACGAGCTCTGGGAGATGAGATAGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1592 nhr-64(ok1957) I. C. elegans C45E1.1. Homozygous. Outer Left Sequence: AAATTCGTGTCGAAAATGCC. Outer Right Sequence: GTGGACGGTGTGATCACTTG. Inner Left Sequence: GGGATAGAATTCGACCAGCA. Inner Right Sequence: ATCGTTGCATTTAAGGTGGC. Inner Primer PCR Length: 2771 bp. Deletion Size: 1348 bp. Deletion left flank: AATCACTACCTTATGAAGGTCGAATGAGCA. Deletion right flank: AAATCAATTTCGAACTCAGTTTTCAAATTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1593 klp-15(ok1958) I. C. elegans M01E11.6. Homozygous. Outer Left Sequence: CGTAACCAAATTCCGCTCAT. Outer Right Sequence: GTAATCCATTCGATTTGGCG. Inner Left Sequence: TGCCATTTTCGAATTCATCA. Inner Right Sequence: AGGGGCTGATTTCCTCATTT. Inner Primer PCR Length: 2341 bp. Deletion Size: 1283 bp. Deletion left flank: ATAACGTTATTTTACATGAAATGTTAGAAT. Deletion right flank: AGTGAAATCAGCTTGCGATCCGCTCCTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1596 F36F2.1(ok1961) I. C. elegans F36F2.1. Homozygous. Outer Left Sequence: CTATGGCGTCGTCGAAAAAT. Outer Right Sequence: TCCCTCTTATGCTCCCAATG. Inner Left Sequence: CATTTCCATCATCACCACCA. Inner Right Sequence: ATTAAGTCCGTTGCCAAGCA. Inner Primer PCR Length: 2175 bp. Deletion Size: 1205 bp. Deletion left flank: TATACTTTTGTTTTTTTTTAACAAAAAGAT. Deletion right flank: GATGATCATGTTATTATCACACTTTTACTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1598 F41H10.11(ok1963) IV. C. elegans F41H10.11 Dpy animals. Homozygous. Outer Left Sequence: ttcccgagattcagatgtcc. Outer Right Sequence: gttggtggacgaggaaaaag. Inner Left Sequence: acctggtggatcagaagctg. Inner Right Sequence: cgggtagaataaaccgacga. Inner Primer PCR Length: 2236. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1599 nac-2(ok1971) III. C. elegans R107.1 Homozygous. Outer Left Sequence: cacccctgtaggcctgatta. Outer Right Sequence: tacgcctggcttttgtaggt. Inner Left Sequence: tattaaggcatgcggtaggc. Inner Right Sequence: ccaaaaggaaatgaaaagcg. Inner Primer PCR Length: 2870. Deletion size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1600 tub-1(ok1972) II. C. elegans F10B5.4. Homozygous. Outer Left Sequence: ATGATGATGGGACGGAACAT. Outer Right Sequence: TTTTGACACACCACACGCTT. Inner Left Sequence: TGGGACAAGGAAAATCGAAC. Inner Right Sequence: CGGCTTGTTTCCAATCATTT. Inner Primer PCR Length: 2809 bp. Deletion Size: 1676 bp. Deletion left flank: AATTGCATTGAAACCTTTAAAAAGAGTTTC. Deletion right flank: ATGCTCACAGAAACCGATGAGTTATCAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1602 B0198.3(ok1974) X. C. elegans B0198.3. Homozygous. Outer Left Sequence: CGAACAACGCTATAGGAGCC. Outer Right Sequence: TTTAGTGAAACCCCCACGAG. Inner Left Sequence: CAGAAGAAGATGCCGAGTCC. Inner Right Sequence: ACAGCATCCCTTACATTGCC. Inner Primer PCR Length: 3350 bp. Deletion Size: 1810 bp. Deletion left flank: CAATATACCTCAAACACTTCATCACTCAAG. Deletion right flank: GGAATTCAAATATCAATAATGCTCTGAATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1603 klf-3(ok1975) II. C. elegans F54H5.4. Homozygous. Outer Left Sequence: CCGAAAGAGAGTGAAGACGG. Outer Right Sequence: TTTGTTGTTCCTCCAGGTCC. Inner Left Sequence: AAAGCAAAAATGACATCGCC. Inner Right Sequence: GCAAAAGAGGATGGGAATCA. Inner Primer PCR Length: 2642 bp. Deletion Size: 1658 bp. Deletion left flank: TAGAAATCCACCATATTATACGGAAGTGAC. Deletion right flank: TACATCAAGCGAGCGATCGCCACTGCAGCG. klf-3 was formerly known as mua-1. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1604 F08H9.4&srz-97(ok1976) V. C. elegans F08H9.4, F08H9.12. Homozygous. Outer Left Sequence: CGAGACTGCCACATAGGTCA. Outer Right Sequence: TCGTGAGAACTAATTCGGGG. Inner Left Sequence: TCTTGATCGCGAAATAACCC. Inner Right Sequence: GTTGAAGGCAAACCCACATT. Inner Primer PCR Length: 2255 bp. Deletion Size: 1342 bp. Deletion left flank: TATCCAAATGCGAAAGTTGGCAATGTTTAC. Deletion right flank: AAACGTACTCATGTAGATAAATGTGTTGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1605 cdh-5(ok1977) IV. C. elegans F08B4.2. Homozygous. Outer Left Sequence: TAGCAGCACGATATTGCCAG. Outer Right Sequence: CAAGAGCAACAGTTACCGCA. Inner Left Sequence: CAAGGCGTTTGGAGTGAAAT. Inner Right Sequence: AGGAATGGGAGATCGAACCT. Inner Primer PCR Length: 3244 bp. Deletion Size: 1695 bp. Deletion left flank: ATTGTATCCGACTGAAATTGCACCTGAAAA. Deletion right flank: CATCTGTGTCTGAAGCAGTCCGTCCTCCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1608 mlt-9(ok1980) X. C. elegans F09B12.1. Homozygous. Outer Left Sequence: ATTTCCATTCTCGGCTCCTT. Outer Right Sequence: CTCTCACACCGTCATCGAAA. Inner Left Sequence: GGCTGCTTCGATTTCTTCAG. Inner Right Sequence: CGAACCTTTTTGCATGTGTG. Inner Primer PCR Length: 2791 bp. Deletion Size: 1289 bp. Deletion left flank: TTCGTGCTCAAATTTCAAAATAAATGTGCA. Deletion right flank: GTGACATTAAACGTCTCTTGACGTGTTCCG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1610 ZK1307.8(ok1982) II. C. elegans ZK1307.8. Homozygous. Outer Left Sequence: ACACAAAGAAATTGGGGCTG. Outer Right Sequence: AAATTCAAAGAGTTCCCGCC. Inner Left Sequence: ATATCGGCATGAGACCCATC. Inner Right Sequence: TCATTCAAGCGAAACAAGGA. Inner Primer PCR Length: 2131 bp. Deletion Size: 1446 bp. Deletion left flank: ACTGACACCTTCCGATGCTTGGACGGATCC. Deletion right flank: TGACAAGGAAGTTGTTCACGAGGAACTTTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1611 lin-17(os160) I; pqe-1(ok1983) III. C. elegans lin-17(os160) identified and reported by Hitoshi Sawa (personal communication). Phenotype is Egl. Bivulva. Psa (Phasmid socket absent). F52C9.8. Homozygous. Outer Left Sequence: GAGCACAGCACAGATGAAGC. Outer Right Sequence: ATGGCATTTTCGCAAGAAAC. Inner Left Sequence: CCTTCTAACGCTTTACCCCC. Inner Right Sequence: GTCCAGTGGATCCGAGTTGT. Inner Primer PCR Length: 3247 bp. Deletion Size: 1330 bp. Deletion left flank: ACATACTGGAGCTGCTCTGCTTCTCGAATG. Deletion right flank: TGGCGCCGAATACGATTTTGATTAGCGCGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1612 tat-6(ok1984) V. C. elegans F02C9.3. Homozygous. Outer Left Sequence: GACGGAACACGAGTGGAGAT. Outer Right Sequence: CAAAGCTAGGCGGTGAAAAC. Inner Left Sequence: TGCAGATGTTGTGTTGCTGA. Inner Right Sequence: TGGTGATGAAGACCCATGAA. Inner Primer PCR Length: 3263 bp. Deletion Size: 1195 bp. Deletion left flank: AATGGACAGAAACCGTCGGTGTAAAACTTG. Deletion right flank: CGACAGCGTCCGACAGCGGGCGACAGCGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1613 cyp-35A5(ok1985) V. C. elegans K07C6.5. Homozygous. Outer Left Sequence: CTCGGCTTGAATAATGGGAA. Outer Right Sequence: AAACTACGCTTTGGCGAGAA. Inner Left Sequence: CCGCCCTTAAAAAGTTACCC. Inner Right Sequence: AAACAAATCCCACCGACAAA. Inner Primer PCR Length: 2497 bp. Deletion Size: 807 bp. Deletion left flank: ACTTGTGGCTGACTGGTCAAGAAACCACGA. Deletion right flank: TTTTAAACATATAGGTTTTTCGCATTTTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1615 glt-5(ok1987) II. C. elegans Y53C12A.2. Homozygous. Outer Left Sequence: TGAGAATTTGGGAACATCGG. Outer Right Sequence: ATCAATCGTTCCATGCATCA. Inner Left Sequence: ATTTGCTCAGAAAACGGGAA. Inner Right Sequence: ATTCAGCCATCATGGGAATC. Inner Primer PCR Length: 2194 bp. Deletion Size: 1158 bp. Deletion left flank: TCTTCTCAGCTTCTGCAACGTCAGCATTCA. Deletion right flank: TAGTTAGTTTGCACTTGAGAAAATGTTGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1617 Y71H2AM.12(ok1989) III. C. elegans Y71H2AM.12 Homozygous. Outer Left Sequence: gcgaaaaaggtaactgctgg. Outer Right Sequence: gttgaggcccaaaaatcaaa. Inner Left Sequence: atgcagcacctcctcgtaac. Inner Right Sequence: gttgtggttgttggggaatc. Inner Primer PCR Length: 2336. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1618 hda-3(ok1991) I. C. elegans R06C1.1. Homozygous. Outer Left Sequence: CTATTTAAAGGCGCACAGCC. Outer Right Sequence: CCAGATGAGCCTCCAACACT. Inner Left Sequence: AATGGCCCAAAATCACAAAA. Inner Right Sequence: GCATCGTGTTCGAATGACAC. Inner Primer PCR Length: 3336 bp. Deletion Size: 2289 bp. Deletion left flank: GAATTTTTGCCGAAAACTGAGAAAATCTTC. Deletion right flank: AAAAATTCTGAAAATGCAAAATTTCAGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1619 ZC8.4(ok1992) X. C. elegans ZC8.4 Homozygous. Outer Left Sequence: tgagaaaaattcgtggaggc. Outer Right Sequence: attggcagatgattggaagc. Inner Left Sequence: aagaaattgcacgaaatggc. Inner Right Sequence: aagtgtggccaaacgttgtt. Inner Primer PCR Length: 3280. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1620 zhp-3(ok1993) I. C. elegans K02B12.8 Homozygous. Outer Left Sequence: tctttcagcactcttcgggt. Outer Right Sequence: taccaccgtatttcgaaggc. Inner Left Sequence: ttaaaacattaatcggcggg. Inner Right Sequence: acggtgacaatcacacgcta. Inner Primer PCR Length: 2125. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1621 K10C8.1(ok1994) V. C. elegans K10C8.1 Homozygous. Outer Left Sequence: cttcctcgagaagaccaacg. Outer Right Sequence: cttcatcgctcatgcacact. Inner Left Sequence: atcttggtggcttggttttg. Inner Right Sequence: agaaagcaccgcaaagaaaa. Inner Primer PCR Length: 1300. Deletion size: about 2958 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1622 ser-3(ok1995) I. C. elegans K02F2.6. Homozygous. Outer Left Sequence: CTAACTGCTCCGCCTCAAGT. Outer Right Sequence: AATTTGGCAGCCATTTTCAG. Inner Left Sequence: TGCGTGAATCACCATCACTT. Inner Right Sequence: TTAAACGGCCAATTTATCGC. Inner Primer PCR Length: 2855 bp. Deletion Size: 1230 bp. Deletion left flank: CGAACGGAAGAAAGATTATTTAATTGTAAA. Deletion right flank: TCGACTCACTTATACGGCTTGTTTGGCGTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1623 cdr-2(ok1996) V. C. elegans C54D10.1. Homozygous. Outer Left Sequence: GTTGGTGGCGTGAAGAATTT. Outer Right Sequence: ATTCCGCTGCAAAATTAACG. Inner Left Sequence: TGTCACTGGACAGCAACACA. Inner Right Sequence: AGCGTGTTCGCAAAGAGATT. Inner Primer PCR Length: 2727 bp. Deletion Size: 1109 bp. Deletion left flank: ATTTTGGAATACCAATGCTTCTGACAAGAA. Deletion right flank: AAAAAAAATCAAGAAGAGTTTACAAATTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1624 Y57G11C.20(ok1997) IV. C. elegans Y57G11C.20. Homozygous. Outer Left Sequence: ATACTCGAGCAGACTGGCGT. Outer Right Sequence: ATAATGTCACCAAGCCCAGC. Inner Left Sequence: AACCGTTTTACCCTGCACAC. Inner Right Sequence: AATCAACCCGGAAGACACTG. Inner Primer PCR Length: 2825 bp. Deletion Size: 1017 bp. Deletion left flank: TTCAGACTGATAAAGACGAACAGCGTGAGA. Deletion right flank: TTGATTTTTTAGATTCAAACATTTTATTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1626 F38B7.1(ok2002) V. C. elegans F38B7.1. Homozygous. Outer Left Sequence: TTCGGACCCATCTTCACTTC. Outer Right Sequence: ATTTCGATTGCTGCGTCTCT. Inner Left Sequence: CTTTTCAAACAAGCGCACAA. Inner Right Sequence: TCCCCAAAACAGCACTAACC. Inner Primer PCR Length: 2805 bp. Deletion Size: 1981 bp. Deletion left flank: AGTTTTTGATTGGGTTTTCACCTCCACTCA. Deletion right flank: AGATTCAATATTTTTTAAGTTCTGTGAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1627 pll-1(ok2003) III. C. elegans K10F12.3. Homozygous. Outer Left Sequence: AAAACACCAATCAGGTTCGC. Outer Right Sequence: TGACCGGATAGAATTCGGAG. Inner Left Sequence: CACATGGCAAATTTAGGGCT. Inner Right Sequence: TTCAAGCAGACCATCTGCAC. Inner Primer PCR Length: 3277 bp. Deletion Size: 1120 bp. Deletion left flank: CAATCTCATGACAGTCGACGGCTTCACATC. Deletion right flank: TACCAATATATGTAATAAAGGACGATAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1628 sulp-4(ok2004) V. C. elegans K12G11.1. Homozygous. Outer Left Sequence: CGGATAAACCATGCAAGACA. Outer Right Sequence: CATCACGCATTGTTGGGTAG. Inner Left Sequence: CCCCAATTTCTTAAGGCACA. Inner Right Sequence: TACCAGCTTAAAGCGGCAAT. Inner Primer PCR Length: 2943 bp. Deletion Size: 2119 bp. Deletion left flank: AACTTCCAGGCATGCCAGTTTAGGTATGTA. Deletion right flank: AACACTCATTCTCCTGATATTTTATCTCGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1629 R07E3.3(ok2005) X. C. elegans R07E3.3 Homozygous. Outer Left Sequence: agccagttgtctcccatttg. Outer Right Sequence: agaaccggacattgttgagc. Inner Left Sequence: tggcacctatacgaccatga. Inner Right Sequence: gggaaaatgtggagggaact. Inner Primer PCR Length: 2636. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1630 exoc-7(ok2006) I. C. elegans C43E11.8. Homozygous. Outer Left Sequence: AGAAGGCCATCTTGCTCATC. Outer Right Sequence: TCCAATGGCAAGTGATCAAA. Inner Left Sequence: CAGAGCAGAGAGGATACGGG. Inner Right Sequence: GAACGGGAAATTGCAAAAGA. Inner Primer PCR Length: 3229 bp. Deletion Size: 1803 bp. Deletion left flank: CTCGATCACTTCATTCACATATGAAGAACA. Deletion right flank: ATTAAAAAAGTACTTTTTTTTAATCGAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1631 ser-3(ok2007) I. C. elegans K02F2.6. Homozygous. Outer Left Sequence: CTAACTGCTCCGCCTCAAGT. Outer Right Sequence: AATTTGGCAGCCATTTTCAG. Inner Left Sequence: TGCGTGAATCACCATCACTT. Inner Right Sequence: TTAAACGGCCAATTTATCGC. Inner Primer PCR Length: 2855 bp. Deletion Size: 1244 bp. Deletion left flank: GTTACCAGATTTGTGTGGAGTGGCAGAATA. Deletion right flank: ATGTGATGGGTTTCTTGACCATTCGTAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1633 mif-1(ok2009) III. C. elegans Y56A3A.3. Homozygous. Outer Left Sequence: CCATGTCAACAAAGTCCGTG. Outer Right Sequence: GAATGAAAAATCCAAGGCGA. Inner Left Sequence: CGGTAAATTTCCCCGATTTT. Inner Right Sequence: TTCGTTGGATTTTTCCTTCG. Inner Primer PCR Length: 2533 bp. Deletion Size: 1020 bp. Deletion left flank: AGGCCCCACAGAAAGGAGGCCCCACCACGG. Deletion right flank: CTTTAAACCTATGTGCACTACCAGATAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1634 F32A5.4(ok2011) II. C. elegans F32A5.4. Homozygous. Outer Left Sequence: TATCCGTCTCTCGCTCCAGT. Outer Right Sequence: CCGTTGTAACGGAAGAGGAA. Inner Left Sequence: CCGTGTCTGGATGTCAGCTA. Inner Right Sequence: ACCCTTCATATCCAACGCAG. Inner Primer PCR Length: 2115 bp. Deletion Size: 1450 bp. Deletion left flank: ATCCGACTCCGTAATTTGACATCCTCTGAG. Deletion right flank: TATTCGTAAATAACGTGTTCTCAGCATTCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1635 F49E2.1(ok2012) X. C. elegans F49E2.1. Homozygous. Outer Left Sequence: CCTCCACATGTCGTAGTCCA. Outer Right Sequence: GATGCCGGATTGACAAAAGT. Inner Left Sequence: GGCAGTTGAAATGCAATGAA. Inner Right Sequence: TTTGCCAAAATGACAAGACG. Inner Primer PCR Length: 2897 bp. Deletion Size: 991 bp. Deletion left flank: GAAAAAAACAAAAACAAAATGTGTGTCGAT. Deletion right flank: TTTATTAACGCATTATTTCAGGAGGTCTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1637 K02H11.6(ok2014) V. C. elegans K02H11.6. Homozygous. Outer Left Sequence: TTGAAGAGAGAGCGAGAGCC. Outer Right Sequence: TTGACCCGTTTGCCAATTAT. Inner Left Sequence: ACTGGGGGAGCACAATATCA. Inner Right Sequence: CGCTCATTCTTCTTTCAGGG. Inner Primer PCR Length: 2187 bp. Deletion Size: 1215 bp. Deletion left flank: CACACCCCATATGTTCAAAATTACAGTCTC. Deletion right flank: CGGCAAGAGCTTCATTTGCGTCGACCAACG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1638 rab-18(ok2020) III. C. elegans Y92C3B.3. Homozygous. Outer Left Sequence: AATTTTGGGGGAAAATCGAC. Outer Right Sequence: CTTTTACCGCGAGAACTTCG. Inner Left Sequence: ATGGAAAACGGGGATTTTTC. Inner Right Sequence: TATCCTGCATTTTCCCTTCG. Inner Primer PCR Length: 2618 bp. Deletion Size: 1316 bp. Deletion left flank: GGCAATTTTAAGCCAAAATTGGTATTTTTG. Deletion right flank: CCATTGAAGTTACGCGGAAATCCACGCCTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1639 uda-1(ok2021) V. C. elegans K08H10.4. Homozygous. Outer Left Sequence: CGAGCAACCTCATTCCATTT. Outer Right Sequence: TGCGCAATATTAATAGCCCC. Inner Left Sequence: AACGTCATGCTATTCCCTGC. Inner Right Sequence: GCAATGCCGCAAAACTAAAT. Inner Primer PCR Length: 2492 bp. Deletion Size: 866 bp. Deletion left flank: TAGTCAAATATTACATTTCATTAAAATATC. Deletion right flank: AGAAAATAAAAGGAATGGAGGTTTCATGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1640 W01C8.4(ok2022) X. C. elegans W01C8.4. Homozygous. Outer Left Sequence: CATGCAAGACGAGGAGACAA. Outer Right Sequence: GCGCGTTGCATCTAAAATCT. Inner Left Sequence: TTGTTCACAAATGGCGGATA. Inner Right Sequence: CCCGTTGTGACCTTCAGTTT. Inner Primer PCR Length: 3309 bp. Deletion Size: 2544 bp. Deletion left flank: CAAAATGATGCAACCAACTGTAAATTTTTT. Deletion right flank: CTCTTTTTGTTTTTTGTCGCATCCTAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1641 dcap-2(ok2023) IV. C. elegans F52G2.1. Homozygous. Outer Left Sequence: GTGGCTCTGCCTGATTGATT. Outer Right Sequence: CGTTCCCAGATGTCGAAAAT. Inner Left Sequence: CTTTCGGAAATCCCCAATTT. Inner Right Sequence: TGGGAGCCATTTTCCTAGTG. Inner Primer PCR Length: 2796 bp. Deletion Size: 1603 bp. Deletion left flank: CATACATTTTTCCCCCTATTCATGTGTAGA. Deletion right flank: GTTTTTGTACACTTGATGGCGGCTCTTCTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1643 cah-1(ok2032) III. C. elegans F54D8.4. Homozygous. Outer Left Sequence: AGACATGTTTTGCGCAAGTG. Outer Right Sequence: GTTTTGTGTCGCCCATCTCT. Inner Left Sequence: ATCTTTGAGCAAAGTCGGGA. Inner Right Sequence: AATAGGTCGAGGGGGTGTTC. Inner Primer PCR Length: 2585 bp. Deletion Size: 1892 bp. Deletion left flank: GAAGTCGCCAAGGTTCGAAATCAGCAAGTT. Deletion right flank: ATCACCTGAGAAATAATGATTGCTTTCTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1644 maa-1(ok2033) III. C. elegans C18D11.2. Homozygous. Outer Left Sequence: TACTACGGAGAGACCCACGC. Outer Right Sequence: TTCGAAATGTCGGTGTTTGA. Inner Left Sequence: GCATTTTTCTTCCCCCAGTT. Inner Right Sequence: CAGGGTCTCACCACAAGTCA. Inner Primer PCR Length: 2684 bp. Deletion Size: 876 bp. Deletion left flank: GGCTTCATCCATCGTCATGTTGTCCAGCTT. Deletion right flank: TTAGTTTTACAATCGAGCCGCGACGCGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1645 C56E6.5(ok2034) II. C. elegans C56E6.5. Homozygous. Outer Left Sequence: TCTTGACCTTGGGTCGATTC. Outer Right Sequence: AATTTTTCGGGATTGGGTTC. Inner Left Sequence: AGACTCTGCGAAATGGGATG. Inner Right Sequence: AAAGGATTGACGGTCTCGTG. Inner Primer PCR Length: 2957 bp. Deletion Size: 1799 bp. Deletion left flank: CATATGTTTTTTGAGCTGAACAGACGGTTC. Deletion right flank: ATGCTGATAGTGGAGAAAGATATGCCGTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1646 try-6(ok2035) I. C. elegans F48A9.3. Homozygous. Outer Left Sequence: CAGAGGAAAACGAGAAACGC. Outer Right Sequence: TGAGCTCAGTTGTCATGGGA. Inner Left Sequence: GTCGGTTGAGAAGGTTGGAG. Inner Right Sequence: AATGTGGACGCCAGTTTAGG. Inner Primer PCR Length: 2338 bp. Deletion Size: 1548 bp. Deletion left flank: GAATATTATATGGACGCAGAAAAATGACCC. Deletion right flank: GATTTCTGTTAAAAGATATTACATTCCAGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1648 F54C4.3(ok2037) III. C. elegans F54C4.3. Homozygous. Outer Left Sequence: TTTCTGCATTTTTGCGTCAG. Outer Right Sequence: AGCAGCAGGTGCTCTTTTTC. Inner Left Sequence: ACAGAGCCGGGAAAATAGGT. Inner Right Sequence: TTTCAAACCCAAAAACTGGC. Inner Primer PCR Length: 3388 bp. Deletion Size: 2351 bp. Deletion left flank: TTGATTTTGAACATGCTTTTTGCGTTAAAA. Deletion right flank: TTTTTTTTCAAATTTTCATCTGAAAAAATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1649 tbck-1(ok2038) II. C. elegans C33F10.2. Homozygous. Outer Left Sequence: CCAAACTTCGGAGCATTCAT. Outer Right Sequence: AGCCAATCGATGTCAGCTTC. Inner Left Sequence: CAAACAAATGCTCGGAAGGT. Inner Right Sequence: GGCCTGCATAGAATTTGGAA. Inner Primer PCR Length: 3281 bp. Deletion Size: 1334 bp. Deletion left flank: CAATAAATACTACACAGATGATCAGGAGAA. Deletion right flank: TTGTCACGGAATCTCAACATTTTGTCTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1650 F56F11.2(ok2039) III. C. elegans F56F11.2. Homozygous. Outer Left Sequence: CCGCCAAATCCTTATTTTCA. Outer Right Sequence: TTTTTCTGAATTTTTCGGCG. Inner Left Sequence: TGGAATCCAACAAAACACCA. Inner Right Sequence: TGAACGTGTCTGGGATGAAA. Inner Primer PCR Length: 2864 bp. Deletion Size: 1924 bp. Deletion left flank: GCAGCTGAAGAGCTCTACCGTGTATTTGAA. Deletion right flank: TGCTGACAAAGATGAAGATTTGGCTGAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1651 D2023.5(ok2040) V. C. elegans D2023.5. Homozygous. Outer Left Sequence: AACGATGCACCATGAACGTA. Outer Right Sequence: AGCAGCTCTCCCAAATCTCA. Inner Left Sequence: CAACTCAGCCAGCTTCTTCC. Inner Right Sequence: CCGGGCTGAAAATAACTGAA. Inner Primer PCR Length: 2110 bp. Deletion Size: 570 bp. Deletion left flank: TATTGTTCAATCCAACCATTTGAGCATATT. Deletion right flank: TCTGCAATCAATGGAGCGCACTTGCGTCGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1652 D1081.4(ok2041) I. C. elegans D1081.4. Homozygous. Outer Left Sequence: CTTTGAATAAAACGCACGCA. Outer Right Sequence: AAAGTGTGGGTCGTCGAGAT. Inner Left Sequence: CGTGCTCACCTGAAACAAAA. Inner Right Sequence: GCAGTTTTGGGAGCAGAAAG. Inner Primer PCR Length: 3047 bp. Deletion Size: 2555 bp. Deletion left flank: ATCGCCGCAATGTATAACAATGCAATTTCA. Deletion right flank: GATGGGCTCCAGTGCTGTGAAAAATTCGGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1653 ctl-3(ok2042) II. C. elegans Y54G11A.13. Homozygous. Outer Left Sequence: CGGCGATTCTTATACTCCCA. Outer Right Sequence: CTTCCCCACATGGTCAATCT. Inner Left Sequence: GGCCAATTTTCTGCCTGATA. Inner Right Sequence: CAACTGCTTTCGCATGGTTA. Inner Primer PCR Length: 2912 bp. Deletion Size: 1420 bp. Deletion left flank: CATTTCCGAAATCCGGATGAACTTTCGTGAACTCTTTGACCATTCCATTTTGAATTTCC TCCAAACAGCCACCCAAATCACTAGCCAAATTCCCAACGAGCCGATCTCTCTCCTCCTC CTTGAGCACTTTCTCCCAGAACTGACGTGGCTGCTCGTAGTTGTGATCGTCTCCAGT. Deletion right flank:  ATGGATTGAACTCCCATTTCTCAGCTTGTTCGAATGTCATCACTTGAATGAACATCTTC CATTCCGGGAAATTTCTTGACTCAATGGCATTGAACAGGTCGCGGATCGCATAGTCTGG ATCCGAAGAGGCGAGCTTTCCAGCGTCAGTTGGATCGAGATTCTTGGAACCTTGAGCAG GCTGAAAAATAGAAAATGAAAATTTAATTCTAGTCCCCGTCTCTCTTAGGCTTACCTTG . Insertion Sequence: GGATTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1654 F31E3.2(ok2044) III. C. elegans F31E3.2. Homozygous. Outer Left Sequence: ATTCGAAAGTCCACCGTCTG. Outer Right Sequence: CATTTCTTCCGCAACTCACA. Inner Left Sequence: GATGGACCAGCGAAGAAAAG. Inner Right Sequence: GGGCGTGAAGAACAGTGAAT. Inner Primer PCR Length: 2860 bp. Deletion Size: 1289 bp. Deletion left flank: AAATACATTTGTGACGTCACAAATGTATTT. Deletion right flank: TGTGGTAGGAACTATTTTCATTCACTTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1655 mps-3(ok2045) I. C. elegans T06A4.2. Homozygous. Outer Left Sequence: ACACTTTACGGTTTCCACGC. Outer Right Sequence: TACCTACCTGCCTACCCACG. Inner Left Sequence: CCTGCCTACCTGCCTACAAG. Inner Right Sequence: CTGCCTACCTGCCTATCTGC. Inner Primer PCR Length: 2411 bp. Deletion Size: 1559 bp. Deletion left flank: CAATGCTTTTTCTACAATTTTGTGGTTAAA. Deletion right flank: AGGCAAGTAGGCAGTTAGGCAGGTAGGCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1656 F54D5.4(ok2046) II. C. elegans F54D5.4. Homozygous. Outer Left Sequence: CCGATGAGCAGCTGTTGTTA. Outer Right Sequence: AAAGGGAAAATTGCAACGTG. Inner Left Sequence: ACGGTATGTCGTCCGATTTG. Inner Right Sequence: AGCAATGCGGAGACAGTTTT. Inner Primer PCR Length: 2218 bp. Deletion Size: 1180 bp. Deletion left flank: CCAAACTTCAATTGCCACTTAGATAAGAAT. Deletion right flank: TTTCTCAGAACTCAGAATATTAATCAATTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1657 R04F11.1(ok2047) V. C. elegans R04F11.1. Homozygous. Outer Left Sequence: AAATGGCCGATGTGATTGAT. Outer Right Sequence: TTCTCCGTGGGAATTTCAAG. Inner Left Sequence: GCCCATTGTTTTTCCATCTG. Inner Right Sequence: GCCAAAATTTCGAAACTGGA. Inner Primer PCR Length: 2447 bp. Deletion Size: 1294 bp. Deletion left flank: CATGGAACCAAACATGTGTATGTACGTTGC. Deletion right flank: CCTTAGGGCCTGGAACAGCTGAGAATGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1658 Y67D8C.10(ok2048) IV. C. elegans Y67D8C.10 Homozygous. Outer Left Sequence: ttctacggccattcttccac. Outer Right Sequence: tgacaaaacgggaacactca. Inner Left Sequence: gcttgaagctcgtctcatcc. Inner Right Sequence: gattcgtacttgcccttgga. Inner Primer PCR Length: 3172. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1659 acr-3(ok2049) X. C. elegans K11G12.7. Homozygous. Outer Left Sequence: CGATTTAAGCAAGACGGAGC. Outer Right Sequence: ACAGGCCAAAGTCTCGAAAA. Inner Left Sequence: GGACCCTCCAGTCTGTTTTG. Inner Right Sequence: CGCGGATAAAAGTATTCCGA. Inner Primer PCR Length: 3245 bp. Deletion Size: 2190 bp. Deletion left flank: ACGAAACATTTTTTGGTCCATTTTGTTTAT. Deletion right flank: GTGGTGATTGATCGATTACTTCTCTATCTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1660 clec-4(ok2050) II. C. elegans Y38E10A.5. Homozygous. Outer Left Sequence: AGACACGTAAGCTCGGCAGT. Outer Right Sequence: GCAAAGTCGCAGTTTTCTCC. Inner Left Sequence: TATCAATGGCGAGGCACATA. Inner Right Sequence: TACTGCGGCTGAGAAAACCT. Inner Primer PCR Length: 2826 bp. Deletion Size: 1610 bp. Deletion left flank: CTTCTATTTATGTTATTTGTCTTTTGAACT. Deletion right flank: GCAAGTGCCGAAAATTTCCAAAACCAGAAATTGCCGAAATTGCCGATTGCCGGAAATTT TAAAAACAGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1661 nhr-85(ok2051) I. C. elegans W05B5.3. Homozygous. Outer Left Sequence: AGACATCTGCCGAAGTCGAT. Outer Right Sequence: TTTGTTCGTTCCGAGAATCC. Inner Left Sequence: CGAACATCAGCCAACAGAGA. Inner Right Sequence: ACATTTGGTGAAGGGAGCAG. Inner Primer PCR Length: 3239 bp. Deletion Size: 2433 bp. Deletion left flank: CTTCTAAGTTTTGTTGGCCTAGAAAAAGCT. Deletion right flank: TATGAGCATCCAAATGTAAGTAAGATTTCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1662 C03D6.5(ok2060) I. C. elegans C03D6.5. Homozygous. Outer Left Sequence: ACCCACGAGATGTCTTGTCC. Outer Right Sequence: AGCCGAAAACACTCCTCAAA. Inner Left Sequence: TGCCAATTCCTGTTGCATAA. Inner Right Sequence: TCTGAAATCGCGTTTTGTTG. Inner Primer PCR Length: 2236 bp. Deletion Size: 1222 bp. Deletion left flank: AGCTGGAGTTTTCAACCACTTTTTACGGGA. Deletion right flank: CTGATGAGGATCCAGTCGCCGAGCCGGTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1663 clec-69&clec-70(ok2061) IV. C. elegans F56D6.15, Y46C8AL.3. Homozygous. Outer Left Sequence: GTTCACATTTTGGTTTGCCC. Outer Right Sequence: TCCATGTTTCAGGGTGCATA. Inner Left Sequence: CAGTTTGCCCGGACAGTAAT. Inner Right Sequence: ATCTTTGAACCCAGCACCTG. Inner Primer PCR Length: 2991 bp. Deletion Size: 4238 bp. Deletion left flank: TTTTTGCTTCACTTATTTCAAACCTCAAGT. Deletion right flank: GTAATAATTTCAGTCCATTGATATGATGCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1664 T23B12.4(ok2062) V. C. elegans T23B12.4. Homozygous. Outer Left Sequence: GTGCACGATATGCCTTCTGA. Outer Right Sequence: CCAACCGAGAAAATTCGTGT. Inner Left Sequence: CTCCAAACGAAAGCGAAGAC. Inner Right Sequence: AAAGAAAAACACGGGGGACT. Inner Primer PCR Length: 2929 bp. Deletion Size: 1108 bp. Deletion left flank: CAACGCCTTCAAGTGAAGCAAAATCGGAAA. Deletion right flank: AACTTTGGAACGGAGTCAAGAAATTCAGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1666 tbck-1(ok2064) II. C. elegans C33F10.2. Homozygous. Outer Left Sequence: CCAAACTTCGGAGCATTCAT. Outer Right Sequence: AGCCAATCGATGTCAGCTTC. Inner Left Sequence: CAAACAAATGCTCGGAAGGT. Inner Right Sequence: GGCCTGCATAGAATTTGGAA. Inner Primer PCR Length: 3281 bp. Deletion Size: 1935 bp. Deletion left flank: TGAAAACGGTGGAAGAAATGCGTGCAGCCG. Deletion right flank: GAAATGCATTCCCATTAATGATTGCTCTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1667 tax-6(ok2065) IV. C. elegans C02F4.2. Homozygous. Outer Left Sequence: AGCCGAGCACAAGACAAAAT. Outer Right Sequence: AGTTTGGTTTCCGTTTCACG. Inner Left Sequence: ACCTTCAAAGGTGTCATCGC. Inner Right Sequence: CTATCTCCTTTTGCCCCCTC. Inner Primer PCR Length: 2766 bp. Deletion Size: 1069 bp. Deletion left flank: GTACTTCAGGATGGCAGCTGAAAATTGTTA. Deletion right flank: TAGCAGATTTTGAGTGCCCACAGATACAGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1668 C02H7.2(ok2068) X. C. elegans C02H7.2. Homozygous. Outer Left Sequence: CAAACTGCAAACTCAAGCCA. Outer Right Sequence: CTCAACACGCAATCGTCACT. Inner Left Sequence: AAACCGCGCAACAGTAAGAT. Inner Right Sequence: TGCAGACTGACGATTCTTGG. Inner Primer PCR Length: 3294 bp. Deletion Size: 1045 bp. Deletion left flank: GATAGACATAAACGTTTAATGCGATCAGAG. Deletion right flank: CGAACTTTTAAAATAATAACCGCATAGGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1669 F31F6.2(ok2072) X. C. elegans F31F6.1. Homozygous. Outer Left Sequence: AAGATTGAGCATCGCTTCGT. Outer Right Sequence: AGACGTTGCCAAAAATCCAG. Inner Left Sequence: CCGAGTGGACCCTGTTTTTA. Inner Right Sequence: TTGCTGATGTTCAAATGCGT. Inner Primer PCR Length: 2417 bp. Deletion Size: 2076 bp. Deletion left flank: TCGTGCAAAATATGTGCGATTGACTTGATCAATCCTGC. Deletion right flank: tcgtgcaaaatatgtgcgattgacttgatc. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1670 K08E7.5(ok2074) IV. C. elegans K08E7.5. Homozygous. Outer Left Sequence: AAGGATGCACCAAACAAAGG. Outer Right Sequence: AGCGATTGAACAAATGACCC. Inner Left Sequence: CTTCAGCTTCACGTGGTTCA. Inner Right Sequence: CTGAGATTTGACGCTCCACA. Inner Primer PCR Length: 3141 bp. Deletion Size: 1298 bp. Deletion left flank: CAGGTACAAAGCCAAGCTCTTCAGCTTCAC. Deletion right flank: CCACGTAGCATTGAGCCCAGCAATTCGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1671 lon-3(ok2076) V. C. elegans ZK836.1. Homozygous. Outer Left Sequence: TAACACCGGAAAATGCACAA. Outer Right Sequence: TATGGACCTCAATGGGTGGT. Inner Left Sequence: AATGCTTTTCGTCGATACGG. Inner Right Sequence: ATGTGTTCTGCTTCTGCGTG. Inner Primer PCR Length: 2770 bp. Deletion Size: 1472 bp. Deletion left flank: GGTCCACGTGGTCCTTCCTCTCTGAAATTT. Deletion right flank: AACGAGTTACTGTAACTCGTGTTGATTTAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1672 sel-12(ok2078) X. C. elegans F35H12.3. Homozygous. Outer Left Sequence: CCTCTTCCTCCTTTTCACCC. Outer Right Sequence: CGACAGTTGTGGTTTCCTCC. Inner Left Sequence: ACGTTTCAGATGCCTTCCAC. Inner Right Sequence: ATGATCCAGCGGGTACAAAA. Inner Primer PCR Length: 2248 bp. Deletion Size: 1525 bp. Deletion left flank: TCTGGTTGTTTTTACGATGAACACGATTAC. Deletion right flank: TCAGCTGAATATATTTTGTTCATTTAAAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1673 C06E8.5(ok2080) III. C. elegans C06E8.5. Homozygous. Outer Left Sequence: CGGGTCAATCATTTCCACTT. Outer Right Sequence: AAATATCGTTTGCAGTCGGC. Inner Left Sequence: TCAAGCAACAAGTGCCTCAG. Inner Right Sequence: CTTCAAGTGGTCTCCCGTGT. Inner Primer PCR Length: 2996 bp. Deletion Size: 1262 bp. Deletion left flank: ATTTCAAAACAAGTTTGCGCGTCAACTGTT. Deletion right flank: ATCTTGAGTTGCCACCTGGCATGATGCCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1674 frm-7(ok2081) V. C. elegans C51F7.1. Homozygous. Outer Left Sequence: TGATAAACGAGCGTGGTCTG. Outer Right Sequence: GAGGGGATCAGTTTCCAACA. Inner Left Sequence: CGTTCGCACTGAACTGTCAT. Inner Right Sequence: GCCCGAATAAATTGGGATCT. Inner Primer PCR Length: 3127 bp. Deletion Size: 1089 bp. Deletion left flank: GACCGACAAGCATCTTTCCCACCAGCAAGT. Deletion right flank: TGCCTCTCTATATTTTTCAAACTTTCCGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1675 F08G12.8(ok2082) X. C. elegans F08G12.8 Homozygous. Outer Left Sequence: gttgaacacacgcacattcc. Outer Right Sequence: ccatctgctcgttgtaagca. Inner Left Sequence: acagtgaagcgtaaccaccc. Inner Right Sequence: gtatcccatcgggaaatgtg. Inner Primer PCR Length: 2607. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1677 Y49F6C.7(ok2086) II. C. elegans Y49F6C.7. Homozygous. Outer Left Sequence: CGGCTGTTGGAGGGATATTA. Outer Right Sequence: AGGTCATTTCCCATCGTTTG. Inner Left Sequence: TCGAAAAGCAAAAGTCCCAT. Inner Right Sequence: TCCATTACCAATGCTCCACA. Inner Primer PCR Length: 2104 bp. Deletion Size: 1471 bp. Deletion left flank: CAAGTTTCTACGTTGGATATGAAGAGTTCT. Deletion right flank: GGGCGACCAACTCGTTGCGCTGAAGGACTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1678 C13C4.5(ok2087) V. C. elegans C13C4.5. Homozygous. Outer Left Sequence: AAAACCGACATGCACACTGA. Outer Right Sequence: TGCGAATGATTGACTGATGG. Inner Left Sequence: CAACTCCAACGGATTCACCT. Inner Right Sequence: AAGAGCAGACCCGCAATAAA. Inner Primer PCR Length: 2307 bp. Deletion Size: 951 bp. Deletion left flank: AAAAGGGAGAAATTGCTGCATCTACAGAAG. Deletion right flank: GCACTGAATCAAAATATTCATTTGCAGTGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1679 cav-1(ok2089) IV. C. elegans T13F2.8 Homozygous. Outer Left Sequence: cacgaagtgaacgaagcaaa. Outer Right Sequence: tccaacaagaccgggactac. Inner Left Sequence: ccatttcccatctgttaccg. Inner Right Sequence: tggatgaaagagcacacagc. Inner Primer PCR Length: 3302. Deletion Size: 2339 bp. Deletion left flank: AGAGTATCGTCCGTGAATCTTTAATCTAAA. Deletion right flank: ATTGTTGGAGTAAAAATCTAAAAATTTCGT. Deletion carries 626-bp insertion at break, corresponding to the reverse complement of T13F2 coordinates 8228-8854. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1680 C24A8.1(ok2090) X. C. elegans C24A8.1. Homozygous. Outer Left Sequence: GATGAACGAATCGGAAATCG. Outer Right Sequence: TGTGAGTTTTGCGGACAAAG. Inner Left Sequence: CAGCCTGAATGGGCATATCT. Inner Right Sequence: AGTGGAGTTGCATGACCAAA. Inner Primer PCR Length: 3261 bp. Deletion Size: 1027 bp. Deletion left flank: TTGCACTGAAAATTTCAATTATAGTACTGT. Deletion right flank: ATTTTTCAGCAAGTTAGAAAGCAAAAGTAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1681 C06E8.5(ok2091) III. C. elegans C06E8.5. Homozygous. Outer Left Sequence: CGGGTCAATCATTTCCACTT. Outer Right Sequence: AAATATCGTTTGCAGTCGGC. Inner Left Sequence: TCAAGCAACAAGTGCCTCAG. Inner Right Sequence: CTTCAAGTGGTCTCCCGTGT. Inner Primer PCR Length: 2996 bp. Deletion Size: 2200 bp. Deletion left flank: TTTTTACCAATTTTTTACCAATTTTAAAAG. Deletion right flank: TACTCCTGATCCTTTCTGAAATACACTTCG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1682 K03E6.4(ok2092) X. C. elegans K03E6.4. Homozygous. Outer Left Sequence: TGAGTGTCAAATCCCCACAA. Outer Right Sequence: TTGTCGTATCCATCTGCTGC. Inner Left Sequence: TCGCGAGATATGTTTGCTTG. Inner Right Sequence: AATTCATGGAAACGTTCGGA. Inner Primer PCR Length: 2664 bp. Deletion Size: 807 bp. Deletion left flank: CGAAGAAGGTTCTGGCAGGAAACAGTGTAC. Deletion right flank: CATTGATTATTTTCCAATCGCCTGTTGCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1683 C36F7.5(ok2093) I. C. elegans C36F7.5. Homozygous. Outer Left Sequence: TGACAAAGCGACCTCTTCCT. Outer Right Sequence: CAGATCCTTCCCTTCCATCA. Inner Left Sequence: CGACGATTGAGCAATGAAGA. Inner Right Sequence: TGCTGCTCAAACTTGATTCG. Inner Primer PCR Length: 2216 bp. Deletion Size: 1115 bp. Deletion left flank: TTGATCTTCTATTTTTTCTTCTTGTCAGCT. Deletion right flank: ATACCTTTCCGCACAAGAACAGAACCTGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1684 Y54G9A.4(ok2094) II. C. elegans Y54G9A.4. Homozygous. Outer Left Sequence: AGGTTTTTCACGACCACGAC. Outer Right Sequence: GCCAATTTCTTGCCAAGTTC. Inner Left Sequence: TCATGTTGACAGCGAGAAGG. Inner Right Sequence: ATTTGAAGGCGCAGATCACT. Inner Primer PCR Length: 3280 bp. Deletion Size: 1561 bp. Deletion left flank: ATCCCAAGAGAAAACATGACGATCGCCTTA. Deletion right flank: ATCCTACTTGCCTGCCTGCCTGCTTTAACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1685 ttm-5(ok2095) I. C. elegans Y54E5A.1 Homozygous. Outer Left Sequence: ttttgaaggcggtagacacc. Outer Right Sequence: gaaaaataaccgcccattga. Inner Left Sequence: ccacactctctcatcaccga. Inner Right Sequence: gccgggatacatctcttcaa. Inner Primer PCR Length: 2720. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1686 T28B8.3(ok2096) I. C. elegans T28B8.3. Homozygous. Outer Left Sequence: TTTCACGTTCATCCACCAAA. Outer Right Sequence: CCGCGACTTTCTTGTTTCTC. Inner Left Sequence: GGAACGATTGAATTGGGAGA. Inner Right Sequence: ACCGATAAATGGGTTCCCTC. Inner Primer PCR Length: 2842 bp. Deletion Size: 1592 bp. Deletion left flank: TCGATTTATTTTCCAGGATTATAAGCTGAT. Deletion right flank: AATATTTTTTATACAAAAACTATGCAAACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1687 F13B6.1(ok2097) IV. C. elegans F13B6.1. Homozygous. Outer Left Sequence: CCAGAATGACCATTCCGTTC. Outer Right Sequence: GGTGAACAGGCAAATCCACT. Inner Left Sequence: TTCACACCTGCTCAAATTGC. Inner Right Sequence: CTGTGGATCCGACAATCCTT. Inner Primer PCR Length: 2315 bp. Deletion Size: 1059 bp. Deletion left flank: ATCAAGTACTTAATGGATTCGTGGGATTAC. Deletion right flank: CATAATTCTCTTGCCACGTATGTAGCAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1688 W05G11.6(ok2098) III. C. elegans W05G11.6. Homozygous. Outer Left Sequence: CCATGAGCAAAAACCCTCAT. Outer Right Sequence: CGTTCTCTGCGTAACATGGA. Inner Left Sequence: TCGTCAACATCTTCAACCCA. Inner Right Sequence: GGAGACTTCGCTTCGTTGTC. Inner Primer PCR Length: 3069 bp. Deletion Size: 1276 bp. Deletion left flank: AATTTTCTAGTAATTTTCAAGTAAAAGCCT. Deletion right flank: AAGGTCTACTGAGGTTTTTCCTTGAAATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1689 jtr-1(ok2102) IV. C. elegans Y77E11A.4. Homozygous. Outer Left Sequence: TGTTCACGGTGAGTGAGGAG. Outer Right Sequence: GTGGCCTGTGGCCTTAAATA. Inner Left Sequence: GTGGATAGGGCTGTGTCGAT. Inner Right Sequence: TGAGCGTCCTCCTCTCCTTA. Inner Primer PCR Length: 2335 bp. Deletion Size: 618 bp. Deletion left flank: TGCCGCAATTCTCATCGTGAGCTTCTTGTC. Deletion right flank: CATATCTGGGGTAGATTCACGGCGCGTCGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1690 ser-2(ok2103) X. C. elegans C02D4.2. Homozygous. Outer Left Sequence: CTCCTTCGCCACACTGATTT. Outer Right Sequence: CCGAATCGCGAAAATTAAAA. Inner Left Sequence: CTTTCACTTTGCACGATCCA. Inner Right Sequence: TCCGCAAATTTCTACGATCC. Inner Primer PCR Length: 3130 bp. Deletion Size: 2043 bp. Deletion left flank: GTTTGTGTCATCAACTAAAAAAATAACTAA. Deletion right flank: GACAATGATCATTAACTTAATGAGCTTTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1692 cki-2(ok2105) II. C. elegans T05A6.2 Homozygous. Outer Left Sequence: gataatctggtttgccgcat. Outer Right Sequence: ggtgtgattggtgcagagaa. Inner Left Sequence: ttgaatcgaaacgccttttt. Inner Right Sequence: aaacaagagcgaaggtcgaa. Inner Primer PCR Length: 2262. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1693 ptr-10(ok2106) I. C. elegans F55F8.1. Homozygous. Outer Left Sequence: CTTTTTCCAGACGGAACGAC. Outer Right Sequence: ATCCGAGAACTCCCAAATCA. Inner Left Sequence: GTACGTGGTCTTTTGCCGAT. Inner Right Sequence: AGCAACCCAGAAAGAGCAAA. Inner Primer PCR Length: 3178 bp. Deletion Size: 1861 bp. Deletion left flank: AATAAAATGGATGAGTATAAGAAGCAAGCG. Deletion right flank: CAAGTTTCAGAGGAAATTCATAAAATTCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1694 T24H7.2(ok2107) II. C. elegans T24H7.2. Homozygous. Outer Left Sequence: AGGAAAGAAGCGATTCCGAT. Outer Right Sequence: TGCCTTGTCGTGTTCTTGTC. Inner Left Sequence: GTAATCTTGCCAACCACCGT. Inner Right Sequence: TTCGTCACATCGTCTTCGAG. Inner Primer PCR Length: 2864 bp. Deletion Size: 1337 bp. Deletion left flank: AAGAAATCGGTGAGAAACCGCAGAGATTAA. Deletion right flank: TCTATTCATATTGTTTTTGTTTCAGCAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1696 mec-17(ok2109) IV. C. elegans F57H12.7. Homozygous. Outer Left Sequence: CACAATCTCCGCTCAAGACA. Outer Right Sequence: CTCGGAGCTTCCTACTGGTG. Inner Left Sequence: CGCAGCCGTTTTAATTTTGT. Inner Right Sequence: TTTTGAGGAATCGGGTGAAG. Inner Primer PCR Length: 2752 bp. Deletion Size: 1977 bp. Deletion left flank: TGGTACCCATCTCTCTCTCTCTCTCCGTCC. Deletion right flank: AATTTATTTTTAAAAAATTATATTCGGACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1697 C54G4.4(ok2110) I. C. elegans C54G4.4. Homozygous. Outer Left Sequence: TAGGGTTGTTTGGGATTTGG. Outer Right Sequence: ATCCGGTAATGTGGCAATGT. Inner Left Sequence: AATTTGAAAGTTGGTTGCGG. Inner Right Sequence: TTTTCAGCCTTCGAGCTTGT. Inner Primer PCR Length: 3269 bp. Deletion Size: 1789 bp. Deletion left flank: TTCGGATCATTTTCATGATTTTTTAGATCC. Deletion right flank: ACTTCAGTTAAAATATTTTTAAAAAGAAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1698 lev-10(ok2111) I. C. elegans Y105E8A.7a. Homozygous. Outer Left Sequence: CCATAATCCAGGCCCTTTTT. Outer Right Sequence: CGTTTCGACTTCTTCTTCCG. Inner Left Sequence: AGACGTTCCACACGATTTCC. Inner Right Sequence: TGTTATACCGCAGAACACCG. Inner Primer PCR Length: 3220 bp. Deletion Size: 1860 bp. Deletion left flank: GGGTTTTTCAACAGTCCCAGGTATCCTGCT. Deletion right flank: GTTCAGCTTTGGCATAGGTTTAGGCTTCGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1699 Y38C9A.1(ok2118) V. C. elegans Y38C9A.1. Homozygous. Outer Left Sequence: AGCTTTCTGGCTGTCGGATA. Outer Right Sequence: GCCGCGAATTTTTCATACAT. Inner Left Sequence: ATTTCGCGGAATTACGTCAC. Inner Right Sequence: GCTCCAATGCGGTCAAGTAT. Inner Primer PCR Length: 3291 bp. Deletion Size: 1439 bp. Deletion left flank: ATCGTTAGCAAGATTCTACCGTACCCTGCC. Deletion right flank: AGTTACAAATTAAAAAAAAGCCCAACTCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1700 F59F4.1(ok2119) X. C. elegans F59F4.1. Homozygous. Outer Left Sequence: GATAACAATCAGGGCTGGGA. Outer Right Sequence: AATTTAACACTTGCACGGGG. Inner Left Sequence: TCGAGCGTCTTTCATCATTG. Inner Right Sequence: TGCGATAGGGTATGTCACCA. Inner Primer PCR Length: 3067 bp. Deletion Size: 1655 bp. Deletion left flank: CGGTGTTTCCATGTGTAAGCTGCTCGGTGA. Deletion right flank: TTTACCCAAGCCTCCCGGCCACCATCTTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1701 clec-34(ok2120) V. C. elegans T25E12.8. Homozygous. Outer Left Sequence: AATCCGCTGATCCAACAAAG. Outer Right Sequence: AATTGGTTTGGGCTCAACTG. Inner Left Sequence: TCTCTCAAGAGGGTCGTCGT. Inner Right Sequence: TCAATTTGGTCTCCCTCCAG. Inner Primer PCR Length: 2159 bp. Deletion Size: 1155 bp. Deletion left flank: TCAAATAGGATTACAGGAAAATAATGCGAT. Deletion right flank: CAGAATTCAATGTTCACTAATCAATAGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1702 C39E9.10(ok2121) IV. C. elegans C39E9.10. Homozygous. Outer Left Sequence: TCGAATCACTCACGCTCAAC. Outer Right Sequence: GTTGCAGGAGCTGAAGGACT. Inner Left Sequence: TGCCAGCTTATCTCTTGGCT. Inner Right Sequence: GTTGATGTTCGAATCGGCTT. Inner Primer PCR Length: 2992 bp. Deletion Size: 2469 bp. Deletion left flank: CGTAGTTCTGTTTTCTGTTTTTGTGATTTT. Deletion right flank: ACTTTGTGTCCTCACTCACGCTGGTCTCGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1703 Y7A5A.9(ok2122) X. C. elegans Y7A5A.9. Homozygous. Outer Left Sequence: TGCGCGCTTTATATAGGCTT. Outer Right Sequence: CCCTTCACCAAAGAACCTGA. Inner Left Sequence: TATTTTCCAGATTCGTCGCC. Inner Right Sequence: CAAAAGAAACGTTCCCCGTA. Inner Primer PCR Length: 2920 bp. Deletion Size: 1335 bp. Deletion left flank: CGTATATTAACTCTGTTAACACTTTTCCTT. Deletion right flank: ACCCATTGTCTATCTATTTCTTTGTTTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1704 F14E5.4(ok2129) II. C. elegans F14E5.4. Homozygous. Outer Left Sequence: CTCGACGAATAGACCGATGC. Outer Right Sequence: TTTGGTCAGTTGGCATTTCA. Inner Left Sequence: CCTTTTTCCATCGAAACCAC. Inner Right Sequence: GCGTGCTTCAGAAAGGTGAT. Inner Primer PCR Length: 2170 bp. Deletion Size: 1766 bp. Deletion left flank: TTTTTCCATCGAAACCACAATTTATACTTG. Deletion right flank: TTTGCAAGATAAGCAGGATCGCTGAGACTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1705 nhr-244(ok2130) I. C. elegans ZK1025.6. Homozygous. Outer Left Sequence: GGAGATCATTTCCGCGATTA. Outer Right Sequence: CAACCCGAAAACTGTCCTGT. Inner Left Sequence: AAAACTAAGCTCACGGCGAA. Inner Right Sequence: AAGATGGTATCGGGTAGGGC. Inner Primer PCR Length: 2176 bp. Deletion Size: 1355 bp. Deletion left flank: AGATATCAATAAGAGAGGTGTTGAAGATGT. Deletion right flank: CACTCTCAATAGTTTTAAAATGGTTTGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1706 nhr-244(ok2131) I. C. elegans ZK1025.6. Homozygous. Outer Left Sequence: GGAGATCATTTCCGCGATTA. Outer Right Sequence: CAACCCGAAAACTGTCCTGT. Inner Left Sequence: AAAACTAAGCTCACGGCGAA. Inner Right Sequence: AAGATGGTATCGGGTAGGGC. Inner Primer PCR Length: 2176 bp. Deletion Size: 1178 bp. Deletion left flank: ATGCTAGACAAGGAAGATGTGGAGGTTCTG. Deletion right flank: AAAAATATATCCAAAACCCCGATGCACCGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1708 mec-7(ok2152) X. C. elegans ZK154.3. Homozygous. Outer Left Sequence: ATTACAGTTGGATCAGGGCG. Outer Right Sequence: CACTTTCCCACCTCATCGTT. Inner Left Sequence: AAGCAAAGCAAAAAGGCTGA. Inner Right Sequence: TGTTCGGGTGTTTCAAGATG. Inner Primer PCR Length: 2164 bp. Deletion Size: 1346 bp. Deletion left flank: TCGTAAAATTTTACCTGTGAACTGCTCTGA. Deletion right flank: ATATGAACGATCTCGCGCATGTTGCTTGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1709 F20D1.4(ok2153) X. C. elegans F20D1.4. Homozygous. Outer Left Sequence: CATCTGCTTCTTGACCCACA. Outer Right Sequence: AATGTTTCGGAGAACAACGG. Inner Left Sequence: GAATCCGCTCAATATCCGAA. Inner Right Sequence: AACAAAAGAAGGGGGAAGGA. Inner Primer PCR Length: 2161 bp. Deletion Size: 1616 bp. Deletion left flank: TTTTGTTGTATAATTCCTCTTGATAATTAC. Deletion right flank: TTTTTAATTTACCGTGATTTTATTTCATAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1710 Y39G10AR.18(ok2154) I. C. elegans Y39G10AR.18. Homozygous. Outer Left Sequence: ATTTTGCATGAAAACTCCGC. Outer Right Sequence: CTCCTTCTGTGCGTGTGTGT. Inner Left Sequence: GAAAATTGAAAATTCCGCCA. Inner Right Sequence: GCATCCACCACCTTTGTTCT. Inner Primer PCR Length: 2518 bp. Deletion Size: 1462 bp. Deletion left flank: GTCGATTTGCCGGAATGTTTCAATTCCGGC. Deletion right flank: TTTTTTTAGTGGGCACAATTGAAAAAACGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1711 plp-1(ok2155) IV. C. elegans F45E4.2. Homozygous. Outer Left Sequence: GAATTTTGCCGCGTATTTGT. Outer Right Sequence: GAATCCGCTCAATATCCGAA. Inner Left Sequence: GAAATTGCGTCTCGGTGTTT. Inner Right Sequence: TTATCCATCTCCATGGCTCC. Inner Primer PCR Length: 2124 bp. Deletion Size: 1107 bp. Deletion left flank: GCTTTTTTTCCTTTCTAAATCTTGTTTTTA. Deletion right flank: AAAAAATATATTAAAAACTTTTTTAATGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1712 rig-3(ok2156) X. C. elegans C53B7.1. Homozygous. Outer Left Sequence: GGGGAAACCCCAGTTTTATG. Outer Right Sequence: ACAAATGCCAGGATTTCAGC. Inner Left Sequence: ACGTCTTAAATTTGCGCGAT. Inner Right Sequence: GCAACAAAACAGTGCGTCAT. Inner Primer PCR Length: 3140 bp. Deletion Size: 1532 bp. Deletion left flank: AAACATCGCAAAACATCGCTACATTTCTCA. Deletion right flank: GCTGGATTTGGTAGGAATAATAATTCTGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1713 mrp-2(ok2157) X. C. elegans F57C12.4. Homozygous. Outer Left Sequence: GGCATCTTTTGCCATTGAGT. Outer Right Sequence: CACCTTCCACAGATCCAACC. Inner Left Sequence: TTGCGAGAAGGTTCTTTGGT. Inner Right Sequence: AACGTCTGGAATCCCATTTG. Inner Primer PCR Length: 3181 bp. Deletion Size: 1357 bp. Deletion left flank: GTTCAGACGATGTGCAATTGTTAGAACAGT. Deletion right flank: GCGCACCAAGGGTGTCGGTTTTTCGATTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1714 rcq-5(ok2158) III. C. elegans E03A3.2 Homozygous. Outer Left Sequence: cgttttcgcatttcacagaa. Outer Right Sequence: ggagcgtacttgccacattt. Inner Left Sequence: cgttttccatctcttccagc. Inner Right Sequence: tttcagagatgagctcgggt. Inner Primer PCR Length: 2930. Deletion size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1715 aqp-2(ok2159) II. C. elegans C01G6.1. Homozygous. Outer Left Sequence: ACAGAGAAAAGGTGCAACCG. Outer Right Sequence: CTGCTCAAGGGTCACAATGA. Inner Left Sequence: CAGGGTGAGAAAGGATTTCG. Inner Right Sequence: CCTCCCAACTTCACCTTTCA. Inner Primer PCR Length: 3110 bp. Deletion Size: 1238 bp. Deletion left flank: AACAATTGGAACCCAGAACCACTTGCTGAA. Deletion right flank: TTTATTACCAGTAAATTGTCCACTCTTCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1716 nhr-49(ok2165) I. C. elegans K10C3.6. Homozygous. Outer Left Sequence: CTCAATTGTGTGCACTTGCC. Outer Right Sequence: AAGGAAGAAGAGTTGGGGGA. Inner Left Sequence: CAACATGCGTTCCACTCCTA. Inner Right Sequence: AGGATGAATTGCCAATGGAG. Inner Primer PCR Length: 3211 bp. Deletion Size: 1437 bp. Deletion left flank: TGAAAACTTGCGTTGCTATCTGTTGTTTGG. Deletion right flank: ACAACTATTTTCTGTCATTCAGGTCCATGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1717 lev-9(ok2166) X. C. elegans T07H6.5. Homozygous. Outer Left Sequence: GCATCCATTCACCATTCACA. Outer Right Sequence: CGGAAAAATGTTGCACAATG. Inner Left Sequence: TCAAATAATTGCCCTTCCCA. Inner Right Sequence: TGCCCAATAAGTCAATGCAA. Inner Primer PCR Length: 3362 bp. Deletion Size: 2796 bp. Deletion left flank: AACCTAAACTTTATTGAAAATAAAAAAAAA. Deletion right flank: CACAGATCATGGAACACTATTCACACAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1718 ifc-1(ok2173) V. C. elegans F37B4.2. Homozygous. Outer Left Sequence: GGCCAACAATCACCAATTTT. Outer Right Sequence: CGCATCCCCTAATTGACTGT. Inner Left Sequence: GTACGGAGGTATTCCGACGA. Inner Right Sequence: GCCATCACGCTTTGAAAGTT. Inner Primer PCR Length: 2286 bp. Deletion Size: 2036 bp. Deletion left flank: TATCGAAAAGGTATGTGCTTTTAAGAGCGT. Deletion right flank: TGCCGTCAAATAGTGTTGTTCCATACAATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1719 Y45F10D.13(ok2174) IV. C. elegans Y45F10D.13. Homozygous. Outer Left Sequence: CCGAAAAATCAGCCCACTAA. Outer Right Sequence: AATTGCCGTTTCACAAGTCC. Inner Left Sequence: AATTTCAGCCCATCATCTGC. Inner Right Sequence: TACATCTCGGATCCTTTCGG. Inner Primer PCR Length: 2960 bp. Deletion Size: 1110 bp. Deletion left flank: TAAAACCCCAAAATCATCATTGAAAATAAA. Deletion right flank: AAATTGATTACTGTTTCAAAAAGTTATTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1720 Y106G6A.1(ok2178) I. C. elegans Y10G6A.1. Homozygous. Outer Left Sequence: GGCATCTTCCCATTCGAGTA. Outer Right Sequence: GAGTCATCGGTTACCGTCGT. Inner Left Sequence: CCTGTGCTCAACTCTGCTTG. Inner Right Sequence: TAAATTCGAATGGCGGTCTC. Inner Primer PCR Length: 2210 bp. Deletion Size: 1007 bp. Deletion left flank: GTTTTAAATATTATTTTTACCGTAAAATTC. Deletion right flank: AAGTTTGTTCAATGTTTTGAAAACCGTAGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1721 Y71G12B.4(ok2189) I. C. elegans Y71G12B.4. Homozygous. Outer Left Sequence: TCCCCGTAGCCATTTAGTTG. Outer Right Sequence: GATGGCGCAGAAATCAAAAT. Inner Left Sequence: GATCTCCAGATTGCTAGCGG. Inner Right Sequence: CTCATTCGGGACACACACAC. Inner Primer PCR Length: 3008 bp. Deletion Size: 976 bp. Deletion left flank: TGGGATTGTGGAGAAATGAATAAGCCGGAT. Deletion right flank: TTGTCCGTGTAGAGTACACGACTTTCCCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1722 T08G11.1(ok2190) I. C. elegans T08G11.1. Homozygous. Outer Left Sequence: CATGTTCCACAGTGCCAAAC. Outer Right Sequence: CAAAATCTCAATGCCCGAAT. Inner Left Sequence: TGACCCTCTTTTCAGCTCGT. Inner Right Sequence: AATCTCCATTCTTTGCCACG. Inner Primer PCR Length: 3284 bp. Deletion Size: 2292 bp. Deletion left flank: TCTCATTTTCCACAGGCTCAATAATGGGCT. Deletion right flank: TATTCAAAACTTCATAAAGAACATACATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1723 C27H2.2(ok2191) IV. C. elegans C27H2.2. Homozygous. Outer Left Sequence: TTCCGAATTGTTTGGCTTTC. Outer Right Sequence: TTTACAATCGCGTGTTGCTC. Inner Left Sequence: CAATTTCACCCTTCGATGCT. Inner Right Sequence: TTTGCCATTGTGCCAATAAA. Inner Primer PCR Length: 2901 bp. Deletion Size: 703 bp. Deletion left flank: ACTTTTTTCCGAATTTCGAATATTGTAAAA. Deletion right flank: GGCACCCTTCCGGCTCCGTCGAGCAAGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1724 F42G4.6(ok2196) II. C. elegans F42G4.6. Homozygous. Outer Left Sequence: CTGCCTACCTATCTGCCTGC. Outer Right Sequence: AAGAAGGCTCCTCGCATACA. Inner Left Sequence: AACAGGTTCATTTTGCGGTC. Inner Right Sequence: GAAATGGAAGAATTTGCCGA. Inner Primer PCR Length: 2746 bp. Deletion Size: 1759 bp. Deletion left flank: TGTTTCAAGCACAACGGTCAGTGTACCTAC. Deletion right flank: CCAAAAATTTTATTCAGAATTGTAATAATT. Insertion Sequence: CAACGGTCAGTGTACCTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1725 ZK1025.7(ok2197) I. C. elegans ZK1025.7. Homozygous. Outer Left Sequence: AACTCGATTACACCGATGCC. Outer Right Sequence: GGAGATCATTTCCGCGATTA. Inner Left Sequence: TTCTTCGGAGACTTCACGGT. Inner Right Sequence: GCCGATTTGTACAGCCCTAA. Inner Primer PCR Length: 2643 bp. Deletion Size: 1741 bp. Deletion left flank: CATGCGTTAAACCGAATACCTATCTACTAA. Deletion right flank: CACGGTCACAGGAGTGGAAATAGTTTCTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1727 F44C8.7(ok2206) V. C. elegans F44C8.7. Homozygous. Outer Left Sequence: CGGGATCTTGAAAATCTGGA. Outer Right Sequence: CGTCGCATTTGATGTTGAAT. Inner Left Sequence: TGAGCACATTTTGGGCCTAT. Inner Right Sequence: CTATCGCCCGGTAACACAGT. Inner Primer PCR Length: 2869 bp. Deletion Size: 1098 bp. Deletion left flank: TCTGAAAATTTAATTTTCAGTGCAAAATGA. Deletion right flank: TTACATGAGAAAATTCACGAAAAAGTTACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1728 tra-3(ok2207) IV. C. elegans LLC1.1. Homozygous. Outer Left Sequence: TTGAGCACAACCTGAAGCAG. Outer Right Sequence: AAAACTCCTATTTGCCCGCT. Inner Left Sequence: TCACAGTTTTCGGGTTTTCC. Inner Right Sequence: AGATGTTTCCGGTGGAGTTG. Inner Primer PCR Length: 3226 bp. Deletion Size: 1474 bp. Deletion left flank: AAAGAACTGAAGTTATGTTTATTGGTTAAT. Deletion right flank: TCTCATTTTGAACTAGAAACTATTGCTAAC. Insertion Sequence: CTTCAGAAAAATATTACAAATTGTATCTTTTTACACAAGATTTTAAATTTTTAAAAATA AAATCTGAAACAATTTTGTCTAATAAAAACAAAGGCCCTCATGAATTGTTTATGAAAAT TATCACCCAAATAAGTTGATTAACTTGGGCGGGGCTTATTTTACAGGTTTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1729 gcy-36(ok2208) X. C. elegans C46E1.2 Homozygous. Outer Left Sequence: gcttttcgtcgttggaactc. Outer Right Sequence: ggtgtgtacttgaagggcgt. Inner Left Sequence: cggccatagtaatggaatgg. Inner Right Sequence: cccgagttgttcttctctcg. Inner Primer PCR Length: 3041. Deletion size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1730 K01H12.2(ok2209) IV. C. elegans K01H12.2. Homozygous. Outer Left Sequence: TCCGTGATATGTTGTTCCGA. Outer Right Sequence: AGAGCCTGCCTACATGGCTA. Inner Left Sequence: TGTTTGCAAAATGATGCGAT. Inner Right Sequence: CAAGGTTCAGTTGCCTCCTC. Inner Primer PCR Length: 2111 bp. Deletion Size: 892 bp. Deletion left flank: ATCGACGATTCCTTTGTAACGTTTATCGGC. Deletion right flank: ATAATCGCAATCATTTTAAACCAAAAAGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1732 E01G4.3(ok2211) II. C. elegans E01G4.3. Homozygous. Outer Left Sequence: CACAAATACGTTGGCATTCG. Outer Right Sequence: GATTGCCGATTTGCCTTAAA. Inner Left Sequence: CTGATGCTGTTGCTGGTGTT. Inner Right Sequence: GAGAAACGGCAAGCAAACTC. Inner Primer PCR Length: 2562 bp. Deletion Size: 1076 bp. Deletion left flank: CCCGAAATCATTGGCGAGGTGAGGTGGCGG. Deletion right flank: CTTTTTATCAGGTGAAAAAAAAATAATTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1733 C10G11.6(ok2212) I. C. elegans C10G11.6. Homozygous. Outer Left Sequence: GACGAAGACGACGAAGAAGG. Outer Right Sequence: GGGGTACCCGATGAGCTACT. Inner Left Sequence: TTTACCACGGAAAACCTTCG. Inner Right Sequence: TTTTGGTGATTCATCGGGTT. Inner Primer PCR Length: 3386 bp. Deletion Size: 1357 bp. Deletion left flank: TTCCGTCTCCGTTTGTTCGAAAAATTCCCG. Deletion right flank: TTCCTCCGCCAGGACTCGTTGGAATCAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1734 F47G4.4(ok2219) I. C. elegans F47G4.4. Homozygous. Outer Left Sequence: GGGCACTTGAAAAGTTCTGC. Outer Right Sequence: CTCCGACTCAATTGTGAGCA. Inner Left Sequence: GGGTCGAGTTTGAGAATGGA. Inner Right Sequence: GTTGGCACCGACGAAACTAT. Inner Primer PCR Length: 2769 bp. Deletion Size: 986 bp. Deletion left flank: GCAGGGGAGAGGGAACTCCCTAGAGGGTTT. Deletion right flank: TGAGCCAAAAGTGTTGTCAAGTTACTATCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1735 F35E12.8(ok2220) V. C. elegans F35E12.8. Homozygous. Outer Left Sequence: TGAAAAAGCTGTGCAAGTGG. Outer Right Sequence: GGGCAGTTTCCAAATCTCAA. Inner Left Sequence: GCAGCACAATGAATCTGGAA. Inner Right Sequence: AGTTTGATTGGCCAAAGTGC. Inner Primer PCR Length: 3078 bp. Deletion Size: 1014 bp. Deletion left flank: AAATTCAAATCAGTGAGATAAACCATACTA. Deletion right flank: AATTCAAAACATATTTTAGAAAGTTATCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1736 F55F8.9(ok2221) I. C. elegans F55F8.9. Homozygous. Outer Left Sequence: CAGAAATCGAGCGTCTCACA. Outer Right Sequence: GAGTGTCGTTGCGAGATTCA. Inner Left Sequence: AAATGTGGTTCTGTCGAGCC. Inner Right Sequence: CATTCGATAGCCGTTGGTTT. Inner Primer PCR Length: 3096 bp. Deletion Size: 950 bp. Deletion left flank: TCCGTTCAAAGTGCTACCGTATGATGAGAA. Deletion right flank: GTGACCATGTCCATGTCCATGAGCAAATGA. Insertion Sequence: AATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1737 pld-1(ok2222) II. C. elegans C04G6.3. Homozygous. Outer Left Sequence: CCACTTGCCACGTATTCCTT. Outer Right Sequence: GAAGATGAAGAGTCGCGGAG. Inner Left Sequence: GGACAACGACTCCACCAGTT. Inner Right Sequence: GGTCATCTGGAACCGAAAGA. Inner Primer PCR Length: 3066 bp. Deletion Size: 1430 bp. Deletion left flank: TTGAAATCACGATCCATTAGCAATACCATC. Deletion right flank: GAATGATTCCTTAACCAAACACGTTTAATA. Insertion Sequence: GA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1738 C36B7.5(ok2223) X. C. elegans C36B7.5. Homozygous. Outer Left Sequence: GTTGGAGGTTTGAGATTCCG. Outer Right Sequence: CTTGATAAATGCCCACCGTT. Inner Left Sequence: GGAAAAGTTCGCTTACCGTG. Inner Right Sequence: CGAAACTTCACAGAGACGCA. Inner Primer PCR Length: 3111 bp. Deletion Size: 958 bp. Deletion left flank: CATGAGTTGCCACAACCAGTCCATGACATC. Deletion right flank: TGTCCGCGATGGATAATAGTTGGATGGATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1739 sma-10(ok2224) IV. C. elegans T21D12.9. Homozygous. Outer Left Sequence: CGCTTAGCACGAATACCTCG. Outer Right Sequence: GCTGGTCTTGCCTTTTTGAG. Inner Left Sequence: CACACGAGCTTGGTCACTTG. Inner Right Sequence: CCGTTTCCACACCATTCTCT. Inner Primer PCR Length: 2783 bp. Deletion Size: 906 bp. Deletion left flank: AATGGTCAACCTAGAGTTTTGGTACAGGAT. Deletion right flank: CTATCGTTTTAACTTTCAGAATTAATCTAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1741 C39F7.2(ok2226) V. C. elegans C39F7.2. Homozygous. Outer Left Sequence: CTGAGCCTAAACCGAACCAA. Outer Right Sequence: ATAGATTGTGTGGTGGGGGA. Inner Left Sequence: AAGCCTAAGCCAAAGCCTTC. Inner Right Sequence: GATCCAGGTTAGGTGTCGGA. Inner Primer PCR Length: 3282 bp. Deletion Size: 2315 bp. Deletion left flank: TAGCGTCAGTAGCGAGCTCACGCTCGCCAC. Deletion right flank: CTGTTCCCGCTACAAAAAGTTTCTTTTACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1742 ifb-1(ok2227) II. C. elegans F10C1.2. Homozygous. Outer Left Sequence: AATTAGCTTCCCCGCAATTT. Outer Right Sequence: GTTGTTGATGCCTCCTTGGT. Inner Left Sequence: CTTTAGTTGACTCCGCCCAC. Inner Right Sequence: GCAAATGCGAGAAACCCTTA. Inner Primer PCR Length: 2999 bp. Deletion Size: 2379 bp. Deletion left flank: CAATTTCTAAGTAAGTAGTGTCTTGATCTC. Deletion right flank: AGCTTTTTGGTTTTGAAATGTTGAAAATTT. Insertion Sequence: ATTTCTAAGTAAGTAGTGTCTTGATCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1743 C33H5(ok2228) IV. C. elegans C33H5. Homozygous. Outer Left Sequence: AAGGAGAAAGTGGCAGCAAA. Outer Right Sequence: CAGACGGACCACCAGTACCT. Inner Left Sequence: CAATGCAGGCACAAGAAGAA. Inner Right Sequence: TCGCCTGGTCATATCAATCA. Inner Primer PCR Length: 2211 bp. Deletion Size: 1217 bp. Deletion left flank: ACTTGGAGTAAATTTTAAACTGCTATATTA. Deletion right flank: TTATCTGTCCTTGATATCCTTGATATGAGT. Insertion Sequence: TATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1744 Y67A10A.8(ok2229) IV. C. elegans Y67A10A.8. Homozygous. Outer Left Sequence: GTTCCCAACAGCTGGATCTC. Outer Right Sequence: GGCGATGACCAAGAAAATGT. Inner Left Sequence: CTAGAATTCCCCGACTTCCC. Inner Right Sequence: AATTCACGAGCCGATTTTTG. Inner Primer PCR Length: 3333 bp. Deletion Size: 1522 bp. Deletion left flank: AATTGGAATTGACTGAAGAAGAAGAGATTT. Deletion right flank: CACTAAAATGTTTACAATTTTTGTGTTTCT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1745 clec-66(ok2230) II. C. elegans F35C5.9. Homozygous. Outer Left Sequence: GCCTCCAATCGTCATTTGTT. Outer Right Sequence: AAACATTGCCGTTCTGCTTT. Inner Left Sequence: ATAAAAGAGCCTGGCGTGAA. Inner Right Sequence: GAGCCCCTTTTGAAGGCTAT. Inner Primer PCR Length: 2401 bp. Deletion Size: 1187 bp. Deletion left flank: CCTCACCATCCCAAGCAGTCACCGATCGAT. Deletion right flank: TTGCCGATTCGTTTGCCGCGCACCCCTGGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1746 C15F1.5(ok2231) II. C. elegans C15F1.5. Homozygous. Outer Left Sequence: CACTCCGACAACAGGCAGTA. Outer Right Sequence: AGCACCGCAACTACCTCAAG. Inner Left Sequence: CGGAGTGTCGTTAGCCAGAT. Inner Right Sequence: GCCATCGTTCCATTTGTTCT. Inner Primer PCR Length: 3106 bp. Deletion Size: 1194 bp. Deletion left flank: TGTGTAATTAAATGAGCCGAAAAACTATAC. Deletion right flank: AACCAAGACTTGCAACATTTTTCAAGCAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1747 R10E11.3(ok2232) III. C. elegans R10E11.3. Homozygous. Outer Left Sequence: GGCGGCAATTTGAACTTTTA. Outer Right Sequence: CGTTTCAGAAGAGTCTCGGG. Inner Left Sequence: GAGAAGGTGCTAATGCGCTC. Inner Right Sequence: TTGGATCATCAGCAGCGTAG. Inner Primer PCR Length: 2429 bp. Deletion Size: 1440 bp. Deletion left flank: TTGGAAATACATGTTACTGCAACTCAGTGA. Deletion right flank: CGCAGCATAATAATGATCAAATTTTCAGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1750 Y75B8A.5(ok2240) III. C. elegans Y75B8A.5 Homozygous. Outer Left Sequence: tcttgaaagggtgttttgcc. Outer Right Sequence: gtaaggaagggcttccaggt. Inner Left Sequence: tttcatttctgggcgttttc. Inner Right Sequence: ttccgatgtgcaaaaattca. Inner Primer PCR Length: 3181. Deletion size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1751 H08M01.2(ok2241) IV. C. elegans H08M01.2 Homozygous. Outer Left Sequence: tggagcaagattctcagcaa. Outer Right Sequence: ccaactccggctaaatgttc. Inner Left Sequence: tgatggacaggttcaaccaa. Inner Right Sequence: accgtttctcaacttctgcc. Inner Primer PCR Length: 3276. Deletion size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1752 E01G4.3(ok2242) II. C. elegans E01G4.3. Homozygous. Outer Left Sequence: CACAAATACGTTGGCATTCG. Outer Right Sequence: GATTGCCGATTTGCCTTAAA. Inner Left Sequence: CTGATGCTGTTGCTGGTGTT. Inner Right Sequence: GAGAAACGGCAAGCAAACTC. Inner Primer PCR Length: 2562 bp. Deletion Size: 1672 bp. Deletion left flank: AATTCCGAAAAAATCCCGAATACCCTGCGG. Deletion right flank: CAAAGATCTCCGTATCACTGACAAAAAGAT. Insertion Sequence: TCTCCGTATCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1754 Y32B12A.3(ok2244) V. C. elegans Y32B12A.3. Homozygous. Outer Left Sequence: GGTGTGCCATTAGGCATTTT. Outer Right Sequence: GAATCGGATCAGTGGAGGAA. Inner Left Sequence: GGTTTTTGACGCCAATGTTT. Inner Right Sequence: CTCTCCCAGCAGAGAAATCG. Inner Primer PCR Length: 2108 bp. Deletion Size: 1023 bp. Deletion left flank: AATCAAAGGGTGATAATAGTTCGAACAAAT. Deletion right flank: CTGATCGCTGGCTCTCGTGGGAAAAGACGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1755 gur-3(ok2245) X. C. elegans ZC504.5 Homozygous. Outer Left Sequence: gttggctcaatatggggaaa. Outer Right Sequence: gcgtcgaatacgttggagtt. Inner Left Sequence: ggcggtgagagtaagctttg. Inner Right Sequence: aaatggacgtcaccaaggag. Inner Primer PCR Length: 3321. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1756 gur-3(ok2246) X. C. elegans ZC504.5. Homozygous. Outer Left Sequence: GTTGGCTCAATATGGGGAAA. Outer Right Sequence: GCGTCGAATACGTTGGAGTT. Inner Left Sequence: GGCGGTGAGAGTAAGCTTTG. Inner Right Sequence: AAATGGACGTCACCAAGGAG. Inner Primer PCR Length: 3319 bp. Deletion Size: 2376 bp. Deletion left flank: ACTGTCATAAATAAATTGAGTTTACGTATT. Deletion right flank: TTTCTGCAATCTTCATTAGAACTGAACAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1757 F28A10(ok2260) II. C. elegans F28A10. Homozygous. Outer Left Sequence: CGAACGAGAAAGGAAACTCG. Outer Right Sequence: TCCGACGCTTACAGGTCTCT. Inner Left Sequence: ACTCTGGAGAGCGGAAGATG. Inner Right Sequence: AGTCGAGAAGCAGAACACCC. Inner Primer PCR Length: 2073 bp. Deletion Size: 604 bp. Deletion left flank: GATTTTATGAATTAGTTTTTAATAAAGATT. Deletion right flank: TAAACCAGACATAGTTGGGGAAAAAATTAA. Insertion Sequence: TG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1758 ZK1025.3(ok2261) I. C. elegans ZK1025.3 Homozygous. Outer Left Sequence: taaatttttccggcagatcg. Outer Right Sequence: cgggtgctttcttgaatcat. Inner Left Sequence: ggaattgaaattttcggcaa. Inner Right Sequence: cttccgtactcccgatttga. Inner Primer PCR Length: 2408. Deletion size: about 2100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1759 acbp-3(ok2262) X. C. elegans F47B10.7. Homozygous. Outer Left Sequence: ACCAGCGCCAATGATAAAAA. Outer Right Sequence: TTTTGCATGTTGTCTACCGC. Inner Left Sequence: AGCCCGTTTGTCCTTGTAAA. Inner Right Sequence: AATTTCCTTCTCGGGTGCTC. Inner Primer PCR Length: 2288 bp. Deletion Size: 1201 bp. Deletion left flank: AAAGTTTTGAAGAAATGTAGAGTGTCGTTT. Deletion right flank: ATACTAAATAAATATGAATTAATTTTGTAA. Insertion Sequence: ACTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1760 dpy-3(ok2263) X. C. elegans EGAP7.1. Homozygous. Outer Left Sequence: AACAACAAAGTCCAAACGCC. Outer Right Sequence: CAACAAATTCACGTTGGACG. Inner Left Sequence: GTGTGTGTGTGGGGTGAGAG. Inner Right Sequence: CCCCATTTACCTCCCAGATT. Inner Primer PCR Length: 2434 bp. Deletion Size: 951 bp. Deletion left flank: TTCTTTTTCTTTTGGGAAATTCATACATGG. Deletion right flank: ATGCTGTACGTGATTGTAGACAAGTGGAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1761 F10F2.7(ok2264) III. C. elegans F10F2.7. Homozygous. Outer Left Sequence: CACATCCCTCCACCAATTCT. Outer Right Sequence: ATGTACCCGACTGAAGCCTG. Inner Left Sequence: ATTCCACACCCTGCTTTTTG. Inner Right Sequence: GACATGACTTGGCTTGGCTT. Inner Primer PCR Length: 2889 bp. Deletion Size: 912 bp. Deletion left flank: GATTAGATTTTGGGATCCGTTACGGCTAGT. Deletion right flank: CCTCTTGTCACATCAGAATCTGCGTACATG. Insertion Sequence: ATGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1762 dsl-6(ok2265) IV. C. elegans H02I12.4. Homozygous. Outer Left Sequence: AAATAGCCCCAAAGATCGCT. Outer Right Sequence: TTCAAAAATGCCCACATCAA. Inner Left Sequence: GTTCTTGCATGAGCAGTCCA. Inner Right Sequence: GAGGGAGTTAGAGCAGCCAG. Inner Primer PCR Length: 2315 bp. Deletion Size: 1811 bp. Deletion left flank: TCACATTTTTCACCGAACCAGTTTCTGAAA. Deletion right flank: CATAAATGATCAAATTAACATTTTTTACAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1763 K11E4.3(ok2266) X. C. elegans K11E4.3 Homozygous. Outer Left Sequence: ttgacttgcaccttcattcg. Outer Right Sequence: agaaacttcatcacgcccac. Inner Left Sequence: gatgccagttgggaaagaaa. Inner Right Sequence: aaaataatgcagtttgcgcc. Inner Primer PCR Length: 2991. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1764 trxr-2(ok2267) III. C. elegans ZK637.10. Homozygous. Outer Left Sequence: GCGAATATCCGATAGCGATT. Outer Right Sequence: CAAGACCCTTCCAAACCAAA. Inner Left Sequence: CCAATCAGGCGTCTCTTCTC. Inner Right Sequence: GCTCAAAGCCTGTTCAATCC. Inner Primer PCR Length: 3171 bp. Deletion Size: 1649 bp. Deletion left flank: TTGTAATTGGAGCAGGATCTGGAGGACTTT. Deletion right flank: TAAGGATAGCGGTTTTTGTTATGTGAAAGC. Insertion Sequence: TTTGTAGCGGTTTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1765 abt-5(ok2268) I. C. elegans Y53C10A.9. Homozygous. Outer Left Sequence: GTTGTTCTGGGTGCCTTTGT. Outer Right Sequence: TCCCAAAGAAACACGACTCC. Inner Left Sequence: CTTGCACAGTCGTGATGCTT. Inner Right Sequence: AGCGAGACCCTGAAAGTGAA. Inner Primer PCR Length: 2886 bp. Deletion Size: 2067 bp. Deletion left flank: TTGAGTTGACGGACAAACGGAATACATTGG. Deletion right flank: TAGAGCGGCGTTCGCGCCTCGCTCAGCTGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1766 C12D8.1(ok2270) V. C. elegans C12D8.1 Homozygous. Outer Left Sequence: aaagaagttgtggtgccgac. Outer Right Sequence: aatggaaggatttaacccgc. Inner Left Sequence: ccgttagccgaaaaattgaa. Inner Right Sequence: cgaatacttgtttgaacccca. Inner Primer PCR Length: 3085. Deletion size: about 2700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1767 clec-39(ok2271) V. C. elegans T25E12.7. Homozygous. Outer Left Sequence: TGGCTGCCTTGCTAGAAAAT. Outer Right Sequence: GTTATTGCACGGGAGACGTT. Inner Left Sequence: GACATTCACACAATCACCGC. Inner Right Sequence: GGGAAAGTGCTCAACTACCG. Inner Primer PCR Length: 2219 bp. Deletion Size: 1334 bp. Deletion left flank: GGTGCCACTCTTTTTTCCATAAAAAGTGAA. Deletion right flank: AATTTTAGAAATTAAAAAAAAAATCACATA. Insertion Sequence: AAATTTTAGAAATTAAAAAAAATTTTAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1768 T07D1.3(ok2272) X. C. elegans T07D1.3. Homozygous. Outer Left Sequence: AATGACACGTGCGACCATTA. Outer Right Sequence: AAAAATGCGGTTTCGTGTTC. Inner Left Sequence: CTTCGGAATATTTGCCTCCA. Inner Right Sequence: AAAAAGTGCCAACAACTGGC. Inner Primer PCR Length: 2130 bp. Deletion Size: 1260 bp. Deletion left flank: TTGGATTAAATGAAGAAATGCTTTTGTTAA. Deletion right flank: TGCATATTTTGGTGGTTTATCTAGTGTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1769 mig-2(ok2273) X. C. elegans C35C5.4. Homozygous. Outer Left Sequence: CCGAGGTTTTCGTTTTTCAA. Outer Right Sequence: AATGACTGGGAAACGTCCAA. Inner Left Sequence: TTTTGTTCCACGCTTTGTCA. Inner Right Sequence: ATGATCGGGAAGAAGAGCCT. Inner Primer PCR Length: 2116 bp. Deletion Size: 1192 bp. Deletion left flank: ATTTTCGCCAACTTTTCATTCCCTAACTTT. Deletion right flank: TTTTGTTGAAACTCATAAAACTATATCTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1770 nac-3(ok2274) III. C. elegans K08E5.2. Homozygous. Outer Left Sequence: AACAAATGGGTGAGGGATCA. Outer Right Sequence: ATTCCCTCAGAGCCCAATTT. Inner Left Sequence: GGGAACTGTAAAGGGTGATCG. Inner Right Sequence: AAAACTGACGCTTTTCACCG. Inner Primer PCR Length: 3136 bp. Deletion Size: 1560 bp. Deletion left flank: ATTTAAACACTATAGCAGTTTCCAAAACTC. Deletion right flank: GAGAAATCTTTGAATTCTCTGAGAAACTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1771 Y52D3.1(ok2275) III. C. elegans Y52D3.1 Homozygous. Outer Left Sequence: cagtgtgttcgcctaaccct. Outer Right Sequence: aatcgataacgggaacatgc. Inner Left Sequence: atcaatgagaaatcggctgc. Inner Right Sequence: gaggaggacgagtcgttgag. Inner Primer PCR Length: 2513. Deletion size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1772 K08B12.2(ok2276) V. C. elegans K08B12.2. Homozygous. Outer Left Sequence: TCCTTTTTGTCGTTGCATTG. Outer Right Sequence: GGAGTGAACCCGATCTTGAA. Inner Left Sequence: CGTTTGTCGTTGTTGCATCT. Inner Right Sequence: GCAAGAAGAAAATGGGTGGA. Inner Primer PCR Length: 2599 bp. Deletion Size: 914 bp. Deletion left flank: GAGCGGAATGGAATGAAGAGTGTGTGTGTG. Deletion right flank: ATGTCAATGAGAGCTAACGCCATCATCAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1773 ZK822.5(ok2281) IV. C. elegans ZK822.5. Homozygous. Outer Left Sequence: GCGATTTTTGGATTGAGCAT. Outer Right Sequence: TTTCAAATTTCCGGATCACC. Inner Left Sequence: GCTTTTCATTGCGATTTCGT. Inner Right Sequence: CACGCAATTTGTCATGCTTT. Inner Primer PCR Length: 2857 bp. Deletion Size: 1318 bp. Deletion left flank: TCGAGGGGACAGAACAGCAAAAGAGGAATA. Deletion right flank: GGCAATTTATGAAGATTTCTTGAAAAATAG. Insertion Sequence: AAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1774 pcca-1(ok2282) X. C. elegans F27D9.5. Homozygous. Outer Left Sequence: ACGCTTATTTCCGAGCTTCA. Outer Right Sequence: ACGTAAAGATGGCCGATGAG. Inner Left Sequence: AACAACCTTTTTGCAATGCC. Inner Right Sequence: GAAGCTCCAACTGCCAAATC. Inner Primer PCR Length: 3054 bp. Deletion Size: 1754 bp. Deletion left flank: AAATTTGAGAAACTGCGAATGAAATTATCA. Deletion right flank: CGAGCTTGCTTGTCGTTCCAGGCAACTCGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1775 strd-1(ok2283) III. C. elegans Y52D3.1. Homozygous. Outer Left Sequence: CAGTGTGTTCGCCTAACCCT. Outer Right Sequence: AATCGATAACGGGAACATGC. Inner Left Sequence: ATCAATGAGAAATCGGCTGC. Inner Right Sequence: GAGGAGGACGAGTCGTTGAG. Inner Primer PCR Length: 2514 bp. Deletion Size: 1015 bp. Deletion left flank: GGAGCAAAACTGACGAAACTTCGTATCACA. Deletion right flank: TAGGGACTCTCTTTTCTCAAAATTGGATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1776 T11F9.1(ok2284) V. C. elegans T11F9.1. Homozygous. Outer Left Sequence: AAATGTCACGTCATCACCGA. Outer Right Sequence: ACCGTAATCCTCCACCCTCT. Inner Left Sequence: TCTTCCCGTTTCGGAAATAC. Inner Right Sequence: GAAATCGAGGCAAAGGATGA. Inner Primer PCR Length: 3090 bp. Deletion Size: 1665 bp. Deletion left flank: GCTGTGTGCATCATAAATATCCTCGAAAAC. Deletion right flank: CGTGATTCGAAAAAATAGTCTTCATCGAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1777 F45E4.3(ok2285) IV. C. elegans F45E4.3. Homozygous. Outer Left Sequence: AAAAGTTGCGCTTCCAAAAA. Outer Right Sequence: TCAAAACGAATCAACGACCA. Inner Left Sequence: CGCTTTTGTAGAAAAACACGG. Inner Right Sequence: TGCATCGGCATTTGTTGTAT. Inner Primer PCR Length: 3120 bp. Deletion Size: 2410 bp. Deletion left flank: TTTGAGATATCAAACGATCGGAAACTAGTA. Deletion right flank: CCGACAGTATGGAGCCGCACCACCTCCAAC. Insertion Sequence: ATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1778 F09A5.1(ok2286) X. C. elegans F09A5.1. Homozygous. Outer Left Sequence: AGGTGTTCTACCCGATGTGC. Outer Right Sequence: TGCCGTTTGTGTACGACTTC. Inner Left Sequence: AATTTGTGGATATCTCGGCG. Inner Right Sequence: AACAAGTCTTCGTGCATCCC. Inner Primer PCR Length: 3224 bp. Deletion Size: 1465 bp. Deletion left flank: GCTGGTCGGCATCGTCATTTGGCTCATTTG. Deletion right flank: CTTAGTTCGACTTAAATTAGTTTGAAACAA. Insertion Sequence: TTCTTAGTTCGACTTCTTAGTTCTCTTAGTTCTCTTAGTTCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1779 fbxb-67(ok2287) I. C. elegans F49B2.2. Homozygous. Outer Left Sequence: ACAATGCAACACCCTGTCAA. Outer Right Sequence: TCACAGGTGAATGAGAAGCG. Inner Left Sequence: TATCCCAAACAGGTTGCACA. Inner Right Sequence: GGGAAATGAGCTAGAAGGGG. Inner Primer PCR Length: 2132 bp. Deletion Size: 1154 bp. Deletion left flank: CTACTCTTTGCCCCTTATTGCTCTTCTGTA. Deletion right flank: AGGTGAAAGTTTACATAGGACACCCCTTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1780 rgs-3(ok2288) II. C. elegans C29H12.3. Homozygous. Outer Left Sequence: CAGCATCTACCCGGACATCT. Outer Right Sequence: GGACAGTCAATGAAAGGGGA. Inner Left Sequence: AGAAATCGCAGGATTCCCTT. Inner Right Sequence: CTGATCTTCAAGCGGGAAAG. Inner Primer PCR Length: 3116 bp. Deletion Size: 1843 bp. Deletion left flank: TGTTAGATGTAAATTATAATTACTATGTTG. Deletion right flank: GCCAACGCGATGAACAATCTAGGAAAGGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1781 his-71(ok2289) X. C. elegans F45E1.6. Homozygous. Outer Left Sequence: GCAGAAAGAACTGAAACGGC. Outer Right Sequence: CCAAGTCCCACACTCGTTTT. Inner Left Sequence: TGTTCCCGTTCACAATCGTA. Inner Right Sequence: AAACTCAAAACCGGCAAATG. Inner Primer PCR Length: 2285 bp. Deletion Size: 991 bp. Deletion left flank: CCCAACGAGGTAGGCCTCAGAAGCCTCTTG. Deletion right flank: AGATGGCTGTGAGCGAGAGCGAGGCAATGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1782 twk-37(ok2298) I. C. elegans C48E7.9 Homozygous. Outer Left Sequence: ccgtaacgagaaattgcaca. Outer Right Sequence: ttgagctcgccaagtttctt. Inner Left Sequence: cgctgggaggtcaaataaaa. Inner Right Sequence: cgaggtttgcagaatcattg. Inner Primer PCR Length: 2181. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1784 dnj-27(ok2302) I. C. elegans Y47H9C.5 Homozygous. Outer Left Sequence: aaatctccaatggatgctcg. Outer Right Sequence: accatggagcaaagaaatcg. Inner Left Sequence: gccggtgtgtcataaggatt. Inner Right Sequence: atccatggttccgatgagtc. Inner Primer PCR Length: 3121. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1785 Y105E8A.11(ok2303) I. C. elegans Y105E8A.11 Homozygous. Outer Left Sequence: atccgaagcagcaattcaag. Outer Right Sequence: ggatcaaacccaaggatgaa. Inner Left Sequence: tcgattgtgcaatgacgttt. Inner Right Sequence: tttcaagcgaatcaatggag. Inner Primer PCR Length: 3030. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1786 Y105E8A.11(ok2304) I. C. elegans Y105E8A.11 Homozygous. Outer Left Sequence: atccgaagcagcaattcaag. Outer Right Sequence: ggatcaaacccaaggatgaa. Inner Left Sequence: tcgattgtgcaatgacgttt. Inner Right Sequence: tttcaagcgaatcaatggag. Inner Primer PCR Length: 3030. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1787 F56F11.5(ok2305) III. C. elegans F56F11.5. Homozygous. Outer Left Sequence: ACAAGCTGAAAATGCCCAAC. Outer Right Sequence: ATTGCCAAAAGTTCGATTGC. Inner Left Sequence: CAGAAATGTCCATGAAATTAACAAA. Inner Right Sequence: CAGGCTCCAGTTCGAAGTTT. Inner Primer PCR Length: 3054 bp. Deletion Size: 2283 bp. Deletion left flank: TAACTCGGCTATAGCCTATAGCCGAGTTTC. Deletion right flank: TAATAGTGCCACACTGTGCGTAATTATTAT. Insertion Sequence: TGAGATTTTTCAACTTTTCAAAAAATCTTATAAAATCTAGAATTTTTTTGAATTTTTTA AGCATGATATTTTGGTCTTTATGGCCCCATAGGCATGTTTTAAAGCAATTCCCACACAT AGTGTAGTCCATCTTTAAGTTTCTATGTATAAAAGTAATTTTTACCATTGCTTTTGCTT TGTAGGCAATCGCCATGATTTCCAGACTTCGTTGAGACTTTTCAATTATATAATCACGG TAAGACTTCGAACTATCTTTTCTTGATTGCGAAAACGAGGATGTGTAGTCAGCTTGCAA TGCTTCTATTGCTTGACGTGGTCCCTGTTCCCCATTCAATTGAAGGTGAGTTATTACCT TACACGCAAGTTGTTCAAGTTCTCTGCAAATTTACAATTGAAAACTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1788 cyp-35A1(ok2306) V. C. elegans C03G6.14. Homozygous. Outer Left Sequence: AAAGCTTTTGTTGGAGGTGC. Outer Right Sequence: TGATTCCTTTTGGAGTTGGG. Inner Left Sequence: GATGCATAGTAAGGAAATCTGGG. Inner Right Sequence: TCCACTACCGAGCTTATGCC. Inner Primer PCR Length: 3112 bp. Deletion Size: 1494 bp. Deletion left flank: TTGATATCCTCAATTCTAAATCAAGCAATC. Deletion right flank: TCACCAGAATACAATTTAAAAACCTTTAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1789 met-2(ok2307) III. C. elegans R05D3.11. Homozygous. Outer Left Sequence: AGGGTTTCGGTTTTTCGATT. Outer Right Sequence: TATCTTTGGAGTGCCGGTTT. Inner Left Sequence: CGTCCCGTATATTTTTCAACG. Inner Right Sequence: CCGTTTTGAAATTTGTTTCCTT. Inner Primer PCR Length: 3056 bp. Deletion Size: 1320 bp. Deletion left flank: AAAAAGGAGAAAGAAATCATGAAAATTTTG. Deletion right flank: GTTACGGAGGAGACGAGTCAGATTATGATG. Insertion Sequence: AAAAAAAATTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1790 D2096.3(ok2317) IV. C. elegans D2096.3 Homozygous. Outer Left Sequence: aactaccgcttatcggctcc. Outer Right Sequence: cacactctgcgaggaaacaa. Inner Left Sequence: gatttttgctcgtagtcccg. Inner Right Sequence: cggtgcaatcataagagcag. Inner Primer PCR Length: 3134. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1791 amt-1(ok2318) X. C. elegans C05E11.4. Homozygous. Outer Left Sequence: CTGTCCCATCCGATTCTGTT. Outer Right Sequence: GTGTGTGCTTCACATGTCCC. Inner Left Sequence: ATTTCGAAAAATGACGACGC. Inner Right Sequence: CTAATTCGACGGCAAAGAGC. Inner Primer PCR Length: 2473 bp. Deletion Size: 1043 bp. Deletion left flank: TTTTATATATCCCCAATAATTTTCAGTCAT. Deletion right flank: ATGATAAGGTATTTCTTTAAAAGTCAGGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1792 inx-7(ok2319) IV. C. elegans K02B2.4. Homozygous. Outer Left Sequence: AGCTAGTCATGGGGAGCAAA. Outer Right Sequence: ACGTCTGAAGGTTCGTGCTT. Inner Left Sequence: GGCTGTCTTCGGAATTTTTG. Inner Right Sequence: CAAGTGCGTCGTTCATCATC. Inner Primer PCR Length: 3021 bp. Deletion Size: 1610 bp. Deletion left flank: AGTTCTGAAAATTGAAATTATTTTAAATTT. Deletion right flank: TTTTTTGACAAATCTCGGTCGATTTCCACC. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1793 Y24D9A.2(ok2320) IV. C. elegans Y24D9A.2 Homozygous. Outer Left Sequence: aattcgcgaaaacgaaacaa. Outer Right Sequence: attgacggagaaaagagcga. Inner Left Sequence: ctccaatgcctgtagatgcc. Inner Right Sequence: aaaattgggaaaatggtggg. Inner Primer PCR Length: 3188. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1794 F53A2.7(ok2322) III. C. elegans F53A2.7 Homozygous. Outer Left Sequence: gaagaagaccagctcggttg. Outer Right Sequence: accttcgaaatgccaatgtc. Inner Left Sequence: gccattctgcttctttttcg. Inner Right Sequence: ccgatctgaaaattggcatt. Inner Primer PCR Length: 2349. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1795 fat-1(ok2323) IV. C. elegans Y67H2A.8 Homozygous. Outer Left Sequence: cgcaatgagactggcttaca. Outer Right Sequence: taagttcctgcaaaacgcct. Inner Left Sequence: gtcgctcattcctcagaagg. Inner Right Sequence: agttgaaccacaggaaacgg. Inner Primer PCR Length: 2875. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1796 set-21(ok2327) IV. C. elegans Y24D9A.2. Homozygous. Outer Left Sequence: AATTCGCGAAAACGAAACAA. Outer Right Sequence: ATTGACGGAGAAAAGAGCGA. Inner Left Sequence: CTCCAATGCCTGTAGATGCC. Inner Right Sequence: AAAATTGGGAAAATGGTGGG. Inner Primer PCR Length: 3169 bp. Deletion Size: 1604 bp. Deletion left flank: TTTGCTGGCAGAACAGGGCACATCGACGGA. Deletion right flank: CACTCGGTACGATAAATGGAACAAGGATAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1797 W02B8.2(ok2328) II. C. elegans W02B8.2. Homozygous. Outer Left Sequence: CAAATTTGCCGAACATTTCA. Outer Right Sequence: TGCTTCATGTCTACAAGGCG. Inner Left Sequence: GAAATTTGCCGATTTGCC. Inner Right Sequence: TAAACCGGCCTCGTGTCTAC. Inner Primer PCR Length: 3065 bp. Deletion Size: 1711 bp. Deletion left flank: CTCAAGGTGGAAGAGGAGCTCCAGGAGAAG. Deletion right flank: GGCACAAGGCCTCAAGGTAGACGTAGGTAA. Insertion Sequence: CCTATACTTACCTCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1798 zig-7(ok2329) I. C. elegans F54D7.4. Homozygous. Outer Left Sequence: AGCGAGAGACGCAGAGAAAC. Outer Right Sequence: ATTTTCCCAATGTCAACCCA. Inner Left Sequence: AGAAAGGGGGAAACTCGGT. Inner Right Sequence: TGCTTGGCGAGTCTAGTGAA. Inner Primer PCR Length: 3106 bp. Deletion Size: 1931 bp. Deletion left flank: GAATCGATGAGTTTTATTTTCTCGTTTGCC. Deletion right flank: AGAAATTAATTTTTCAAAAAAAGAAAGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1799 Y71F9B.8(ok2333) I. C. elegans Y71F9B.8. Homozygous. Outer Left Sequence: ACAACCTGATGAGGGGTGAG. Outer Right Sequence: TGCCGGAATTGAAATTCTTC. Inner Left Sequence: TCGTTTGAACAATCGGAACA. Inner Right Sequence: TCCAGACCCTCATCATCTCC. Inner Primer PCR Length: 2841 bp. Deletion Size: 1153 bp. Deletion left flank: TGAAAATCTAGAGTCTTGTAATTGGGACTT. Deletion right flank: ATTTTTTGTAGATCAAACCGTGATGGGACA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1800 gpa-17(ok2334) III. C. elegans Y71H2B.7. Homozygous. Outer Left Sequence: GCCTCCTCAATCCTCAATCA. Outer Right Sequence: TTCCAGTACACAATCGCCTG. Inner Left Sequence: GAAGACGGCAATGATACGGT. Inner Right Sequence: TTGAGCATCAGTTGCCTGAG. Inner Primer PCR Length: 2552 bp. Deletion Size: 1693 bp. Deletion left flank: TTTCCAATTAGTGGTGGTGATTTTTGCCTG. Deletion right flank: AGGGAAAAAAGGGAAAACCGGAGAATTATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1801 csb-1(ok2335) X. C. elegans F53H4.1. Homozygous. Outer Left Sequence: ACAACTGGGAGAAAACCGTG. Outer Right Sequence: AGGAAGGTGTCGAGTGGTTG. Inner Left Sequence: GGCTGGGGGATTCAAATTAT. Inner Right Sequence: GAAGACTGATCATCGGAGCG. Inner Primer PCR Length: 3043 bp. Deletion Size: 1620 bp. Deletion left flank: CATCCGTTTCTTGGCGGCCTTCTTCTCCAC. Deletion right flank: TCGAGCTTTCGGAAACCACTGGTTCAGCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1802 F54E4.4(ok2336) X. C. elegans F54E4.4. Homozygous. Outer Left Sequence: CGATTGGGCCCTATTTAACA. Outer Right Sequence: TACAGCTGCCAGATGGATCA. Inner Left Sequence: TCATGTCTTATGGTGAAATTTTGG. Inner Right Sequence: AAGGAGTGAAGTGTGCAGAATG. Inner Primer PCR Length: 3144 bp. Deletion Size: 1217 bp. Deletion left flank: ACTCACTGTAGTAGTAGTTGTGGGTAAAGT. Deletion right flank: ATAAATGCGGGAAAAGCGGACGATCTTCTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1803 clec-65(ok2337) II. C. elegans F35C5.8. Homozygous. Outer Left Sequence: TTAATGGTGTTCGGGACCTC. Outer Right Sequence: GGCAAATTTTGACATCGCTT. Inner Left Sequence: AGCAGCATCGCCAACTCTAT. Inner Right Sequence: GCAAATTGCCGGAATTAAAA. Inner Primer PCR Length: 2174 bp. Deletion Size: 1580 bp. Deletion left flank: AACTCTATCCGTCAGTGACAGACGATGCGG. Deletion right flank: GTACTCACTTCTGTGTATTTTTTTTGCTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1804 T22D1.11(ok2338) IV. C. elegans T22D1.11 Homozygous. Outer Left Sequence: ttggggatgttcaattggtt. Outer Right Sequence: aacgactcaaaagctcagcc. Inner Left Sequence: atattggcagacacgcgatt. Inner Right Sequence: gccagagagctgctcaaaat. Inner Primer PCR Length: 2803. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1805 T05E8.1(ok2339) I. C. elegans T05E8.1. Homozygous. Outer Left Sequence: TGTTCCGGTTTCAGCTCTCT. Outer Right Sequence: TTTCCACCAAATCGACATGA. Inner Left Sequence: ACAATCCAAGGACCAACAGC. Inner Right Sequence: CCAGCAAAAATGGCAAATCT. Inner Primer PCR Length: 3175 bp. Deletion Size: 1978 bp. Deletion left flank: TCCTTTGTCTGTACTTCATACAAAACAATG. Deletion right flank: TTATTAGTAATTAAGCATCTTAAGAGTATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1806 fbxb-8(ok2340) I. C. elegans F49B2.1. Homozygous. Outer Left Sequence: TCGATTCGAATGGTTGTTCA. Outer Right Sequence: ACGTCATATGTGGCGCATTA. Inner Left Sequence: ACATAGGACACCCCTTGTCG. Inner Right Sequence: CCCGCATTTTTGTAGATCGT. Inner Primer PCR Length: 2880 bp. Deletion Size: 1799 bp. Deletion left flank: AGCTTCGATCACGATTCAGAGCAGTTTTGT. Deletion right flank: TCAATCCCGGCAATTTGCCGATTTACTGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1807 F55G11.2(ok2341) IV. C. elegans F55G11.2. Homozygous. Outer Left Sequence: ATGGCATTTGTTAAGCCCTG. Outer Right Sequence: TAGCTTGTCGTTGTCGTTGC. Inner Left Sequence: TTTGTGTTGTTTGGCTCGTC. Inner Right Sequence: CTTGCGGTCCAAAAGACATT. Inner Primer PCR Length: 2122 bp. Deletion Size: 1155 bp. Deletion left flank: ACTAGCTTCCAAGTTGACTATATTAATATT. Deletion right flank: ACTGTAATTCACAAATTTTAGATAAGTTAA. Insertion Sequence: TTGACTATATTAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1808 glr-2(ok2342) III. C. elegans B0280.12. Homozygous. Outer Left Sequence: AGCATCATGAGCAAATGCAG. Outer Right Sequence: ATATTGGTTTCCCTTTCCCG. Inner Left Sequence: TTTCCTCAAGGGCTCTCAAA. Inner Right Sequence: CTCACCTTCTCGGGCAATTA. Inner Primer PCR Length: 2675 bp. Deletion Size: 1229 bp. Deletion left flank: GATATTTCGGAGATTTCTCGTGCAGATATG. Deletion right flank: CAAGCAGTTATTTATGTGCCTACTTGAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1809 ins-30(ok2343) I. C. elegans ZC334.2. Homozygous. Outer Left Sequence: CCATCTGACGTTGCTCAGAA. Outer Right Sequence: GGAGCATGAGCACAACTCAA. Inner Left Sequence: AGGCTCGTAGATGCCAAAAA. Inner Right Sequence: TGATCTACCTCTGCATCCCC. Inner Primer PCR Length: 2309 bp. Deletion Size: 1078 bp. Deletion left flank: TTTTAGAAGACAATTATCAGTTGAAAAATC. Deletion right flank: TTTATCAACAAACTCCTTCCGCAAGTCTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1810 cpr-5(ok2344) V. C. elegans W07B8.5. Homozygous. Outer Left Sequence: AATCGAGTCTGCGGTTTCAG. Outer Right Sequence: CAACGTTCTCTCGCATCAAA. Inner Left Sequence: GGTTTTTCACCTCGAATGGA. Inner Right Sequence: TTGTGACACCCCGAAATTCT. Inner Primer PCR Length: 3132 bp. Deletion Size: 2015 bp. Deletion left flank: TTGTTTGTTCCGTCCATTCTACACTGAGTC. Deletion right flank: TTATCAGTTAATTTTATCAGTATCTTTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1811 C03B1.5(ok2345) X. C. elegans C03B1.5. Homozygous. Outer Left Sequence: GCGTGTAATCATGCAAATCG. Outer Right Sequence: TTGCATCTTCACAGGCTCAC. Inner Left Sequence: TTGCACGTCCACAATGAAAT. Inner Right Sequence: TGAAAATTGAACACAGGCCA. Inner Primer PCR Length: 2279 bp. Deletion Size: 1310 bp. Deletion left flank: GGCGATACTTCTCTATTCCTTATGAAGGAC. Deletion right flank: TTCTCAAGGGAGAGAATCCGTTCAAAAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1812 atn-1(ok84) V. C. elegans W04D2.1 Homozygous. Outer Left Sequence: agatgccattgacaccttcc. Outer Right Sequence: tattctgtctgtaccggacg. Inner Left Sequence: attcacagcctggtgcaact. Inner Right Sequence: atggaatcgcttcgtgtcgg. Deletion size: about 1136 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1813 F39B1.1(ok2346) X. C. elegans F39B1.1. Homozygous. Outer Left Sequence: ACATGGAACATTTCGGTGGT. Outer Right Sequence: AACGCAACGTCACTCTTGTG. Inner Left Sequence: GCCGATCTCCAATACCAAGA. Inner Right Sequence: CTGCTGCATCGAAAGTCGTA. Inner Primer PCR Length: 3242 bp. Deletion Size: 1597 bp. Deletion left flank: CGCATGTCATCGTCACGCTGGAAAGCATCA. Deletion right flank: TAACACTTACATAAAGGTCCAATGGAATCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1814 R151.1&R151.4(ok2347) III. C. elegans R151.4, R151.1. Homozygous. Outer Left Sequence: GTGCAAAGCCATATCCACCT. Outer Right Sequence: CGTGGGTCTCTATCGGTTGT. Inner Left Sequence: TTTTCCTAATTGTGGTCGCC. Inner Right Sequence: CAGCAGTCTGAACCCTCTCC. Inner Primer PCR Length: 2360 bp. Deletion Size: 1306 bp. Deletion left flank: ATATTCTATATCGACCACCAAATGAAGTAA. Deletion right flank: CAATGTGGCAGATAAGGATATTCTAAATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1815 vit-3(ok2348) X. C. elegans F59D8.1 Homozygous. Outer Left Sequence: atgcggtcgttctcaacttc. Outer Right Sequence: gcacattgctgaccttctca. Inner Left Sequence: cggtggaattcctcaacatc. Inner Right Sequence: ggatttgcttcaaagaccca. Inner Primer PCR Length: 3061. Deletion size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1816 gpa-16(ok2349) I. C. elegans Y95B8A.5 Homozygous. Outer Left Sequence: agcgcaatggggtgtattat. Outer Right Sequence: cgaatcggaccaaacactct. Inner Left Sequence: agcgaaacgaagatccaaga. Inner Right Sequence: attcgtgatcgagtgtggtg. Inner Primer PCR Length: 3358. Deletion size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1817 mop-25.3(ok2350) I. C. elegans T27C10.3. Homozygous. Outer Left Sequence: TTTACGGGGCTCGTATTTTG. Outer Right Sequence: TACAGTAATCCATGCGGCAG. Inner Left Sequence: GAGCCCGTAAATCGAGACAA. Inner Right Sequence: GGAACGGATTTCCGAATTTT. Inner Primer PCR Length: 2264 bp. Deletion Size: 1005 bp. Deletion left flank: GAATGAGCTCTTCACTGCTCAAACAAACTA. Deletion right flank: AGACTTCCGAAAGTGAATCACGTCTACCGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1818 C18B2.6(ok2353) X. C. elegans C18B2.6. Homozygous. Outer Left Sequence: CGTTTAAAACACACCCCACC. Outer Right Sequence: GCTCAAAATGTTGGCGTTCT. Inner Left Sequence: CAGCTCCAGTCCTCATGTCA. Inner Right Sequence: CATTTCCCGTTTCCTTTTCA. Inner Primer PCR Length: 3228 bp. Deletion Size: 2211 bp. Deletion left flank: CCGACTGTGTGACGTACTATTTCTGCGACG. Deletion right flank: AATATTCTCGAAAGGCAGATCCATGGACGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1819 Y62H9A.9(ok2354) X. C. elegans Y62H9A.9 Homozygous. Outer Left Sequence: cctgaactccaaggaccaaa. Outer Right Sequence: ctccaatttccgttcttcca. Inner Left Sequence: ttcctaaattgtccccctcc. Inner Right Sequence: tcaaaaatccatcccatcgt. Inner Primer PCR Length: 3238. Deletion size: about 3000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1820 T25F10.6(ok2355) V. C. elegans T25F10.6. Homozygous. Outer Left Sequence: TGAATAGACGTGTCGTTGCC. Outer Right Sequence: CCTCATTCTGGGACGTGTTT. Inner Left Sequence: ATGTGGGTGGAGATGATGGT. Inner Right Sequence: TGACGTCGAAGACGAGTACG. Inner Primer PCR Length: 2512 bp. Deletion Size: 1021 bp. Deletion left flank: GACTCCCATCTGGTATGGAATCATTCCCTG. Deletion right flank: CTTGAATTGGGATAATTCCCTCGGATCTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1821 K10G9.1(ok2356) III. C. elegans K10G9.1. Homozygous. Outer Left Sequence: AGACCTGTGAGATGTCCGCT. Outer Right Sequence: GGCTCTTCAGGCACAACTTC. Inner Left Sequence: GCAGAACCCTCAAGAAGTCG. Inner Right Sequence: TTGCGTCTCGTTCAGAACAC. Inner Primer PCR Length: 3066 bp. Deletion Size: 1936 bp. Deletion left flank: TAGCTGTGAAGAATATGACGGTGAGTGTCT. Deletion right flank: CGAAATTTTCAGAATGGAGGAAGAAAGAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1822 elp-1(ok2357) V. C. elegans F38A6.2. Homozygous. Outer Left Sequence: CACCATACCATCACTTCCCC. Outer Right Sequence: TGTCTCCACCGTGACACAAT. Inner Left Sequence: AATCAGTGACCGGAATCTGC. Inner Right Sequence: GGAGTAGCGCAAGTAGGGAA. Inner Primer PCR Length: 2857 bp. Deletion Size: 1416 bp. Deletion left flank: CAAAAATAACGAAAATGACGTCACTCAATT. Deletion right flank: ACTAAATTTTTTAACGTTTATGTTTTTAGA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1823 gst-4&msp-38(ok2358) IV. C. elegans K08F4.7, K08F4.8. Homozygous. Outer Left Sequence: ATGCTGGGTGAAACTAACGG. Outer Right Sequence: AAAGATCTGGGGCAGTGATG. Inner Left Sequence: TCCTCGAACATCGAAACACA. Inner Right Sequence: AAGGTGATCAACTCATCGGC. Inner Primer PCR Length: 2170 bp. Deletion Size: 1548 bp. Deletion left flank: CAAACCTTGGGCAAGAATTTCCAGAGATTG. Deletion right flank: GAATTGTTTGGCAGCGCCATCCGGGGTGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1824 C18B2.6(ok2360) X. C. elegans C18B2.6. Homozygous. Outer Left Sequence: CGTTTAAAACACACCCCACC. Outer Right Sequence: GCTCAAAATGTTGGCGTTCT. Inner Left Sequence: CAGCTCCAGTCCTCATGTCA. Inner Right Sequence: CATTTCCCGTTTCCTTTTCA. Inner Primer PCR Length: 3228 bp. Deletion Size: 1608 bp. Deletion left flank: ATAGTATATGTCAAGTATAATTTTTCGTTT. Deletion right flank: ATGTTTCTCGTAATAGATATAAGCTGTCGT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1825 C36B1.12(ok2362) I. C. elegans C36B1.12 Homozygous. Outer Left Sequence: ttccatttggtggttggatt. Outer Right Sequence: gatatcgccaagtcccagaa. Inner Left Sequence: aggctccagatgcgaataga. Inner Right Sequence: catgagcattgggaactgaa. Inner Primer PCR Length: 3358. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1826 T26A5.5(ok2364) III. C. elegans T26A5.5. Homozygous. Outer Left Sequence: GTTCGTCAAATCGACTGGGT. Outer Right Sequence: GTTGGAGGCTTCTGTCCATC. Inner Left Sequence: AGGTGGATCTCATTCAACGG. Inner Right Sequence: TTCCTCACTTCCTCGTTTCG. Inner Primer PCR Length: 3244 bp. Deletion Size: 1461 bp. Deletion left flank: TTCTGCATGCGTCTCTATGGCCTCAAACTG. Deletion right flank: GCATTTGTTGGTGGACTTCCAACTTCATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1827 hum-6(ok2365) X. C. elegans T10H10.1. Homozygous. Outer Left Sequence: GGGGAACGAAACCCATTAGT. Outer Right Sequence: TGGAAAACTGAACTCGAGCA. Inner Left Sequence: TCAAAACCGAAAGAGCACAA. Inner Right Sequence: GCTCTCGATCATCAACCACA. Inner Primer PCR Length: 3314 bp. Deletion Size: 2881 bp. Deletion left flank: TGTACCACACCACAGCTTCGCAGACACCAC. Deletion right flank: TTAGTCTAGTCTGTGTCAATTTTGTTTCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1828 dgk-5(ok2366) II. C. elegans K06A1.6. Homozygous. Outer Left Sequence: CAGATATTCGGCGGGAGTTA. Outer Right Sequence: ACAGATTTTGAGCCACCCAC. Inner Left Sequence: TCTTGCAGCTGATAACGGTG. Inner Right Sequence: CGACGACCCAGTCGAATTAT. Inner Primer PCR Length: 2725 bp. Deletion Size: 1478 bp. Deletion left flank: AATTATCGTAATCAGCTCTTCCAACCACAA. Deletion right flank: CAAGACGAAGAATCCACGTGGGTGGAACAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1829 F22G12.5(ok2367) I. C. elegans F22G12.5. Homozygous. Outer Left Sequence: GAAAAGGGGTTAGGAGCAGG. Outer Right Sequence: CCCCTAGATCTGACACTGCC. Inner Left Sequence: TCAAATCGGCTAATTTTCGG. Inner Right Sequence: TCGTCTGCATCTGTGTGTCA. Inner Primer PCR Length: 3163 bp. Deletion Size: 1478 bp. Deletion left flank: TAGAGATTTGCCACGGAGATTCTTCGAGCT. Deletion right flank: ACAGCATCCTGTCTAGATCTAGGCTTAACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1830 C37E2.1(ok2368) X. C. elegans C37E2.1. Homozygous. Outer Left Sequence: TTGGGTTCGTGATTTGTTGA. Outer Right Sequence: CCAAGACCACCGAAACAACT. Inner Left Sequence: ACAAGTTCTGGTGGGGATTG. Inner Right Sequence: AATTTCACAGCTGGCCATTC. Inner Primer PCR Length: 2507 bp. Deletion Size: 1441 bp. Deletion left flank: TACGGAACTTGTCAATGACGGCATCAGCAA. Deletion right flank: GAGCCTCATGTTCAGACCCTGAAGTTCTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1831 set-22(ok2370) V. C. elegans Y32F6A.1. Homozygous. Outer Left Sequence: CAATCAAAATGAGTTCGGCA. Outer Right Sequence: TCCTCAACTGATAGACGGGC. Inner Left Sequence: AAATTGGCAACAGACTCAAAAA. Inner Right Sequence: TCTCGATTGAAATTCCCGAG. Inner Primer PCR Length: 3158 bp. Deletion Size: 1483 bp. Deletion left flank: CAACAATGTCTCTTGAGAATTCAAAAATCT. Deletion right flank: AAGATATTTAAATACTTTTAAAACTTTTTA. Insertion Sequence: ATATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1832 acc-4(ok2371) III. C. elegans T27E9.9 Homozygous. Outer Left Sequence: cgtcctcgccattctcttag. Outer Right Sequence: tttcgccaaaattatctccg. Inner Left Sequence: atccgaggacacagatttgg. Inner Right Sequence: tggccttcgttgtcttcttt. Inner Primer PCR Length: 3018. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1833 K10B3.5(ok2372) X. C. elegans K10B3.5 Homozygous. Outer Left Sequence: aaagccgttcatgtcaaacc. Outer Right Sequence: acgagagaagacatgggacg. Inner Left Sequence: gagtagtgtgagctgctgcg. Inner Right Sequence: ggtgttccttctcaaatggc. Inner Primer PCR Length: 3221. Deletion size: about 2600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1834 che-7(ok2373) V. C. elegans F26D11.10. Homozygous. Outer Left Sequence: AAAATTCGTCCGAGTCGTTG. Outer Right Sequence: GAGCAGTGGCTCTTTGCTCT. Inner Left Sequence: TGATTCTGGCCATCAGAATTT. Inner Right Sequence: GGGGCACAAAAATGAGAGAA. Inner Primer PCR Length: 3059 bp. Deletion Size: 1496 bp. Deletion left flank: TGCCCACGTACATTATTTTTGTCGCCTGAA. Deletion right flank: GCACTGCCATCATAATAAGAAACGATGATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1835 F41D9.1(ok2374) X. C. elegans F41D9.1 Homozygous. Outer Left Sequence: tcgtgctccactctcatttg. Outer Right Sequence: gttgaaccgatcggaagaga. Inner Left Sequence: aagaaaggtgagcgctgtgt. Inner Right Sequence: gccttgtggcctaatggata. Inner Primer PCR Length: 3251. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1836 W05B5.2(ok2375) I. C. elegans W05B5.2 Homozygous. Outer Left Sequence: acgttaagaaaccgcctttg. Outer Right Sequence: cggaatcgtcctgaaatgtt. Inner Left Sequence: aagtctccaccaatgcaaaa. Inner Right Sequence: ttctttcttttatttttcggtttca. Inner Primer PCR Length: 3143. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1837 C54A12.2(ok2376) II. C. elegans C54A12.2. Homozygous. Outer Left Sequence: AGGCTACCGTGTCGGTATTG. Outer Right Sequence: TCAGTCGGCAACGTATGAAA. Inner Left Sequence: GAAAAATGTTGAGGCGGTGT. Inner Right Sequence: ATCTTTGGCATGTTTGGCTC. Inner Primer PCR Length: 2721 bp. Deletion Size: 1540 bp. Deletion left flank: TCCCACTTCCTTCTGCAATAACCTTAACAC. Deletion right flank: CAGAGAATGCAATTTGATAATGATGGTTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1839 C18H2.2(ok2379) III. C. elegans C18H2.2. Homozygous. Outer Left Sequence: AAGTTGGAACCTTGGAGCCT. Outer Right Sequence: ACAGCGTCGTTGAAAGATCA. Inner Left Sequence: AACTGCTCCCATGTGACCTAA. Inner Right Sequence: CACTTCTGAAAATTCCACCGA. Inner Primer PCR Length: 3037 bp. Deletion Size: 1531 bp. Deletion left flank: TATTTTTCGTGTAACAATCTATTTTTCGTGGAACAATCTATTTTTCGTGTAACAATCTA TTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATT TTTC. Deletion right flank: ATCATCTTTGGATGTGACCAGCGCTGAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1840 M28.8(ok2380) II. C. elegans M28.8. Homozygous. Outer Left Sequence: AACTCCAGCTCGCAATGAAT. Outer Right Sequence: GCCAAGGTTTGCAAGTTTGT. Inner Left Sequence: TGTGCTCAGTATTCGGGATCT. Inner Right Sequence: ACAAACCGACAGATTTGCCT. Inner Primer PCR Length: 3039 bp. Deletion Size: 2145 bp. Deletion left flank: TGAACCTCTTTGTTTGTTCTTATCAATTTA. Deletion right flank: TTAATATCGGGTAAGACAAATTAGTGTGAT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1841 Y32G9A.8(ok2383) V. C. elegans Y32G9A.8 Homozygous. Outer Left Sequence: gcacagggaactggtttgtt. Outer Right Sequence: ggtaccgtctttttgggaca. Inner Left Sequence: gtcctcttcttgggctcctt. Inner Right Sequence: cagccaaaaatacactgcga. Inner Primer PCR Length: 2685. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1842 Y54E10A.3(ok2384) I. C. elegans Y54E10A.3. Homozygous. Outer Left Sequence: CACCATGCCAGTTATCAACG. Outer Right Sequence: CCGAAAAATTGTTTTGCAGC. Inner Left Sequence: TCGATTTCACTGCAGTCTGG. Inner Right Sequence: TGACATATTTCAACGCGACG. Inner Primer PCR Length: 2527 bp. Deletion Size: 1157 bp. Deletion left flank: TTCTGACAATAAAATAAACTTTATTTTTTA. Deletion right flank: TTAGAAAATATCCGAAAAAAATATCCGCCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1843 lin-42(ok2385) II. C. elegans F47F6.1. Homozygous. Outer Left Sequence: CGGTTACGCATTGAAAGACA. Outer Right Sequence: AGTCCCTTTTGCCTGGATCT. Inner Left Sequence: TTTTGCAGGAAACGTAAAGGA. Inner Right Sequence: AGGGGCCTGATCCTAAGAAA. Inner Primer PCR Length: 3109 bp. Deletion Size: 2632 bp. Deletion left flank: CCGGGTTCAGGCCCATATAGGCCTATAGGC. Deletion right flank: ACGGGGGGCTACCCGGCTGGGTGGGAAGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1844 F56C9.5(ok2386) III. C. elegans F56C9.5 Homozygous. Outer Left Sequence: tgaccgttttccaaaacaca. Outer Right Sequence: caaaatcgggcgtactcatt. Inner Left Sequence: atttcgacggtttacttgcg. Inner Right Sequence: cagccatacttcccaatcgt. Inner Primer PCR Length: 2278. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1845 dod-17(ok2387) IV. C. elegans K10D11.1. Homozygous. Outer Left Sequence: GTGCAAAGACCACCGATTTT. Outer Right Sequence: CTTGAGAGCGCCTTTCACTC. Inner Left Sequence: GACAAAACGCCCAGTTTCAT. Inner Right Sequence: CTTTGCTTCTATGTCGGCGT. Inner Primer PCR Length: 2109 bp. Deletion Size: 1489 bp. Deletion left flank: TTCATCTGTCTAGCGTTTGCTACTGCAATT. Deletion right flank: AATCGATGAGATGGTGGAACTCCGGCCGCA. Insertion Sequence: CGATGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1846 C30G12.6(ok2389) II. C. elegans C30G12.6. Homozygous. Outer Left Sequence: TTCATGGGAACACACTCCAA. Outer Right Sequence: CAGGGATCTCACTAGCCCAA. Inner Left Sequence: AACACGTGACGAATGATCCA. Inner Right Sequence: AAACCGTTTTCGCACAAATC. Inner Primer PCR Length: 3210 bp. Deletion Size: 1408 bp. Deletion left flank: TCATTCTTATTCCCTAAAAGAGCTGGAATG. Deletion right flank: TCACAGTTACTTCATCACAACATGTGGTTT. Insertion Sequence: TGTTACTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1847 Y76G2A(ok2390) I. C. elegans Y76G2A. Homozygous. Outer Left Sequence: CATACGCAAACGCCAAAGTA. Outer Right Sequence: CGGATGCTCTATTTGGGAAA. Inner Left Sequence: GGATACAAGGAACAGGCAGC. Inner Right Sequence: GTGAGCTTCTGTGATCCCGT. Inner Primer PCR Length: 2243 bp. Deletion Size: 833 bp. Deletion left flank: GCTGAAGGATCAGAACATCAGGAAGAGCCT. Deletion right flank: AAAACTTAAGTCAGGTGGAAAAATATTTTC. Insertion Sequence: TTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1848 F19C6.4(ok2392) X. C. elegans F19C6.4. Homozygous. Outer Left Sequence: AACATTCTGTCCCCTATGCG. Outer Right Sequence: AACCGTACAAAAAGCATGGC. Inner Left Sequence: CAGCCATACAGCGTTTTGAA. Inner Right Sequence: GCCTACGGAGCAGAAGATTG. Inner Primer PCR Length: 3163 bp. Deletion Size: 1030 bp. Deletion left flank: AAGCGATAATACTCCGTTTCATATACCAGT. Deletion right flank: ATATTAGAGGAGTTTTTTGGGTTGAAAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1849 C43E11.11(ok2393) I. C. elegans C43E11.11. Homozygous. Outer Left Sequence: TCAGATGCCCAAAGATGTGA. Outer Right Sequence: CTTCGGTGCTTAACGAGGTC. Inner Left Sequence: CGGAGATCACATCGGAGATT. Inner Right Sequence: GGGCTTTTTCTGCAGTCATC. Inner Primer PCR Length: 3346 bp. Deletion Size: 1230 bp. Deletion left flank: TTCCGAAAACCCGAGAAAACGATGACGATA. Deletion right flank: TTTAAATTTATTTATTTAACTTGTCTAACT. Insertion Sequence: AATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1850 C44C8.6(ok2394) IV. C. elegans C44C8.6 Homozygous. Outer Left Sequence: gctcaaaatttcggcacatt. Outer Right Sequence: accggactagctccaccttt. Inner Left Sequence: actctgtgccaccaaaaacc. Inner Right Sequence: catatccgtccattgttccc. Inner Primer PCR Length: 2719. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1851 hpr-9(ok2396) III. C. elegans Y39A1A.23 Homozygous. Outer Left Sequence: aaattcgctgaaatcatggc. Outer Right Sequence: gttgggtttttgatgtgcct. Inner Left Sequence: aatcgaaaaaccgacaccct. Inner Right Sequence: cctccaactttccgacaaga. Inner Primer PCR Length: 2639. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1853 dos-1(ok2398) III. C. elegans ZK507.4. Homozygous. Outer Left Sequence: CGCCGACTTCATCATTCTCT. Outer Right Sequence: AAAGGCACAGCACATTACCC. Inner Left Sequence: TATCTGCGTGACGGTTTTTG. Inner Right Sequence: GAGCGCGTCTTTAAAGGGTA. Inner Primer PCR Length: 2244 bp. Deletion Size: 1674 bp. Deletion left flank: TCGTTTGAATCCCACCATTCAGAACCCAGG. Deletion right flank: AAAGAAATCGCAAAAGACGCACCCCAATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1854 sms-1(ok2399) IV. C. elegans H21P03.3. Homozygous. Outer Left Sequence: TGAAAACAATGGCCAGATCA. Outer Right Sequence: TTCGTCTCGTCGAATCTGTG. Inner Left Sequence: ACGAGCACAAGTGTGTGTCC. Inner Right Sequence: TGATAAACCAGCAAGTCCCC. Inner Primer PCR Length: 1168 bp. Deletion Size: 620 bp. Deletion left flank: GAGAATTGATCCAATGAAACAGAGACGACG. Deletion right flank: GGTCAAATTTTAAAGCAAATTTTCGAAAAA. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1855 B0213.15(ok2401) V. C. elegans B0213.15 Homozygous. Outer Left Sequence: ggagaaaagcgtggtctctg. Outer Right Sequence: tttccgaaaaatcgaacagg. Inner Left Sequence: tagtgcaaacggagttggtg. Inner Right Sequence: tactgagaagaccgccgagt. Inner Primer PCR Length: 2540. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1856 B0213.15(ok2402) V. C. elegans B0213.15 Homozygous. Outer Left Sequence: ggagaaaagcgtggtctctg. Outer Right Sequence: tttccgaaaaatcgaacagg. Inner Left Sequence: tagtgcaaacggagttggtg. Inner Right Sequence: tactgagaagaccgccgagt. Inner Primer PCR Length: 2540. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1857 B0213.15(ok2403) V. C. elegans B0213.15 Homozygous. Outer Left Sequence: ggagaaaagcgtggtctctg. Outer Right Sequence: tttccgaaaaatcgaacagg. Inner Left Sequence: tagtgcaaacggagttggtg. Inner Right Sequence: tactgagaagaccgccgagt. Inner Primer PCR Length: 2540. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1858 ifd-1(ok2404) X. C. elegans R04E5.10. Homozygous. Outer Left Sequence: AGAATGCTTGAAAGCCGAGA. Outer Right Sequence: ACTACGGAAGGGCATGTGAC. Inner Left Sequence: CGACCGAAAATGTACCAACA. Inner Right Sequence: TTGCGGTAAACTCTGATCCC. Inner Primer PCR Length: 3151 bp. Deletion Size: 1863 bp. Deletion left flank: AATATCATGGTATAGCACTTTAAAAACTTT. Deletion right flank: ATTTTAAAAAAAGCAAATTAAAAACTAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1859 B0391.5(ok2405) V. C. elegans B0391.5 Homozygous. Outer Left Sequence: aagaccttcccgatttcgat. Outer Right Sequence: ccagcccatagtttccaaga. Inner Left Sequence: caattccggctcgaaataaa. Inner Right Sequence: cctgctctgcttggaatagg. Inner Primer PCR Length: 3191. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1860 F35A5.1(ok2406) X. C. elegans F35A5.1. Homozygous. Outer Left Sequence: AACCACCGAAACCAACAGAG. Outer Right Sequence: CGCCGTGAGGATGATAAGTT. Inner Left Sequence: ACTCCCAAACCGAAGGAAGT. Inner Right Sequence: TTCTGATCAATTTCCCGAGG. Inner Primer PCR Length: 2698 bp. Deletion Size: 2012 bp. Deletion left flank: AGCTGATTCTCTTGGTGGACCTAAGCCAAA. Deletion right flank: CAAACTGCGGCTTTAATTACACAGGAAGGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1861 arl-5(ok2407) III. C. elegans ZK632.8. Homozygous. Outer Left Sequence: GACAAGTCATTCCGCGATTT. Outer Right Sequence: TCGTCCAACAAATGATCGAA. Inner Left Sequence: GTTGCACCGCTAAACCCTAA. Inner Right Sequence: GCCAGAAGAAAGTGAGCCAG. Inner Primer PCR Length: 2126 bp. Deletion Size: 1199 bp. Deletion left flank: TCTTCCCGTTCTTTTTTATTCAAACTTATG. Deletion right flank: ATATTAAAATTAAAATTATTTTCAGTTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1862 F07G6.2(ok2408) X. C. elegans F07G6.2. Homozygous. Outer Left Sequence: AGTATGCTAGCCCGGAAGGT. Outer Right Sequence: GTCTCAGCAAAACCAGGGAG. Inner Left Sequence: TGCGCTGTTTAGAATTGTGC. Inner Right Sequence: CGATGTTTGGGTGTCACATT. Inner Primer PCR Length: 3052 bp. Deletion Size: 1625 bp. Deletion left flank: ATTTTTGCCGACATTAGTTTAAAAAATTAA. Deletion right flank: GTGCTAGGACGTAGCGCTTTCATGCAGGCG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1863 flp-12(ok2409) X. C. elegans C05E11.8. Homozygous. Outer Left Sequence: AATCAAAACGCAATTTTCGG. Outer Right Sequence: AGGGGAGGACCATCATTAGG. Inner Left Sequence: AAAATTGCAATAAACACGGGA. Inner Right Sequence: CTTGGTCGGCACATAAGCTC. Inner Primer PCR Length: 1155 bp. Deletion Size: 564 bp. Deletion left flank: AGCTTTTATAAATATCAGCCTAAATTTGGC. Deletion right flank: GGGTTTTCTTGCTGGGCCCCATAAGACGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1864 msh-2(ok2410) I. C. elegans H26D21.2. Homozygous. Outer Left Sequence: ACCATTTTGGCAACTTGGAG. Outer Right Sequence: GCGAAACCAATTCACCGTAT. Inner Left Sequence: CAACTCCCTCGAAAACCTTG. Inner Right Sequence: TCCCTGCAGGACCATTTTAC. Inner Primer PCR Length: 3099 bp. Deletion Size: 1300 bp. Deletion left flank: AATTAGTTACCTTCAAAGTGACTCGGAAAT. Deletion right flank: CCCTGTTCACTCGAGTATAGCTCAACGGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1865 hum-6(ok2411) X. C. elegans T10H10.1. Homozygous. Outer Left Sequence: GGGGAACGAAACCCATTAGT. Outer Right Sequence: TGGAAAACTGAACTCGAGCA. Inner Left Sequence: TCAAAACCGAAAGAGCACAA. Inner Right Sequence: GCTCTCGATCATCAACCACA. Inner Primer PCR Length: 3314 bp. Deletion Size: 1767 bp. Deletion left flank: CACCCCTACCTGTACCACACCACAGCTTCG. Deletion right flank: GGTTTAGTCTGTATATTGCACTTTTTGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1866 F01G12.2(ok2412) X. C. elegans F01G12.2 Homozygous. Outer Left Sequence: ggagctggagtggaaatgaa. Outer Right Sequence: ccgcctgctcatctatcttc. Inner Left Sequence: cgcaacggaatatccttttt. Inner Right Sequence: tcgctacccttgatattcgc. Inner Primer PCR Length: 1284. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1867 C10H11.1(ok2413) I. C. elegans C10H11.1. Homozygous. Outer Left Sequence: GCGCCGAAAAAGTACAAAAA. Outer Right Sequence: AGTAATGACGGTTTCACCGC. Inner Left Sequence: TTGTGCAGGAGAAACGTGAG. Inner Right Sequence: TGCATCGTTCTGTTTCCAAG. Inner Primer PCR Length: 3296 bp. Deletion Size: 2472 bp. Deletion left flank: GGATCGAAGAATGTCGATGTGAGACTTGTA. Deletion right flank: GTTGTGTACAAAGGAGCAGAACCTGAGCAG. Insertion Sequence: CT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1868 hum-8(ok2414) IV. C. elegans Y66H1A.6. Homozygous. Outer Left Sequence: AATTTTCGGCAATCGACACT. Outer Right Sequence: GATGCATTTGAATGAGGCAA. Inner Left Sequence: TTGACGGAATTCCCAAAAAT. Inner Right Sequence: CTCACCACAATGGCCAAATA. Inner Primer PCR Length: 3122 bp. Deletion Size: 1206 bp. Deletion left flank: AAAGTCCATTTCCTTTCAATTCAAATAACT. Deletion right flank: AATGTCTCGAAAACGGTTTAAAAGAGTAAA. Insertion Sequence: TTTTCCTTTCAATTTCAAATAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1869 W06B11.1(ok2415) X. C. elegans W06B11.1. Homozygous. Outer Left Sequence: AAAACGATATTGGGCTGTGG. Outer Right Sequence: GCATCGGTTTTCAGTGGAAT. Inner Left Sequence: AGATTGCCTGGGTGAAATGT. Inner Right Sequence: AGCCTATGCACAGAGCTGGT. Inner Primer PCR Length: 3070 bp. Deletion Size: 1660 bp. Deletion left flank: TTTAAAATGTTTGTTTTTTTGTAAATTGAT. Deletion right flank: TTATTTCAGTCTTTGGATGCCAAATTATAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1870 clec-49(ok2416) V. C. elegans W04D12.6. Homozygous. Outer Left Sequence: ACAGGAACCCCCTGAAAAAT. Outer Right Sequence: TACATCAACTGGGCACCAAA. Inner Left Sequence: AAACCGGAAAATCCTAAGCC. Inner Right Sequence: AATCCGGGAAAGGAAAATTG. Inner Primer PCR Length: 3163 bp. Deletion Size: 1614 bp. Deletion left flank: CGGGTTTTCAATTTCGTGATGTCATTGAAT. Deletion right flank: CCGGCAAATTGGCAAATTGCCGGAATTGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1871 stn-2(ok2417) X. C. elegans F27D9.8. Homozygous. Outer Left Sequence: ATTACGGCAAACAGAAACCG. Outer Right Sequence: CCCCTCTGGGAAATAGGAAC. Inner Left Sequence: TTGACTCATCGCGTGTCTTT. Inner Right Sequence: CGAATGAGCGTTCATAGCAA. Inner Primer PCR Length: 3180 bp. Deletion Size: 1569 bp. Deletion left flank: CGGTTCGGTAATATGCTTGCTCAAAAAGTT. Deletion right flank: TTGTTTCTACTCATGTTTCTTCGTCCTTTT. Insertion Sequence: TTGTTAAAGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1872 C27A2.1(ok2421) II. C. elegans C27A2.1. Homozygous. Outer Left Sequence: ATGCAACGTGCTAAAGCAAA. Outer Right Sequence: GTGGTTCCATTCCACATTCC. Inner Left Sequence: AAGCTCGAGCGAGACTTCAG. Inner Right Sequence: ACATCTGAATGGAACTGGGC. Inner Primer PCR Length: 3285 bp. Deletion Size: 2424 bp. Deletion left flank: AAATAATATTTATTTTTGTTGAAAAATTAG. Deletion right flank: TTGAAAACCGTGCACGTATCCACGATAAAC. Insertion Sequence: CTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1874 npp-12(ok2424) I. C. elegans T23H2.1. Homozygous. NOTE: This strain appears to carry a roller mutation in the background; a low percentage of rollers are observed in the population. Outer Left Sequence: CTGGAATCGGATTTGGAGAA. Outer Right Sequence: TGATCTTCGAACGACGAGTG. Inner Left Sequence: GATTCGTCGCTTCCAATGAT. Inner Right Sequence: ATTGGTTGCAGCAATGACAG. Inner Primer PCR Length: 3053 bp. Deletion Size: 1204 bp. Deletion left flank: TGCAATTGCTCTCCGTGCAAGAAGTCTCAC. Deletion right flank: TTTCTCAGTTCCTTCTGATTTCTCGAGCCG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1875 Y65B4A.3(ok2425) I. C. elegans Y65B4A.3. Homozygous. Outer Left Sequence: ACCTCCTCAGACGACTCGAA. Outer Right Sequence: GAGCGCGAAAATTCAAAGAG. Inner Left Sequence: GTCGCCATATCGTCGTTTTT. Inner Right Sequence: CCGATTTTAGAGGAAGACCAGA. Inner Primer PCR Length: 3213 bp. Deletion Size: 1830 bp. Deletion left flank: CATGGTTTCCGACTGTTTTTCCTGTTAAAT. Deletion right flank: TTTTTTCCACATGTGTGGATCTCAATTTAT. Insertion Sequence: GTTAAAAAATGTATGAAAAAAAATTTTAAAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1877 Y44A6D.3(ok2427) V. C. elegans Y44A6D.3. Homozygous. Outer Left Sequence: AGGTGTTCCACCAGCACAAT. Outer Right Sequence: TGCCGTGCTTCTATCTTCCT. Inner Left Sequence: TCTCTCATCTTTCGCTTCACC. Inner Right Sequence: CAACTCTTAAGCCACAAAACTGT. Inner Primer PCR Length: 3141 bp. Deletion Size: 1471 bp. Deletion left flank: ATTCTGATGGAAATGACTAGAAGGCAAGGC. Deletion right flank: ATTGATGTGCCTGAAATTTGAAAAAAATGT. Insertion Sequence: TTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1878 ptp-3(ok2428) II. C. elegans C09D8.1 Homozygous. NOTE: C09D8.1 used to be ptp-1; ptp-1 is now C48D5.2. Outer Left Sequence: aaatccgttgagcaaacacc. Outer Right Sequence: gtccttctcgattttcagcg. Inner Left Sequence: ttttacggccaattttctgc. Inner Right Sequence: atatccttgtgcgcgtaacc. Inner Primer PCR Length: 2770. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1880 nas-32(ok2430) V. C. elegans T02B11.7. Homozygous. Outer Left Sequence: GGATCTACCATGAGCCAGGA. Outer Right Sequence: CGAAAATGAGAACGGAAAGC. Inner Left Sequence: TGTGCACCCGTAGACACATT. Inner Right Sequence: GACGGGTCGTACTTTTGGAA. Inner Primer PCR Length: 2939 bp. Deletion Size: 1989 bp. Deletion left flank: AATTCGTCCGCCCATGGTGTATACCATCAC. Deletion right flank: CATGTCCAATGCTGGTGGATTCTCGGTTAT. Insertion Sequence: TTCTTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1881 nas-36(ok2431) I. C. elegans C26C6.3. Homozygous. Outer Left Sequence: AAAAATGAAGTGCCGGTGTC. Outer Right Sequence: GTTTATCAACAGGGCACGCT. Inner Left Sequence: TTTGCGCAATATGCATTCTC. Inner Right Sequence: CGTCGTCCCCTGAAAGATAA. Inner Primer PCR Length: 3089 bp. Deletion Size: 2659 bp. Deletion left flank: ATGAAAAAATTGGCGCATTCAAGAAGTTTT. Deletion right flank: TTTCTTGTTATAACATTTTCAAATTTCCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1882 sgn-1(ok2432) II. C. elegans F07H5.2. Homozygous. Outer Left Sequence: ACGTGTGTTTGTGGGTTTCA. Outer Right Sequence: AAAGCCACGTTCGATTCAAG. Inner Left Sequence: CCCCTTCTCAATATTCGGGT. Inner Right Sequence: AAGCTTCCAGCCTCCTTTGT. Inner Primer PCR Length: 3103 bp. Deletion Size: 1620 bp. Deletion left flank: TTGAGCACAATTCCGATGGCAAGGATCAAA. Deletion right flank: AGGTTTAATTATATTATTATAGTACACATC. Insertion Sequence: TATATTATTATAGTACAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1883 W03B1.2(ok2433) IV. C. elegans W03B1.2. Homozygous. Outer Left Sequence: ATGGCAATTGCGTATAAGGC. Outer Right Sequence: CTAGTGATGGCGCAGTTGAA. Inner Left Sequence: CAAAGACCTTGTCTGAACCTGA. Inner Right Sequence: AAACAGCACTGCTTCCAACC. Inner Primer PCR Length: 3025 bp. Deletion Size: 2350 bp. Deletion left flank: TGAGGATCCGGAATGAGAGCAGAAACCAGC. Deletion right flank: GAAGGAGTACGAGAACGAGTCAAAGAACAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1884 B0285.7(ok2434) III. C. elegans B0285.7. Homozygous. Outer Left Sequence: ATAGGCGCATTAGATGACGG. Outer Right Sequence: CATTTTCGCATTTCTCGGAT. Inner Left Sequence: TTGAACAAGAAATAACATTGAAAAA. Inner Right Sequence: CTGTGCCTGTCTCATGCCTA. Inner Primer PCR Length: 1167 bp. Deletion Size: 630 bp. Deletion left flank: ACAAATTCGCTTTCTCCACAGCCACCATCT. Deletion right flank: AGAATCTGCCTGCCTTATACCTAAATGTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1886 lgc-20&B0491.5(ok2436) II. C. elegans B0491.5, B0491.4. Homozygous. Outer Left Sequence: ATCCTTTCACCAATTCCACG. Outer Right Sequence: CATGGATCGGTCTTTGGAGT. Inner Left Sequence: GTCATTTCGTCGGAATTTGG. Inner Right Sequence: TTTGTAATTCAGCAAGGGACG. Inner Primer PCR Length: 3101 bp. Deletion Size: 1454 bp. Deletion left flank: CAAAACTAATGAGTCAAAGCGCTCAGTCAT. Deletion right flank: TTACAGAGAATTTTGTTAAATTTTAAAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1887 tom-1(ok2437) I. C. elegans M01A10.2. Homozygous. Outer Left Sequence: AGCGGAGAGTGAAGTTTTGC. Outer Right Sequence: AGGAGGGTTTGCAACAAAAA. Inner Left Sequence: GCCCGATTAATAGTCTCTCCAA. Inner Right Sequence: CGGTATTTCTTAATGTTAATGCAC. Inner Primer PCR Length: 3012 bp. Deletion Size: 2391 bp. Deletion left flank: GTTAACCATCTGCCCTTACCCAGTGTCGCC. Deletion right flank: TAATAAAGATGAAATGAATGTTTCAGTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1888 gly-10(ok2439) IV. C. elegans Y45F10D.3. Homozygous. Outer Left Sequence: CACACCAAGCCATACGTCAG. Outer Right Sequence: GCCCATTTTTGGAGATCAGA. Inner Left Sequence: TTTGGCCTCCTAACAAAACG. Inner Right Sequence: GTGCAAAAATCCTTTGCCAT. Inner Primer PCR Length: 3042 bp. Deletion Size: 1037 bp. Deletion left flank: CTTTTTGCAATTCAATTTTCAAATATTTGT. Deletion right flank: GAAATAGAGGCGGGGTGTAGTTTTGCAACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1889 F09G2.1(ok2440) V. C. elegans F09G2.1. Homozygous. Outer Left Sequence: TGAAACGAGTAGGCAGTCCC. Outer Right Sequence: TGACTTTTCTGACCAGCACG. Inner Left Sequence: AAAATTTTGCGGACAGGATG. Inner Right Sequence: TAATGGAAACTTTGGTCGGG. Inner Primer PCR Length: 3181 bp. Deletion Size: 1440 bp. Deletion left flank: TCAGCAATCTGCCGATTTATCTGAAAAAAT. Deletion right flank: CAAAATAGTAGGTGTCCCACCTGCAATCGA. Insertion Sequence: TTAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1891 Y51H1A.4(ok2443) II. C. elegans Y51H1A.4 Homozygous. Outer Left Sequence: tttccagattttctcgcgtt. Outer Right Sequence: tttcgcactgttttctcgtg. Inner Left Sequence: aagtgaaggaaatgccgaaa. Inner Right Sequence: ccaatgcatctcatcctcct. Inner Primer PCR Length: 2570. Deletion size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1892 F53B1.2(ok2444) X. C. elegans F53B1.2. Homozygous. Outer Left Sequence: ATGCTCTTTTCGCCCCTTAT. Outer Right Sequence: GCTCCAAATGTGGAATGCTT. Inner Left Sequence: GACCTATACCGGCAGATCCA. Inner Right Sequence: TCATGCTTCATACCCTGGCT. Inner Primer PCR Length: 1108 bp. Deletion Size: 383 bp. Deletion left flank: AGAAACGAGCTGAAACTATTTATGCGACGC. Deletion right flank: TGGCCAAGTCGTCAGATGGCACATCAACAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1893 lys-1(ok2445) V. C. elegans Y22F5A.4. Homozygous. Outer Left Sequence: AAAAGGCGATGCTGAGAAGA. Outer Right Sequence: TTGCTGCTGATGTCCTCTTG. Inner Left Sequence: GAGAGCAACGGACAAAAACG. Inner Right Sequence: GCACGGAAGTCATCGAAAGT. Inner Primer PCR Length: 3015 bp. Deletion Size: 1652 bp. Deletion left flank: ATTCTTGATCTTCATTTCTAACTAGAAACC. Deletion right flank: ATTTGGATCTGGAGCATTCGACACAACTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1894 sri-17(ok2446) I. C. elegans F15H9.3. Homozygous. Outer Left Sequence: CGAAGTAGGCAGGAATGAGG. Outer Right Sequence: TGGAGCACATCGAGTGAGAG. Inner Left Sequence: ACGATAGGCTTTTCCAACCA. Inner Right Sequence: TTCTCTGCGCTCTATCACCA. Inner Primer PCR Length: 1300 bp. Deletion Size: 466 bp. Deletion left flank: AAATTCCAGTTCGCAAGTTTTCTGACAGAA. Deletion right flank: GTCTATAATTACGAGTCTAATCAATGGCTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1895 hch-1(ok2447) X. C. elegans F40E10.1. Homozygous. Outer Left Sequence: AGCTTGGGTAGTGGTGGTTG. Outer Right Sequence: AACGCGATGGTTTCCTACTG. Inner Left Sequence: TGTAGATGTGCGAGCGGTAG. Inner Right Sequence: GCCGACTTCGTTAATGGAAA. Inner Primer PCR Length: 3007 bp. Deletion Size: 1611 bp. Deletion left flank: CAAGGCACCTGATGCAGAAATAGTTTGAAT. Deletion right flank: CCTTCGAAAAGATACGGAATTTCATCGGGT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1896 C18H7.2(ok2454) IV. C. elegans C18H7.2 Homozygous. Outer Left Sequence: aaccgcgcaaatgagtagat. Outer Right Sequence: gctccccctacttttgaacc. Inner Left Sequence: attcgggtcattgcttgaaa. Inner Right Sequence: aaggcactgattggttcagc. Inner Primer PCR Length: 3107. Deletion size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1897 clec-50(ok2455) V. C. elegans W04E12.8. Homozygous. Outer Left Sequence: AGTTGTTCGCATCCCTTTTG. Outer Right Sequence: ACACAACCCGGACACCTTTA. Inner Left Sequence: CAAAACCCCTGGATCAACTG. Inner Right Sequence: CATGCTTCTCGCACATTTTG. Inner Primer PCR Length: 3140 bp. Deletion Size: 1880 bp. Deletion left flank: CCTGACCGACCTTGTGCATACCGATCCACG. Deletion right flank: GTGATAACGTTAAAGAATGGTGCCATATAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1898 clec-50(ok2456) V. C. elegans W04E12.8. Homozygous. Outer Left Sequence: AGTTGTTCGCATCCCTTTTG. Outer Right Sequence: ACACAACCCGGACACCTTTA. Inner Left Sequence: CAAAACCCCTGGATCAACTG. Inner Right Sequence: CATGCTTCTCGCACATTTTG. Inner Primer PCR Length: 3140 bp. Deletion Size: 1387 bp. Deletion left flank: AGGCAGTTGTTTGGAGCGGCCGACACGTTC. Deletion right flank: AATTTTTATCACACAGTTTTTGTTTTAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1899 F28F8.2(ok2457) V. C. elegans F28F8.2 Homozygous. Outer Left Sequence: aatggcgttctctgctcagt. Outer Right Sequence: aggcgactatgcgtcatttc. Inner Left Sequence: cacaccaacacacgtaaggg. Inner Right Sequence: catggcaaatacacggaaga. Inner Primer PCR Length: 3079. Deletion size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1900 cwp-4(ok2458) V. C. elegans K11D12.1. Homozygous. Outer Left Sequence: AGGCTCATATTCGGCAACAC. Outer Right Sequence: ATGGCTCCAGTCTTACCCCT. Inner Left Sequence: GATCGTCGCCTAGAGACTGG. Inner Right Sequence: TCTTCTCCACGCATAATGGA. Inner Primer PCR Length: 3283 bp. Deletion Size: 1550 bp. Deletion left flank: CGCGGACACTGAGCAAGCGAACAACACCAA. Deletion right flank: GGAGGAAAAATTGACACATATAACTAACTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1901 C42C1.10(ok2459) IV. C. elegans C42C1.10 Homozygous. Outer Left Sequence: acgacttccaattgcattcc. Outer Right Sequence: acttccacatccaagaaccg. Inner Left Sequence: ctcacaaattcgaacggaaa. Inner Right Sequence: gcatcgtcaaaccactgaaa. Inner Primer PCR Length: 3301. Deletion size: about 2900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1902 flp-19(ok2460) X. C. elegans M79.4. Homozygous. Outer Left Sequence: CGAGAACTGAAACAAACGCA. Outer Right Sequence: TGATTTGATGTGCGCAATTT. Inner Left Sequence: AACCCACACCTCAACTTTCG. Inner Right Sequence: ATTGAACCATGTCTGACCGT. Inner Primer PCR Length: 1138 bp. Deletion Size: 505 bp. Deletion left flank: TTCAAATATCATCACTTTCTTATTTTCCGG. Deletion right flank: TATTTCAGGGCAACCAATTCAGTCACAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1903 flp-19(ok2461) X. C. elegans M79.4. Homozygous. Outer Left Sequence: CGAGAACTGAAACAAACGCA. Outer Right Sequence: TGATTTGATGTGCGCAATTT. Inner Left Sequence: AACCCACACCTCAACTTTCG. Inner Right Sequence: ATTGAACCATGTCTGACCGT. Inner Primer PCR Length: 1139 bp. Deletion Size: 268 bp. Deletion left flank: GAGTTTATTTTTTATTAACAATTATCTTTG. Deletion right flank: AACAAAAACCCAACTAATTTTGTGTGTTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1904 tag-266(ok2462) III. C. elegans W06E11.5. Homozygous. Outer Left Sequence: GCTCTTTTTCCGACACTTGC. Outer Right Sequence: CCTCGTCGTTTGACCATTTT. Inner Left Sequence: TCTCCTTTGTCGAGAATCTGAA. Inner Right Sequence: TCATGTCAGCCACACCATTT. Inner Primer PCR Length: 3192 bp. Deletion Size: 1425 bp. Deletion left flank: AAAGTAGATATATTTTTCAAAATTTTAAAG. Deletion right flank: TTGAAAATGTTTTAGAAAATTCATAAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1905 hse-5(ok2463) III. C. elegans B0285.5. Homozygous. Outer Left Sequence: AAAAGTATCGGGAGTTGGGG. Outer Right Sequence: TTATGTTTTGCCCGTTTTCC. Inner Left Sequence: CCAGAGTCTTTTTGTGGCGT. Inner Right Sequence: AGTTCCCAAAGCAACGTGAC. Inner Primer PCR Length: 3193 bp. Deletion Size: 1427 bp. Deletion left flank: AAAAGATGGTTCAACATTTGAATTATACAC. Deletion right flank: ACCAAAAAATCGACAGCCCTGATCAGGCTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1906 mes-1(ok2467) X. C. elegans F54F7.5. Homozygous. Outer Left Sequence: CAGAAACCATTTCCCTCGAA. Outer Right Sequence: CTGAAGACACTTGCTCAGCG. Inner Left Sequence: CCACAGTCGAAGGTTTGGAT. Inner Right Sequence: TGGCAAAAGAATCATGGTCA. Inner Primer PCR Length: 3220 bp. Deletion Size: 1722 bp. Deletion left flank: GGCACAATATCAATCAGATTCTGACAAAAA. Deletion right flank: CGGTACGTGATTTAGTTGTTTTTTTTTCTC. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1907 K03E5.1(ok2468) I. C. elegans K03E5.1. Homozygous. Outer Left Sequence: TTAGCGAGGGTCGAAGACAT. Outer Right Sequence: AAAATCTGACAAACGTGCCC. Inner Left Sequence: TTTAGCTTTGCACACGATGC. Inner Right Sequence: TTTCCTAACGAGACCCAACG. Inner Primer PCR Length: 2967 bp. Deletion Size: 1739 bp. Deletion left flank: TTGGGTGCGAAATCCGTGGCCTAATTTTCT. Deletion right flank: TAGTTTGATGAATACACCAGATTTGACGTG. Insertion Sequence: CT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1908 mlk-1(ok2471) V. C. elegans K11D12.10. Homozygous. Outer Left Sequence: CAGCCACTGCTCTTTCATCA. Outer Right Sequence: TGGCAACCCCAAGAAAAATA. Inner Left Sequence: TTTGAGTCTCGCTTGTTCCA. Inner Right Sequence: TTTCTATGCGGTGCATTTCA. Inner Primer PCR Length: 3205 bp. Deletion Size: 2971 bp. Deletion left flank: CTCATCGGCATTGTCGACTGAAAGTTTATT. Deletion right flank: ATTAGCTCAATTTTTTGCAAAACTAACTTG. Insertion Sequence: CATGATCTTTATGCGGGAAGTGGTGATATAAATCGAAAAAATCGGCATTCCATCGCGCC GGAAACCAAAGCAAGACGGTTAAAGCATCATAAACCAAAAAAAGCCGACATAACGGGTC CGACAGAAGTGAAACATATATTGTCTGTGCAAAAGGATGATAAAAATTTTAGAGTTAAA AGTAAGTTATATGGTTTAATATTCAATAAAATTGAAAGTTTTTTTGCATGCGTCATTTG GTATAGTAGAAACAATAATTTGAAATAAATATTAAACGTAAAATCAAGATTGCATGCTA GGGTTTCCATGGTAGGCAGGCGTGACCTAGTGCCTGCCTGAAAACTGCCGACCACATGC CTCTTTTCTACATTTTGGCAGAAATTTCAGGCAGGCGTTTTGGCGCCTACATGGAAGCC CAATAGCATGCAATTGTTCGTTCCGTTTACTTCTCATATGAAACTTATCTGCTAAATTA ATATTAACATAGGATATTTTTGAGTCGAAAACAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1909 gcy-19(ok2472) II. C. elegans C17F4.6. Homozygous. Outer Left Sequence: AATATCTCGGGCTTTTGCCT. Outer Right Sequence: AAAACGTCTGGAACGTGACC. Inner Left Sequence: AAATTTCACAGCACCGGAAC. Inner Right Sequence: AATAGATGCGGAATGGCAAA. Inner Primer PCR Length: 3073 bp. Deletion Size: 1376 bp. Deletion left flank: TTACTTAATATGAGCATTTCCATTTTTCGA. Deletion right flank: CTGGCGACGTTTCATGGGCTTCTTCTCCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1910 tbx-9(ok2473) III. C. elegans T07C4.6 Homozygous. Outer Left Sequence: ttcaattttccagtcgaccc. Outer Right Sequence: caacattttcggaccgtctt. Inner Left Sequence: gtttgcttgtttggaaggga. Inner Right Sequence: gaggtgagatggggtgaaga. Inner Primer PCR Length: 3003. Deletion size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1911 ins-27(ok2474) I. C. elegans ZC334.11. Homozygous. Outer Left Sequence: TGTTCAAAACGCACTTGGAG. Outer Right Sequence: TCAAAGCCCCATAACTTTGC. Inner Left Sequence: ATATTACCGCTGGTTGCTCC. Inner Right Sequence: CAAGCTTCAGCGCATAAACA. Inner Primer PCR Length: 1324 bp. Deletion Size: 461 bp. Deletion left flank: TCTACGTAGATCAAACCGACATGGGACAGC. Deletion right flank: AACTGATGAGAATAAAACAATTGTTAAGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1912 W05H7.3(ok2485) X. C. elegans W05H7.3 Homozygous. Outer Left Sequence: cttttcaaccggttttgcat. Outer Right Sequence: cgactaagagagcccgtgtc. Inner Left Sequence: ttcctgtgagaaaaatcccg. Inner Right Sequence: gatgagccaagcttagtggc. Inner Primer PCR Length: 2915. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1913 msh-2(ok2486) I. C. elegans H26D21.2. Homozygous. Outer Left Sequence: ACCATTTTGGCAACTTGGAG. Outer Right Sequence: GCGAAACCAATTCACCGTAT. Inner Left Sequence: CAACTCCCTCGAAAACCTTG. Inner Right Sequence: TCCCTGCAGGACCATTTTAC. Inner Primer PCR Length: 3099 bp. Deletion Size: 1772 bp. Deletion left flank: CCCGGCTGTTCAGCGAGTTTTCCCATCTCA. Deletion right flank: AATTATTCGATTTCTCTGAAATTAAATTAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1914 aqp-9(ok2487) I. C. elegans K07A1.16 Homozygous. Outer Left Sequence: gggaaaatcttgcgtttgaa. Outer Right Sequence: ctggacggaagattgtggat. Inner Left Sequence: cccacaaactctactccccc. Inner Right Sequence: tttaaaagctcaaactcaagaacc. Inner Primer PCR Length: 1134. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1915 ins-3(ok2488) II. C. elegans ZK75.3. Homozygous. Outer Left Sequence: GTCCCACTTCGATGCAATTT. Outer Right Sequence: GGAGGCTCTTTACTCGCCTT. Inner Left Sequence: CTATTGCACAACAACACCCG. Inner Right Sequence: TTCTTCCCTGTCTGCCATTT. Inner Primer PCR Length: 3189 bp. Deletion Size: 1449 bp. Deletion left flank: ACTATCATTAACTTTTCAAAATGTTAGTTT. Deletion right flank: AATAATGAAAAGTGCAAGAACAACGGAGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1916 pgp-8(ok2489) X. C. elegans T21E8.3 Homozygous. Outer Left Sequence: atccagagcacttgtcgctt. Outer Right Sequence: ggaagtgtttttgctttcgg. Inner Left Sequence: ttgaccaccagacagctgag. Inner Right Sequence: ggacaaacccaggaacttga. Inner Primer PCR Length: 3296. Deletion size: about 2100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1917 dnj-28(ok2490) I. C. elegans Y54E10BL.4. Homozygous. Outer Left Sequence: AAAACCGAGGCACAAAGAGA. Outer Right Sequence: AATCGATGTTCAATCGCTCC. Inner Left Sequence: CCGGAAATGCGTTATTTGTC. Inner Right Sequence: GTTAGGTATTTCGCGCCCTT. Inner Primer PCR Length: 3131 bp. Deletion Size: 2116 bp. Deletion left flank: AGTTAGACAGTAATTTCAAAAAAGTTAGTT. Deletion right flank: ATATGGCAGACGAGGAGTATGATATGGGTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1918 sedl-1(ok2497) X. C. elegans W05H7.3. Homozygous. Outer Left Sequence: CTTTTCAACCGGTTTTGCAT. Outer Right Sequence: CGACTAAGAGAGCCCGTGTC. Inner Left Sequence: TTCCTGTGAGAAAAATCCCG. Inner Right Sequence: GATGAGCCAAGCTTAGTGGC. Inner Primer PCR Length: 2915 bp. Deletion Size: 1236 bp. Deletion left flank: AAACTAAATTCAGAAAATATTTTTGGCTTC. Deletion right flank: TATTCAGAAATCAACTGGGCTGATGATACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1919 W07E6.3(ok2498) II. C. elegans W07E6.3 Homozygous. Outer Left Sequence: caccagatctcacgacgaaa. Outer Right Sequence: ccgttttcgaaattaagcca. Inner Left Sequence: gaaaaatccgattctggggt. Inner Right Sequence: aaatttcttcgggcacgtta. Inner Primer PCR Length: 3191. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1920 mig-10(ok2499) III. C. elegans F10E9.6. Homozygous. Outer Left Sequence: AACACATGGCATTGCAAAAA. Outer Right Sequence: GCAACAGAAGGTGTACGCTG. Inner Left Sequence: TGATATCCGGACAGAGAGGG. Inner Right Sequence: CCAAGGAGTCGGTGATTTGT. Inner Primer PCR Length: 3015 bp. Deletion Size: 2263 bp. Deletion left flank: ACCCACATACCTTATACTTTATCCGAAAAT. Deletion right flank: GTGCTTGAGATATCAATCTAGATGGTTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1921 clc-1(ok2500) X. C. elegans C09F12.1 Homozygous. Outer Left Sequence: gcacgttgccattccttatt. Outer Right Sequence: catccccgagaggtccttat. Inner Left Sequence: ttgcatagatgccaccatgt. Inner Right Sequence: atctttaacccatccgcctt. Inner Primer PCR Length: 2240. Deletion size: about 1200 bp. [NOTE (05/02/2019): VC has reported their stock of RB1921 is heterozygous; will send verified homozygous replacement. Not known if stock available through CGC prior to May 2019 is homozygous.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1922 F46H5.4(ok2501) X. C. elegans F46H5.4. Homozygous. Outer Left Sequence: AAACGCAACTCGGAAAAATG. Outer Right Sequence: CTACACGAATGCTTGCTGGA. Inner Left Sequence: TCAATTCCTGGTAATGGTGAGA. Inner Right Sequence: TGTTTCTCTGGTTCATTCATGG. Inner Primer PCR Length: 3072 bp. Deletion Size: 2420 bp. Deletion left flank: GTTCAGCCATGTTAAGAAGCCAAGTTATTC. Deletion right flank: ATGATTTGAGCTGAATGTAGCAGATTTCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1923 ckr-1(ok2502) I. C. elegans T23B3.4. Homozygous. Outer Left Sequence: TTTCAAAAACCCTGGTACGG. Outer Right Sequence: AAATCGCCATTGAAATACGC. Inner Left Sequence: TGAGTTGGAGATGAAGGGCT. Inner Right Sequence: GATCCTCACAATCCTCGGAA. Inner Primer PCR Length: 2705 bp. Deletion Size: 1289 bp. Deletion left flank: CTTTGGAATTGGATGTCTAGTTTTTTTAGT. Deletion right flank: CAGTGGGGAGCTGAGATAAAAACAGAATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1924 F45H10.4(ok2503) II. C. elegans F45H10.4 Homozygous. Outer Left Sequence: aacgaacgagttcaattggc. Outer Right Sequence: ggccaccgatttttcctatt. Inner Left Sequence: taaagcaatttccccacagg. Inner Right Sequence: ttacggccacatagcaaaaa. Inner Primer PCR Length: 3175. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1925 C49G9.1(ok2504) I. C. elegans C49G9.1. Homozygous. Outer Left Sequence: TTTTAAGCCATAACACCCGC. Outer Right Sequence: ATGCATCGACGAATACACCA. Inner Left Sequence: CCAGGAAATTGTCAACACGA. Inner Right Sequence: ATCCCTTCCTCCACATCTCA. Inner Primer PCR Length: 1210 bp. Deletion Size: 385 bp. Deletion left flank: TAAGGATTTGATAATTTCATGAAAATTAAA. Deletion right flank: ATCCAAATTTTTTTTTTCCAAAATTTTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1926 T02G5.3&mmaa-1(ok2512) II. C. elegans T02G5.1, T02G5.13. Homozygous. Outer Left Sequence: TGATTGGTGCACTGGTCATT. Outer Right Sequence: AATCACGATACCTTGGACGC. Inner Left Sequence: TCGTTTCGAAATTCGTCCTC. Inner Right Sequence: ATGCCTGGTGACGACTACCT. Inner Primer PCR Length: 2798 bp. Deletion Size: 1381 bp. Deletion left flank: GTTTATACTCTGGAAAAAGTTACAAAATCA. Deletion right flank: GTGGGATCAATTGTTAAAACTGCAACTTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1927 C38D4.4(ok2513) III. C. elegans C38D4.4. Homozygous. Outer Left Sequence: ACAAGAGGTGGAAGAGCCAA. Outer Right Sequence: CTATCCTTATCCGACGGCAA. Inner Left Sequence: AAGAAACGGCTGCGGTAATA. Inner Right Sequence: TGATAGCTTCTAGACACTCATTATC. Inner Primer PCR Length: 3063 bp. Deletion Size: 1751 bp. Deletion left flank: TATTTGTCCTTATTTATTTTATTATTTGAA. Deletion right flank: AATTGACCGAAATCTACGATAAGCATTTCG. Insertion Sequence: CCGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1928 exoc-8(ok2523) I. C. elegans Y105E8B.2. Homozygous. Outer Left Sequence: CTACCGACTGAGCTATCCGC. Outer Right Sequence: AAATTTCATGGCGTTTTTGG. Inner Left Sequence: TTTCGCAAAATGCACAACAT. Inner Right Sequence: GCCCCAGTCAACGTTAAAGA. Inner Primer PCR Length: 2583 bp. Deletion Size: 1474 bp. Deletion left flank: TTAAAAATGAACAAATTTTTTGGAAAATCT. Deletion right flank: TCACAGTTTGCCGTTTTCCTCGAATAGTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1929 inx-21(ok2524) I. C. elegans Y47G6A.1. Homozygous. Outer Left Sequence: AAAGTGGCACCGAGAAGTTG. Outer Right Sequence: TCAACGAACTCGAATCATCG. Inner Left Sequence: CTCGCCTCAAAACCAATGTT. Inner Right Sequence: CGTCGATACTGTGGAACGAG. Inner Primer PCR Length: 3086 bp. Deletion Size: 1960 bp. Deletion left flank: ATATTATGGGGACGCAGAAAAATTCGCATT. Deletion right flank: CTAATTTTGTTTATATTGATGAGAAAACAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1930 spr-3(ok2525) X. C. elegans C07A12.5. Homozygous. Outer Left Sequence: CCCATTTTCAAATTCCATCG. Outer Right Sequence: GCAAGCATCAAAACTGACGA. Inner Left Sequence: GCGAAAAGAGTGCGGTCTAC. Inner Right Sequence: GATGGGAAGGGAAGGGAATA. Inner Primer PCR Length: 2752 bp. Deletion Size: 595 bp. Deletion left flank: CCGCCAGTTTTGGAAGTGTAGTACTCGCAT. Deletion right flank: GTCTACCATATTTTGTCACACCGTGTCAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1931 feh-1&nhr-239(ok2526) III. C. elegans Y54F10AM.1, Y54F10AM.2. Homozygous. Outer Left Sequence: ACAACATCCACCATCCACCT. Outer Right Sequence: ATAACCTTATGCCCAAGCCA. Inner Left Sequence: TTTTCAGATTCTAGGCCGTCA. Inner Right Sequence: GAGCCTAAGCCTAAGCCCAC. Inner Primer PCR Length: 3094 bp. Deletion Size: 2350 bp. Deletion left flank: CAAATTAGACTTAGGCTTTAAATTGTTTGT. Deletion right flank: AAACCGGCAAATTGATTTGCCGAATTTGCC. Insertion Sequence: TTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1932 ZK418.8(ok2535) III. C. elegans ZK418.8 Homozygous. Outer Left Sequence: aaaaccggtgaagtttgagg. Outer Right Sequence: catttgcgaaatgggaaagt. Inner Left Sequence: ttttcgagctacaacgacttttt. Inner Right Sequence: attgcgagcccatttgttat. Inner Primer PCR Length: 3125. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1933 F56D12.5(ok2536) II. C. elegans F56D12.5 Homozygous. Outer Left Sequence: aatatcgcaacggtgtctgg. Outer Right Sequence: tctagcagaccaatttgggg. Inner Left Sequence: gttcttgcaggtatccccat. Inner Right Sequence: cagcagcacaattcattcaaa. Inner Primer PCR Length: 3037. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1934 W07B8.4(ok2537) V. C. elegans W07B8.4 Homozygous. Outer Left Sequence: caatggggtttcaaagcaat. Outer Right Sequence: gccgattttcagttagcctg. Inner Left Sequence: catgtattcctcgggattcg. Inner Right Sequence: ttcgctctgattcacttcca. Inner Primer PCR Length: 3069. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1935 gcy-20(ok2538) V. C. elegans F21H7.9. Homozygous. Outer Left Sequence: TTGCGACAGCGTATTTTCTG. Outer Right Sequence: TTCGAATTTTCGACCAAAGC. Inner Left Sequence: ACCAGACTCACCTTGGCAAC. Inner Right Sequence: GCTCTGAAAGTCTCGCTGCT. Inner Primer PCR Length: 3244 bp. Deletion Size: 1321 bp. Deletion left flank: GGTCATTTTGGTGGAAGTTGAGGGGCCACT. Deletion right flank: TGAGTGTCTGATTCTATGGTCTTTAATTAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1936 M28.4(ok2539) II. C. elegans M28.4 Homozygous. Outer Left Sequence: agcgattccaaaatcactgg. Outer Right Sequence: tgcctggtaggcagaaaagt. Inner Left Sequence: cgctggattgttggttatca. Inner Right Sequence: gtcattggaattggaggtgg. Inner Primer PCR Length: 3023. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1937 rgs-7(ok2540) X. C. elegans F56B6.2. Homozygous. Outer Left Sequence: ACAGCGCAAGGTAGGTCAAT. Outer Right Sequence: ATCCCCAACAAAATTGGTCA. Inner Left Sequence: GAGTGTCGTCTGCTGGTTCA. Inner Right Sequence: CAGTTTCTCACCTCATCGCA. Inner Primer PCR Length: 3326 bp. Deletion Size: 1491 bp. Deletion left flank: CGTTGCCTTTCATTGCCCACGCACCCGCTA. Deletion right flank: CAGATTCAATGTTGAACACTTATCTGAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1938 Y116A8B.5(ok2541) IV. C. elegans Y116A8B.5 Homozygous. Outer Left Sequence: aaaataccggcgtcactgtc. Outer Right Sequence: atggctatttggagtggcaa. Inner Left Sequence: agctgaagcgtcagaaggac. Inner Right Sequence: ggtttggggaaagtgtcaac. Inner Primer PCR Length: 3290. Deletion size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1939 C50A2.2(ok2542) IV. C. elegans C50A2.2. Homozygous. Outer Left Sequence: AAAATCGTCGTCGAAACCTG. Outer Right Sequence: CTGACGCAAAATTGCAGAAA. Inner Left Sequence: ACAACGAACCGAGCCGAT. Inner Right Sequence: GTGCGTATTGGGAAGGTAGC. Inner Primer PCR Length: 3005 bp. Deletion Size: 1982 bp. Deletion left flank: ATTTAGTGTGACTAGGTTACTGTAGCACCA. Deletion right flank: CGTCAGATTGTGTTTACCAACAAAAAAAAT. Insertion Sequence: GACTTTTTTCTGCAATTTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1940 F55D12.5(ok2543) I. C. elegans F55D12.5 Homozygous. Outer Left Sequence: accatttgcctgttctcctg. Outer Right Sequence: actacaacagcaacccgtcc. Inner Left Sequence: aatcgcactcaggttgttga. Inner Right Sequence: tccaaccacaactaccacg. Inner Primer PCR Length: 1181. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1941 rbr-2(ok2544) IV. C. elegans ZK593.4. Homozygous. Outer Left Sequence: GAGGGGAAGATGAGTGTCCA. Outer Right Sequence: GCATGTCAGTGTTGATTCGG. Inner Left Sequence: TGCGTTGCTTGTAATGAAGG. Inner Right Sequence: TGAGCATGCTTCAAGACCAC. Inner Primer PCR Length: 3298 bp. Deletion Size: 1311 bp. Deletion left flank: CGAGTCGAGTAGGAAGTGGATTTCCTCGAA. Deletion right flank: GAGCAAAAGATGCTATCTATCGAGAACAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1942 ace-2(ok2545) I. C. elegans Y44E3A.2. Homozygous. Outer Left Sequence: GATGCGGATTTTCGAGTTGT. Outer Right Sequence: ACTTGCCTGCCTAGCAGTGT. Inner Left Sequence: ATGATTCGATGCTTCCCTTG. Inner Right Sequence: ATTCATGAGCACCGATCTCC. Inner Primer PCR Length: 3182 bp. Deletion Size: 1470 bp. Deletion left flank: TCAGCAAAATCAATAAGAGAGCAAGTAAAA. Deletion right flank: GTGTTAGAGAGTGATAATTGGAAAATTGAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1943 Y11D7A.8(ok2550) IV. C. elegans Y11D7A.8. Homozygous. Outer Left Sequence: ACGTTATGTCAGATTGCCCC. Outer Right Sequence: CAGAATGAGCCAAACAAGCA. Inner Left Sequence: CCACGATGCCACTAAAAGGT. Inner Right Sequence: AGTCTTTCCATCCGATTCCA. Inner Primer PCR Length: 2844 bp. Deletion Size: 1143 bp. Deletion left flank: ACATCTTTCATTTAATGTTTCGGAATTGCA. Deletion right flank: TTTCATCTATAATTTCAGCATATAGGAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1944 M01E5.2(ok2552) I. C. elegans ok2552. Homozygous. Outer Left Sequence: CAAAGATTGTGGCGGAAAAT. Outer Right Sequence: CGGTAGCTGATTTTCGTGGT. Inner Left Sequence: GTTACACCTTTTCCTGGCGA. Inner Right Sequence: CTAAAATTCTGCGGAAACCG. Inner Primer PCR Length: 2997 bp. Deletion Size: 2279 bp. Deletion left flank: ATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAA AATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAA AAATAGATTGTTACACGAAAAAATAGATTGTTAC. Deletion right flank: CAAAAAACTGTGAAAATTCACTTCAACTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1945 C10F3.7&fut-8(ok2558) V. C. elegans C10F3.6, C10F3.7. Homozygous. Outer Left Sequence: CAGTCAAAGGTGGCAACTCA. Outer Right Sequence: CGAAAATTGAAGCCCATTTG. Inner Left Sequence: TTGGTGCGAGAAGAACACAG. Inner Right Sequence: CATCAACTCCCACCAAATCC. Inner Primer PCR Length: 2789 bp. Deletion Size: 2239 bp. Deletion left flank: TCTCTACCGTTCATATACTTACCCCATCGA. Deletion right flank: GTAGCAAATGCGGTAATTGCACAATAGGTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1946 C30F12.7(ok2559) I. C. elegans C30F12.7. Homozygous. Outer Left Sequence: GGGTGTTCTTGCACCTGAAT. Outer Right Sequence: TTTGAATTTCCTTTGCCCTG. Inner Left Sequence: AGATGTTCATGAAAACGCCC. Inner Right Sequence: GATTGGTCATGGGGCTCTAA. Inner Primer PCR Length: 2691 bp. Deletion Size: 2003 bp. Deletion left flank: TAGGTTCCCATGCTTGAAAATATAAAGTCT. Deletion right flank: TGTGGGTTTATAAAACTTAATGAAAAACGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1947 Y106G6A.2(ok2561) I. C. elegans Y106G6A.2. Homozygous. Outer Left Sequence: TTCGGCTGACATGAAGACTG. Outer Right Sequence: CTTCAACAGCAAATGCCTGA. Inner Left Sequence: CGAAGGGTATGGGGAGAAAT. Inner Right Sequence: GGGGAACGAAACCCATAAGT. Inner Primer PCR Length: 2400 bp. Deletion Size: 1281 bp. Deletion left flank: GTGCGCCTTTAGAGTACTTTAGTTTCAAAC. Deletion right flank: AACCGGGTTATTGTCGATTCAATATTCATG. [NOTE (11-18-2015) A user has reported that this strain was heterozygous for ok2561 by PCR analysis.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1949 tra-2(ok2563) II. C. elegans C15F1.3 Homozygous. Outer Left Sequence: aaccagaaaagtcgccttga. Outer Right Sequence: tccacatcaagcatccagaa. Inner Left Sequence: ttggtgtgatggcaaagatg. Inner Right Sequence: atgcattcctgcgattcttc. Inner Primer PCR Length: 3370. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1950 F38A6.3(ok2564) V. C. elegans F38A6.3 Homozygous. Outer Left Sequence: aatcttgacgtcctctggga. Outer Right Sequence: acggaggtatgaggacaacg. Inner Left Sequence: tggaagacaatcggaaaagg. Inner Right Sequence: taaatcggagccagatccac. Inner Primer PCR Length: 2977. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1951 gcc-1(ok2565) X. C. elegans C15C7.2 Homozygous. Outer Left Sequence: ttaaaaatgctgagggtggc. Outer Right Sequence: caatgggcaaagacgagaat. Inner Left Sequence: tggcaaatatcattgcagga. Inner Right Sequence: cggtgacgagagagtcacaa. Inner Primer PCR Length: 2903. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1952 B0207.10(ok2568) I. C. elegans B0207.10 Homozygous. Outer Left Sequence: agtgatatgtgatgtggccg. Outer Right Sequence: accgtaaccccctttttcac. Inner Left Sequence: ttggcgagaacgttcaataa. Inner Right Sequence: tgtgttctctgtccccacaa. Inner Primer PCR Length: 1200. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1953 lec-7(ok2569) X. C. elegans R07B1.2 Homozygous. Outer Left Sequence: accctaaacgacattcgcac. Outer Right Sequence: aactatgcatgtgcatccca. Inner Left Sequence: aaacatctcaaaaatgcccg. Inner Right Sequence: gctcacgctaccatttcctc. Inner Primer PCR Length: 2100. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1954 Y48E1B.13(ok2570) II. C. elegans Y48E1B.13 Homozygous. Outer Left Sequence: ttcattttcacggccacata. Outer Right Sequence: tgaaaagtgccattgtttgg. Inner Left Sequence: tatgcagttttccaacgacg. Inner Right Sequence: atataccatgtgcccgcttc. Inner Primer PCR Length: 2793. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1955 T27A3.6(ok2571) I. C. elegans T27A3.6 Homozygous. Outer Left Sequence: atgtgggaattggcgataaa. Outer Right Sequence: tccggttcactgacttttcc. Inner Left Sequence: ggttgtatctacgggagcca. Inner Right Sequence: ttgcatttttctagccgctt. Inner Primer PCR Length: 2177. Deletion size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1956 C47B2.7(ok2572) I. C. elegans C47B2.7 Homozygous. Outer Left Sequence: ttggcgcgaaattacttttt. Outer Right Sequence: ttggaagctaaaaagccgac. Inner Left Sequence: caatatttagcgcgaaaccaa. Inner Right Sequence: aaaaaggctccaaaccttga. Inner Primer PCR Length: 1183. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1957 W03G11.2(ok2574) X. C. elegans W03G11.2 Homozygous. Outer Left Sequence: aacccaagatggatgcaaaa. Outer Right Sequence: tctgtggagcatcaggatca. Inner Left Sequence: tcttcatcgggtatgtgcttt. Inner Right Sequence: atcccagtggttttgacgtg. Inner Primer PCR Length: 3140. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1958 T07D4.1(ok2575) II. C. elegans T07D4.1. Homozygous. Outer Left Sequence: TTGGTTGGATCAGAAAGTGATG. Outer Right Sequence: GATTGCATGGTAAGACAGTGGA. Inner Left Sequence: ACCATTACGAATAGCATTGGCT. Inner Right Sequence: TTGTTCTGCTCTCGACATGTTT. Inner Primer PCR Length: 2673 bp. Deletion Size: 1767 bp. Deletion left flank: GTACAAGTGTTTGAAAAACCCTATAAGTAG. Deletion right flank: TTTTAACATCCACTTCACTTTGATTCCTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1959 F35H12.2(ok2576) X. C. elegans F35H12.2 Homozygous. Outer Left Sequence: cccaacaccttcagtcaggt. Outer Right Sequence: acctccatcctcaacacagg. Inner Left Sequence: ggaatactgggttttccgct. Inner Right Sequence: ggaagggacacacggaagta. Inner Primer PCR Length: 3288. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1960 F42A8.1(ok2579) II. C. elegans F42A8.1 Homozygous. Outer Left Sequence: caacgtgattatttgccacg. Outer Right Sequence: ttccaaacccaatttgaacc. Inner Left Sequence: tccagacgtattcctttccaa. Inner Right Sequence: aaatcaacttgtccaagggc. Inner Primer PCR Length: 1291. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1961 C06G3.7(ok2580) IV. C. elegans C06G3.7 Homozygous. Outer Left Sequence: gccgagacaacaagaaggtt. Outer Right Sequence: tcatacatcacacgacgcaa. Inner Left Sequence: tcgatttttcacagaaattgttaag. Inner Right Sequence: gagaaaaaccaaagagcagca. Inner Primer PCR Length: 3009. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1962 mlt-10(ok2581) II. C. elegans C09E8.3. Homozygous. Outer Left Sequence: AGGTTAAATTCCGAGTCGCC. Outer Right Sequence: TTTAGGTCGCTACTCAGCGG. Inner Left Sequence: AGGCAGAGATGGAAGACGAG. Inner Right Sequence: AAAATGCGGTTTATTGAACTGA. Inner Primer PCR Length: 3023 bp. Deletion Size: 1771 bp. Deletion left flank: CCACAAATCTCCCAGTACAAAGTACAAATT. Deletion right flank: TCCGAGTTGCTCGCCGAGCCGACATCGTCT. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1963 col-61(ok2582) I. C. elegans C01H6.1. Homozygous. Outer Left Sequence: CATTTTGTCCCTTCTTCCGA. Outer Right Sequence: ATTAAACGTGGCAAAGCACC. Inner Left Sequence: GAAGGTGTCTTCCTCCCCTC. Inner Right Sequence: AAATTGTGGCCAACTTCCAG. Inner Primer PCR Length: 2583 bp. Deletion Size: 1697 bp. Deletion left flank: AGTGAATTCAGTGTCCCAATGGAACGAGAA. Deletion right flank: GAGCCCATCCATAACGTGACGAAACAAAGG. Insertion Sequence: GCTCGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1964 K04G2(ok2584) I. C. elegans K04G2. Homozygous. Outer Left Sequence: AGGGGAAACAATGCATTCAG. Outer Right Sequence: CCAACAAGACAAGAATCGCA. Inner Left Sequence: TGAGAGTGAGAAGGACATGGAA. Inner Right Sequence: TGTGGAGCTCACGAAACACT. Inner Primer PCR Length: 1099 bp. Deletion Size: 387 bp. Deletion left flank: AATTGTTTTAAATCAGTTAAGCAAGCAGGT. Deletion right flank: GAAAAGTAGTCAAATACTTTATTTTACAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1965 Y105E8A.12(ok2585) I. C. elegans Y105E8A.12 Homozygous. Outer Left Sequence: cccgatcatcccaagattta. Outer Right Sequence: gctccaatgcgaatttgttt. Inner Left Sequence: ccaaatttgtactcgacccg. Inner Right Sequence: catcgattttgggaatcagg. Inner Primer PCR Length: 3158. Deletion size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1966 R11A5.4(ok2586) I. C. elegans R11A5.4. Homozygous. Outer Left Sequence: TGGGGGATCAAGTCAAGGTA. Outer Right Sequence: GGATCCCGAATGCAGAGATA. Inner Left Sequence: TGGGTTAGGAGTTGGTGGAG. Inner Right Sequence: ACGTCGTTCATCAAACGTCA. Inner Primer PCR Length: 2625 bp. Deletion Size: 1961 bp. Deletion left flank: ATAATTTTTTTCAGGGAGACTTCCATCTTC. Deletion right flank: ATTTTTTATTTGAAACGCATCTATTGTTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1967 aqp-4(ok2587) V. C. elegans F40F9.9. Homozygous. Outer Left Sequence: TTTAAATACTTCCCCGCACG. Outer Right Sequence: GTTCCAGCACAATCACATGG. Inner Left Sequence: GTTTGTGCTTTGCTCAACGA. Inner Right Sequence: TTGCCAAAGACAACGAACTG. Inner Primer PCR Length: 2660 bp. Deletion Size: 1180 bp. Deletion left flank: GACCTAAAACACTGTTCTATTTCACACTTT. Deletion right flank: AGGCTCCTTTTACAGTCACACGTATGGGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1968 C23H3.5(ok2588) II. C. elegans C23H3.5. Homozygous. Outer Left Sequence: AGCCCAAGCCAATTATCCTT. Outer Right Sequence: AACACGAACTTTGAATCGCC. Inner Left Sequence: TGGACATGTCAGATTTGGGA. Inner Right Sequence: TAATCTTGGGAAGTGGGCAA. Inner Primer PCR Length: 3031 bp. Deletion Size: 1218 bp. Deletion left flank: TTTTAGGTCAATCCTGTTCATCAATACCTG. Deletion right flank: TTGTCGGAAAATATCAATTCCGGCAATTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1969 C32B5.13(ok2589) II. C. elegans C32B5.13. Homozygous. Outer Left Sequence: CTCACCTGAGCCGTTCTTTC. Outer Right Sequence: GTCCGGCCACATACAAGAGT. Inner Left Sequence: AAACTTGCTCTCAGTTGCCC. Inner Right Sequence: GGACCGAAGACGTCTCAAAC. Inner Primer PCR Length: 2981 bp. Deletion Size: 1120 bp. Deletion left flank: TTCAACCAAAATATATCTTACAAGCCCATA. Deletion right flank: GCATAGGATGCATTGCACTATCCCTGATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1970 F33D11.10(ok2590) I. C. elegans F33D11.10. Homozygous. Outer Left Sequence: CATTTCGTCGATTTGTGTCG. Outer Right Sequence: TTTTCGCCGTATTATCTCGG. Inner Left Sequence: ACAAAGTTGATGGCGACTCC. Inner Right Sequence: GGAAATTTACGCGACTCGAC. Inner Primer PCR Length: 1348 bp. Deletion Size: 583 bp. Deletion left flank: AGAATAGTACAGCCTGTGTGATGGTAAGAG. Deletion right flank: GGAAATTGAAAAAGTCGCAGTCTTTCCGGT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1971 F57F4.4(ok2599) V. C. elegans F57F4.4 Homozygous. Outer Left Sequence: acagcagcatccggtaattc. Outer Right Sequence: aggactttgcgacagcatct. Inner Left Sequence: tgttcaaattacggcaaacg. Inner Right Sequence: acggagctctcttgtacgga. Inner Primer PCR Length: 3086. Deletion size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1972 F21F3.1(ok2600) I. C. elegans F21F3.1. Homozygous. Outer Left Sequence: TCTCCACATCCTCATCTCCC. Outer Right Sequence: CGGTGGCCTAGAAAAACAAA. Inner Left Sequence: CGTTGAAAATGTATGAGCCG. Inner Right Sequence: TGGAGGTGCAGGTTCTACAG. Inner Primer PCR Length: 1269 bp. Deletion Size: 572 bp. Deletion left flank: GTGTTTTTTGTGTGTGAGTGTGTGTGTGTG. Deletion right flank: GACTATTCAACCCCAGCAAAGAAATCGGTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1973 W04A4.4(ok2601) I. C. elegans W04A4.4. Homozygous. Outer Left Sequence: AAGTAACATGCTCATCCCCG. Outer Right Sequence: TTGAATGCATGAGTTGCTCC. Inner Left Sequence: TTTGTTCCCCTATTCGCATC. Inner Right Sequence: GCCAAAAGGCTATCCTATGATCT. Inner Primer PCR Length: 3177 bp. Deletion Size: 1678 bp. Deletion left flank: GTAGAAAAAAATACCGTTTTTTGTTTGAAG. Deletion right flank: CCCAAATTGCTCTTGTTGATCCTTACAGAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1974 smd-1(ok2602) I. C. elegans F47G4.7. Homozygous. Outer Left Sequence: AAACAGGAAAGGGGGAGAGA. Outer Right Sequence: AAGCCTTCAGATTCAAGCGA. Inner Left Sequence: CGACAAAGAGATGGGGAGAA. Inner Right Sequence: CGCACTCCAGGTCATAGACA. Inner Primer PCR Length: 3240 bp. Deletion Size: 1093 bp. Deletion left flank: GAGCGTAGACTAGGGTTTCCGTCTGCAAAT. Deletion right flank: GAACTCAACTTCTCTGTGGAATGTGTAAAG. Insertion Sequence: CAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1975 klc-1(ok2609) IV. C. elegans M7.2 Homozygous. Outer Left Sequence: aaatggcgccaagagatatg. Outer Right Sequence: tcacgcaattttgagttcgt. Inner Left Sequence: attgtcaggctgctggatct. Inner Right Sequence: cgattcaataattttcgggg. Inner Primer PCR Length: 2292. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1976 uev-1(ok2610) I. C. elegans F39B2.2. Homozygous. Outer Left Sequence: GAAATGCGTACTCGCACTGA. Outer Right Sequence: GGAAAAGTTCGAGGGGAAAG. Inner Left Sequence: ACGGATTTATTCGGATGGGT. Inner Right Sequence: TACCGGGGAGAGTAAACTGG. Inner Primer PCR Length: 1301 bp. Deletion Size: 480 bp. Deletion left flank: CTTGTCCGAGAGGACTACACAGTTAGCCTT. Deletion right flank: CCGTTCGTTTCACCACCAAAGTTCACATGG. Insertion Sequence: TGCAAACGCGCTCCACT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1977 Y66H1B.2(ok2611) IV. C. elegans Y66H1B.2. Homozygous. Outer Left Sequence: AGCGAGTCCAGTGTCGATTT. Outer Right Sequence: CGCTTACCGAAAATGCAAGT. Inner Left Sequence: GACGTCCTGGGAAGAACTTG. Inner Right Sequence: TCCAAAACTTTAAACCGCCA. Inner Primer PCR Length: 3218 bp. Deletion Size: 1763 bp. Deletion left flank: TTAAAAATATTGAGTTTCAACAATTTTACA. Deletion right flank: ATCGCGTAGACTCCTGGTTCTGTTGGAGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1978 ZK1248.15(ok2612) II. C. elegans ZK1248.15. Homozygous. Outer Left Sequence: GTACATGCAATGAGACCGGA. Outer Right Sequence: GTTTTCATGGAAGAGGCCAA. Inner Left Sequence: GAAGGTACATTCGTCATCCGA. Inner Right Sequence: ACCACGTGTTCCATGGTCTT. Inner Primer PCR Length: 1119 bp. Deletion Size: 577 bp. Deletion left flank: AAGAGTGATCTCGTCTGCTAGTGGGATCGA. Deletion right flank: AGCCGTTTATCTGAATCTGTTGCTCTGTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1979 del-3(ok2613) I. C. elegans F26A3.6. Homozygous. Outer Left Sequence: TCATCGCTTCTACGTGCATC. Outer Right Sequence: ATAATTGGAAGGGTTTCCCG. Inner Left Sequence: TAGCCCCCTACACCTCACAG. Inner Right Sequence: TAAATCGGCACCTGCTTTC. Inner Primer PCR Length: 1222 bp. Deletion Size: 350 bp. Deletion left flank: TATATAAATAAGACACAACTGGCGTCGATT. Deletion right flank: ATAATCAGCTGCTTCACGAAGCGATGGATT. Insertion Sequence: TCGTGAAAGCAGCTGATTACGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1980 C02C6.3(ok2614) X. C. elegans C02C6.3. Homozygous. Outer Left Sequence: CGTGTCTCTTCACATGCGTT. Outer Right Sequence: AAGTGAGGGAAAAGCAGCAA. Inner Left Sequence: CATTTGCTGAAAAACGCTGA. Inner Right Sequence: GCTGGCAGGTGGTTAAATGT. Inner Primer PCR Length: 2605 bp. Deletion Size: 1841 bp. Deletion left flank: TTTTCAAATAGACGATTTAACCTCTTAATA. Deletion right flank: AATTTTGGGTTGGGTCTTGGTTTAATATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1981 lin-23(ok2615) II. C. elegans K10B2.1 Homozygous. Outer Left Sequence: cgttttcatcgttttccgtt. Outer Right Sequence: attttatgggccaccatctg. Inner Left Sequence: caccgagcttcaacaactca. Inner Right Sequence: ctcttcgtctacgtcgcctc. Inner Primer PCR Length: 2567. Deletion size: about 1100 bp. [NOTE (08/24/2021): A user has reported that their stock of RB1981 received directly from RB appears to be heterozygous. Not known if that is also the case for CGC stock.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1982 vit-1(ok2616) X. C. elegans K09F5.2. Homozygous. Outer Left Sequence: AGCGTGAGCTCAAGGAGAAG. Outer Right Sequence: AGCTTCGTATCCACGACGAC. Inner Left Sequence: ACAAGGATGCTGAGACCACC. Inner Right Sequence: GCTACTGGCTCAACGGAGAA. Inner Primer PCR Length: 3252 bp. Deletion Size: 1797 bp. Deletion left flank: AAGGAAGCCATTGATGCCCTCAGACTTCTT. Deletion right flank: CGTGAAGTTCAACTCTCTCTTACCTCTACC. Insertion Sequence: CTTTCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1983 K05F1.5(ok2617) II. C. elegans K05F1.5. Homozygous. Outer Left Sequence: CTCACATTCACCCAGTGTGC. Outer Right Sequence: AACATCCCAACCACGAACTC. Inner Left Sequence: TTGGTGAGTACACCCTGAACA. Inner Right Sequence: TATTGCAAGTTGTTTTGCGG. Inner Primer PCR Length: 3142 bp. Deletion Size: 1240 bp. Deletion left flank: CCATTTGTCGTCAGGAACATTGGCTAGAAA. Deletion right flank: TGCACATATCTTCTGTTAAATTGTCCTTTT. Insertion Sequence: CATATTTTTTGTTAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1984 clec-227(ok2618) V. C. elegans F08H9.5. Homozygous. Outer Left Sequence: TTATCCGGACAATCCGTAGC. Outer Right Sequence: AAAGCAATCCGGTCAATACG. Inner Left Sequence: ACTTCAATACACCGGATGGC. Inner Right Sequence: ACTTTGTGCCAGCCAACTTT. Inner Primer PCR Length: 2163 bp. Deletion Size: 1295 bp. Deletion left flank: TTATAAAAGAAAAATTGTATTTTTTTGAAA. Deletion right flank: TTTATTATGTGAATGCTCCAACTGGATTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1985 C48B4.1(ok2619) III. C. elegans C48B4.1. Homozygous. Outer Left Sequence: TTTCCCCAACACAAACCATT. Outer Right Sequence: TGACGTGGATGGCTTAAACA. Inner Left Sequence: CCAATGGTGCCATTTCTTCT. Inner Right Sequence: ATGAAGTAACCAAGCGGTGG. Inner Primer PCR Length: 3288 bp. Deletion Size: 1509 bp. Deletion left flank: TACGAACAGCTGAATATCGAATTGAAATAG. Deletion right flank: AGTTCCGTTTGGGCATAAGTTCCAATGATC. Insertion Sequence: GTTCCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1986 Y111B2A.19(ok2620) III. C. elegans Y111B2A.19 Homozygous. Outer Left Sequence: attttcggtaatttgccggt. Outer Right Sequence: aaaattacgctccgcctctt. Inner Left Sequence: tctgccagtttgctggaaat. Inner Right Sequence: tgcgcgacgctacttataga. Inner Primer PCR Length: 3222. Deletion size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1987 Y40C5A.4(ok2622) IV. C. elegans Y40C5A.4. Homozygous. Outer Left Sequence: CAGAAGCGTTTTGCTGTGAC. Outer Right Sequence: TTTTTGTGGGTGTGATTGGA. Inner Left Sequence: TGGGTCAACGATAAGATCCC. Inner Right Sequence: TTGCACTCATCAGTATTGTTCAC. Inner Primer PCR Length: 3131 bp. Deletion Size: 1099 bp. Deletion left flank: TGTGCAACATCTCGTTATGAGATAACAAAA. Deletion right flank: AAAAAGTATATTAGGGCAGGAATATGGGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1988 spe-17(ok2623) IV. C. elegans ZK617.3. Homozygous. Outer Left Sequence: TGCTGCACCTAACAATCAGC. Outer Right Sequence: CAAGCGAACAGCAGTCACAT. Inner Left Sequence: GCTTGAATTTTTGACTGTGGC. Inner Right Sequence: GTTGTCGAATTATTGCGGCT. Inner Primer PCR Length: 1167 bp. Deletion Size: 285 bp. Deletion left flank: GGTAATCTCTAGTTGTCTTCCAGTTTCAGT. Deletion right flank: CTCGGAAGTTGAGAACGTGGCGGCCACGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1989 flp-10(ok2624) IV. C. elegans T06C10.4. Homozygous. Outer Left Sequence: CCTATGATCCAAGCCCTCAA. Outer Right Sequence: AAAACTTGACGACTGGTGGG. Inner Left Sequence: TCCAATTAACGTTTATGACCGA. Inner Right Sequence: GCATGATGACGTGGATTTTG. Inner Primer PCR Length: 1168 bp. Deletion Size: 682 bp. Deletion left flank: CCCATCTCACTAATTATACGCCTAAATCTT. Deletion right flank: ACATTCGATTCGGAAAACGAAGAGTCGATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1990 flp-7(ok2625) X. C. elegans F49E10.3. Homozygous. Outer Left Sequence: GAAGGCGGAGTCATAGCATC. Outer Right Sequence: TGAAGGACTGGAAAACAGGC. Inner Left Sequence: ATGAGAAGAAGGGGGTGGAG. Inner Right Sequence: TTGGGTAGCGACCAATCTGT. Inner Primer PCR Length: 1302 bp. Deletion Size: 548 bp. Deletion left flank: TCCTATTTTTTCTATTTTTTATATTTTTCA. Deletion right flank: TGCAAACACCTTGATTACCAAGAACAAAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1991 F26F2.1(ok2626) V. C. elegans F26F2.1 Homozygous. Outer Left Sequence: attttcgaaacgccaagcta. Outer Right Sequence: tgagcaacagtttcaggacg. Inner Left Sequence: tcatttgagcttgttgctgg. Inner Right Sequence: gcggagggtaagagatttttg. Inner Primer PCR Length: 3101. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1992 C44B9.1(ok2627) III. C. elegans C44B9.1 Homozygous. Outer Left Sequence: acaccctggcacactttttc. Outer Right Sequence: ggatacattttcccgctcaa. Inner Left Sequence: taattttgcttgcttccgct. Inner Right Sequence: aatcaccgtccttctggaaa. Inner Primer PCR Length: 3150. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1993 C06B3.3(ok2628) V. C. elegans C06B3.3 Homozygous. Outer Left Sequence: ggcaaagatcacaattccgt. Outer Right Sequence: tgggaatgggaagagatttg. Inner Left Sequence: aaggcttcgcatctcttgg. Inner Right Sequence: tgcaaggtaccattaaccga. Inner Primer PCR Length: 1208. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1994 dod-24(ok2629) IV. C. elegans C32H11.12. Homozygous. Outer Left Sequence: TTCCGTGATCACAATTGACC. Outer Right Sequence: GGTTAACCTCCCCAATTCGT. Inner Left Sequence: TGTGTCCCGAGTAACAACCA. Inner Right Sequence: ATTGTCGTCACTTTTCGGCA. Inner Primer PCR Length: 1260 bp. Deletion Size: 401 bp. Deletion left flank: CCATGAACAGTGGATAATCGATGAGCTTAT. Deletion right flank: TTCTGGAGCCTGAATAGAACTATATTTAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1995 F35E2.1(ok2630) I. C. elegans F35E2.1. Homozygous. Outer Left Sequence: TGCGGATCTTGTTGTCTGAG. Outer Right Sequence: ATGGAACTTGTTCGGGTGAG. Inner Left Sequence: AAGGCGTATGTCCGAAGATG. Inner Right Sequence: CAATTGATTTGTAGACTGATTGGAA. Inner Primer PCR Length: 1374 bp. Deletion Size: 311 bp. Deletion left flank: ACTCTCTCATAGTTTATAGTGTGGGAAAGT. Deletion right flank: TTTGGGAAACATCCACATAAAGCTGTATCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1996 F25E5.3&try-8(ok2641) V. C. elegans F25E5.3, F25E5.10. Homozygous. Outer Left Sequence: CGAGGGAACAACTCCAGAAG. Outer Right Sequence: CTTGTTCGCAGTGTTGCAGT. Inner Left Sequence: TGTCCACATATGAGTCTGCCA. Inner Right Sequence: TGAACGACAATCTGGACATGA. Inner Primer PCR Length: 3023 bp. Deletion Size: 1520 bp. Deletion left flank: CAGCTTCAAGCAACATGTGGACGTAACACA. Deletion right flank: CATGGAACTTACTCACGGCGGCACCTCCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1997 mtr-4(ok2642) IV. C. elegans W08D2.7. Homozygous. Outer Left Sequence: CAGCTCACACATCTGCTGGT. Outer Right Sequence: AGAGCATCATCGTTTCCCAG. Inner Left Sequence: CGTCTCCAATCAAAGCACTG. Inner Right Sequence: CACTTTTTCTTTCGGCTTTCA. Inner Primer PCR Length: 3060 bp. Deletion Size: 1554 bp. Deletion left flank: CTTAAAATATTTTTAACTTCAGAATGGGTC. Deletion right flank: AAAGAATTATTCAAATTCAACGAGAACCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1998 hog-1(ok2643) X. C. elegans W06B11.4. Homozygous. Outer Left Sequence: TGAAGCTAATGCTGAACCGA. Outer Right Sequence: CAGTACAAACGGCTGCACAT. Inner Left Sequence: TTGTGGCCTAAAATGCAAAA. Inner Right Sequence: TCATGCTTGTTTTTCTACCGA. Inner Primer PCR Length: 1280 bp. Deletion Size: 487 bp. Deletion left flank: GTAGTTTTCTAAAATTTTATTGTTAACAGT. Deletion right flank: AGATAAGATGTTTTGCAGATACAGCGAGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1999 grl-7(ok2644) V. C. elegans T02E9.2. Homozygous. Outer Left Sequence: AGACCCTCCGTACCTGGTTT. Outer Right Sequence: CTTTGAATGGCAGTGTGACG. Inner Left Sequence: AAGCTCGGAAGCGTGCTG. Inner Right Sequence: CTATTGCATAACCGCCCATC. Inner Primer PCR Length: 1207 bp. Deletion Size: 424 bp. Deletion left flank: CGATTCCTGAGCTGTAGCAACTTCCGCGAC. Deletion right flank: CGGAATAGCATTCTGGAAATAGAATCAACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2000 maoc-1&E04F6.6(ok2645) II. C. elegans E04F6.3, E04F6.6. Homozygous. Outer Left Sequence: AACGATGGAGAGGAAACGTG. Outer Right Sequence: TGAACCACGTCCAGAAGATG. Inner Left Sequence: GGACGGTCATTGTTATCTCTTG. Inner Right Sequence: CGGTGGGAATAAGACAGAGG. Inner Primer PCR Length: 3145 bp. Deletion Size: 2110 bp. Deletion left flank: ATACTTTTTTTGCAAATTATTTAAAACATC. Deletion right flank: AGTAAAACCATTCAAATATAATATAAATTC. Insertion Sequence: AGTAAAAACGTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2001 F52E10.3(ok2646) X. C. elegans F52E10.3. Homozygous. Outer Left Sequence: TCGGACTCCTGTTCGCTAGT. Outer Right Sequence: TGGCAGTTTCTCTTCTCCGT. Inner Left Sequence: CAACGGGCATCTTTGTAATCT. Inner Right Sequence: GGATTTATGGCTCTCACCCA. Inner Primer PCR Length: 1229 bp. Deletion Size: 533 bp. Deletion left flank: GTGGAAATTCGTTTTCAGTAGGGCGTATTT. Deletion right flank: TAATATTTTTAAATTCAAGTTATAAGCATT. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2002 F41E7.2(ok2647) X. C. elegans F41E7.2 Homozygous. Outer Left Sequence: aatgccaactatgattcgcc. Outer Right Sequence: tctcgcggatacaaagacct. Inner Left Sequence: aagaacagggaatcggaacc. Inner Right Sequence: ttctctcctcgttccacctc. Inner Primer PCR Length: 3078. Deletion size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2003 Y48E1A.1(ok2655) II. C. elegans Y48E1A.1. Homozygous. Outer Left Sequence: TTCAGCTTTGAAATTTCCGC. Outer Right Sequence: GCCATTTTGGGCAATAAAAA. Inner Left Sequence: CTCCGTCGTCTGATCCTCTC. Inner Right Sequence: TTCAGGAATGAGATCCCTCG. Inner Primer PCR Length: 2607 bp. Deletion Size: 1490 bp. Deletion left flank: CAGTTTCAATTCCCGCTGCCATATTTCCCT. Deletion right flank: TTTTGTCTCAGAAAATCCGCATTTTTTGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2004 clec-63(ok2656) II. C. elegans F35C5.6. Homozygous. Outer Left Sequence: ACACCCATCAGTCCTTCCTG. Outer Right Sequence: ACCAAAACATGCCTACCTGC. Inner Left Sequence: GGTGTTATCAGTGATGGGGG. Inner Right Sequence: TACCCCAGATATGTCCGAGC. Inner Primer PCR Length: 2202 bp. Deletion Size: 823 bp. Deletion left flank: AATTTCTGAAGATCAGACAAAAATAGAGAG. Deletion right flank: TTGGATGGCAGAACATCAACGCATACAGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2005 T28F2.7(ok2657) I. C. elegans T28F2.7. Homozygous. Outer Left Sequence: CGTCGATTCCAGTAATCCCA. Outer Right Sequence: CATTCATCTGCATGGACACC. Inner Left Sequence: CGCAGCTAGAGTTTCACAGC. Inner Right Sequence: CAGAGCTTTAACATTGAGATGCC. Inner Primer PCR Length: 1202 bp. Deletion Size: 776 bp. Deletion left flank: AAACCTGAAAATCTTAGTAGCATAAGAACA. Deletion right flank: CTGAAATTCGAAAAAGTTGGTGAGCAAATT. Insertion Sequence: CACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2006 spi-1(ok2658) II. C. elegans R10H1.4. Homozygous. Outer Left Sequence: TTGGTCACTGATATGCGCTC. Outer Right Sequence: AAGTCGACCGAGTCGTCAAT. Inner Left Sequence: GGGAAATGAAAATAAGGTCAATG. Inner Right Sequence: TGCTCAACGAGATGTGGAAA. Inner Primer PCR Length: 1194 bp. Deletion Size: 711 bp. Deletion left flank: ATGACCGAGACTGGTCCGACCTCCGATATT. Deletion right flank: GGATTAAATGAAGTTTGGATGGTTTGTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2007 grl-6(ok2659) X. C. elegans K10C2.5. Homozygous. Outer Left Sequence: ACAAACACCAACAGCGATGA. Outer Right Sequence: TCAATTGCAAAAATGCTCGT. Inner Left Sequence: TTGTTGGATTTTGCTTTTACGA. Inner Right Sequence: CTCAGAATTTCCCCCAAAAA. Inner Primer PCR Length: 1134 bp. Deletion Size: 570 bp. Deletion left flank: TTGGCAGAATGTATCGGTATGAGCTATGTA. Deletion right flank: GGTTTATTGCTGAAACTTACTGAGCCGGGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2008 pgp-14(ok2660) X. C. elegans F22E10.3. Homozygous. Outer Left Sequence: TCCAGAAGCAGAATTTTGGG. Outer Right Sequence: TGGGTTTTCGAAGGTTTCAC. Inner Left Sequence: GGACCAAAGCTCTGGCAAT. Inner Right Sequence: TTGTTTGCTGTTGTTTCGGA. Inner Primer PCR Length: 1234 bp. Deletion Size: 688 bp. Deletion left flank: GACCAAAGCTCTGGCAATTGCAATTCTCTG. Deletion right flank: AAAGATTGAGTTAGACTGTAATTGATGGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2009 F46A8.9(ok2661) I. C. elegans F46A8. Homozygous. Outer Left Sequence: TTTTTACGCGGTAAACCCTG. Outer Right Sequence: AAATTTGGAAGGTTTTGGGG. Inner Left Sequence: TATTCCACACTCAACGCGAG. Inner Right Sequence: ATGGCTGATTATGCTGGGAG. Inner Primer PCR Length: 2229 bp. Deletion Size: 997 bp. Deletion left flank: TGTTTCAATAATACAATAGCTATTTCAGAA. Deletion right flank: AGCGGCAAGATCCACGCCAATGGTCATTCC. Insertion Sequence: GA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2010 ZK795.4(ok2662) IV. C. elegans ZK795.4 Homozygous. Outer Left Sequence: catcaaccaccaccagtgag. Outer Right Sequence: aaaatcgatgcattcggaag. Inner Left Sequence: cggttgggacgatcaaaag. Inner Right Sequence: tcataatacttttccgccgc. Inner Primer PCR Length: 3038. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2011 ugt-62(ok2663) III. C. elegans M88.1. Homozygous. Outer Left Sequence: AAACATGGTTCCCGACATTC. Outer Right Sequence: AATTCGGTGCATTTGGAAAA. Inner Left Sequence: GCAACTTTGGAATTTTTGGG. Inner Right Sequence: ATCAGATTTCCTGCGCAACT. Inner Primer PCR Length: 3024 bp. Deletion Size: 1367 bp. Deletion left flank: ACGCTAAATTGTTTTAATACATTTTAAAGT. Deletion right flank: ATGAAATATTTCTCGATTAAAGTTTCTCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2012 T21C9.11(ok2664) V. C. elegans T21C9.11. Homozygous. Outer Left Sequence: AAAATTTGAATCGGGCGTTA. Outer Right Sequence: ACTCTTTCGCCTGAAATCCA. Inner Left Sequence: CGATTTTTGTACATTCAGGCAA. Inner Right Sequence: TTTCTGGTCGAAAGTGGTCA. Inner Primer PCR Length: 3024 bp. Deletion Size: 2525 bp. Deletion left flank: AGGCAAAAATCCATTTGTTCCGTCATTTTT. Deletion right flank: GAAATGCCACGTCAGCAGAGTGAAATGTGG. Insertion Sequence: GAACGAAAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2013 T08A9.13(ok2666) X. C. elegans T08A9.13. Homozygous. Outer Left Sequence: AAGAAAAGCTTGCAACGAGC. Outer Right Sequence: AGCTCCAATTGCAGTTTCGT. Inner Left Sequence: TCAATTGTTCCCCACTCTCC. Inner Right Sequence: CAATGCCACTTCGGTTTCTT. Inner Primer PCR Length: 2631 bp. Deletion Size: 1432 bp. Deletion left flank: AATGTACTAAACATTTATACTATGTTGCAA. Deletion right flank: TTGAGAAGCTTTTTGTGCAGCAATAATGGC. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2014 F47G4.5(ok2667) I. C. elegans F47G4.5. Homozygous. Outer Left Sequence: AAATCGGAAGACAAGCATCG. Outer Right Sequence: AATCCTCTCCAAGTCCCGTT. Inner Left Sequence: TGAATACAAGCCTTCGCCTT. Inner Right Sequence: TTTTCCTTCCAGTGCAATTC. Inner Primer PCR Length: 1117 bp. Deletion Size: 570 bp. Deletion left flank: AAGTGTCCATGCTGATAATATTATCTGAAA. Deletion right flank: ACGGTTGAAGATGACCGCCGCTGTCGGATC. Insertion Sequence: CGGTTGAAGATAATATTATCTGAAACGGTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2015 Y76A2B.3(ok2668) III. C. elegans Y76A2B.3 Homozygous. Outer Left Sequence: aacaacacgttgctggagtg. Outer Right Sequence: ccacccatggcctaactcta. Inner Left Sequence: tctaatcgagttggattcacg. Inner Right Sequence: tgcaattacagggtcaacca. Inner Primer PCR Length: 3069. Deletion size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2016 gfi-1(ok2669) V. C. elegans F57F4.3. Homozygous. Outer Left Sequence: AGATAGATGGAAGAGCGGCA. Outer Right Sequence: TCGAGATGTACGACGAGTGC. Inner Left Sequence: AGCTTCCTTGACGTTGCAGT. Inner Right Sequence: GGCTGGATATGGTGGAAAGA. Inner Primer PCR Length: 1147 bp. Deletion Size: 658 bp. Deletion left flank: TTTACAACTGGAATAGTGTTTGTGGTGTTTACGGCAGCTTCCTTGACGTTGCAGTTGGT TCCGGTTGTGCAGCAGTAACCGGTGATATCCTTGTCTGTGGAGATGGTCTTACGCTCGT TGTTTAATCCAAGGGACTTGCAAATTGTCTTTGGAACGCAATGATATGACTTGTAAAGA ACATTATTGACAGTTGTCTCAAGAGATCCGCAATATCCGTCACATGATACGGTTCCTCC AACGTTGACATTTCCGTCACTGGTGTAGACTCCGACGTAGCACTTGGCTGGTCC. Deletion right flank: ATTCCAAGTTGATAGCATGTGCTGACTGGATCGCAAGTGTAAATTGTAGCGTTGGTGAG AGCTCCATTGTACATGGTTGAGAGAGTAGCAGAAGCGCATTCTCCCTTACATGCTTGCC AACCAGCGATGGAAATTGGCATGTTATTGACGTAAAGACCAGAGAAGCAAGCGATTGGA TAATCACGGAAGTTCGTAACTGGCATTGAAGTATTGATCTTTCCACCATATCCAGCCAA ATCGACGTTGCAGTTGTTGTAGTTGTCGCAGCAGCATCCCGTAACTGTGGTATCATATG GAAGTGGTTTGCACTCGTCGTACATCTCGAGTTGTCTGCAGAATTGGGTTGGCACGCAT CCGAAGATAGCAACTGGGTCTTGGTTGAGGGTAGCTTGAATTGAGGCGCACTTTCCTGG GCAGAAGATTTCAGATCCAGTGGCCTTTCCTTGAGCGTAGATTCCAGCGAAGCACTTGC GGAATCCAGATGGTACAGTCTTGTTCTTTGGTGGATCAAGGCAGAGATCAGTGTTACAG CAGCATCCGGAGACTCCTGGGATTGGGGAGGCACACCAGTTGTTCATGTTGAGAGATTG GCAAACAGTGCTTGGGTCGCATCCGTAAAGAGTTGCTGTGGTGGCAACTCCGTTGAGTG TAGTGTTCAATGAGATGGACGCACATTGTCCCTGGCAAGCTCCGAGAATGACTGGAGTA GATGGAACACCGTTGACATAAAGTCCAGTGTAGCAAGCAATAGCATAGTCGACTGAAGT TGGTGGTGGTGGTGGAGTGATGGTGGTATTGGCAATGTTACAGTTGTTGGCATTGTTAC AGCAGCATCCAGTGACTTGGTTGTCATTCCAAACTGGTTTGCAGTTGTCGTAGAGTTCA AGGGAGTTACAGATCGAGTTTGGCATGCAGTGATAGGTGTTGACTTGGAATCCACCGAC AACTCCTGAGAGGGATGAGCATTGTCCGTTACATGGAATTTGAGCTCCAACGTTAACTG CGCTTCCATTAACAATGTAGTTCGAGCTGATACCAGCATAGCACATAAGTTGGTTTCCT GGGTTACGAGCTGGATAGACTGTTGGATCAATACAGGCATTGGTGTTACAGCAGCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2017 T21D12.3(ok2670) IV. C. elegans T21D12.3 Homozygous. Outer Left Sequence: cgctgaaaaacggagaagtt. Outer Right Sequence: taatcaaacgacaccgtcca. Inner Left Sequence: cgaaatttttgaatttttgaatcc. Inner Right Sequence: tggctcaacaactatggtgc. Inner Primer PCR Length: 1362. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2018 grl-5(ok2671) V. C. elegans Y47D7A.5. Homozygous. Outer Left Sequence: TTTTTCCCTCTTTATCCCGC. Outer Right Sequence: TGTAAATGTTGTTCCACCGC. Inner Left Sequence: CCAGCCCAACCTAAGCCTAA. Inner Right Sequence: AAACTTTCTGCAAAATGCTCTACA. Inner Primer PCR Length: 1187 bp. Deletion Size: 624 bp. Deletion left flank: ATTAATGTCAATCAGGCTTTCAAGTCAAGG. Deletion right flank: AATCACACTGTTACAAGAGTACAGAAAGAA. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2019 csq-1(ok2672) X. C. elegans F40E10.3. Homozygous. Outer Left Sequence: AGATCCCAGACGATCCAGTG. Outer Right Sequence: CCGAGGCAAAACATCCTAAA. Inner Left Sequence: TGAAAATATGGATGACGAATGTG. Inner Right Sequence: AAGAAACTACCAAGCGGCAA. Inner Primer PCR Length: 1222 bp. Deletion Size: 348 bp. Deletion left flank: AAGTTTATATCCTTGCTAGAAAAAAATAAT. Deletion right flank: AAACACTCCGACTCCAACTTCGAGGCTCTC. Insertion Sequence: TGTGCTCCAGAGAGATCCAAAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2020 T22F7.4(ok2673) III. C. elegans T22F7.4. Homozygous. Outer Left Sequence: CGTGACGTCAGCACACTTTT. Outer Right Sequence: AATTTTCTTGCCCCCTTCTC. Inner Left Sequence: ACGCGTCGCAATTTTTGTAG. Inner Right Sequence: CGTTTCGCTCGTTTATGTTG. Inner Primer PCR Length: 1283 bp. Deletion Size: 491 bp. Deletion left flank: ATTAATTTTTGTGAACGCCTATTTTAGAGG. Deletion right flank: AAAAAAATTTTTGAAAAAAAAATTTTTTTT. Insertion Sequence: GG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2021 srt-34(ok2674) V. C. elegans F54E2.6. Homozygous. Outer Left Sequence: TGGTGTTCTTCCGACTGTCA. Outer Right Sequence: AATTATTTTGGCGTTCGCTG. Inner Left Sequence: TGCATAGTTTTGCAATTCACC. Inner Right Sequence: GGTTCTGTGCTTTCGATTCC. Inner Primer PCR Length: 1286 bp. Deletion Size: 496 bp. Deletion left flank: AGGTAGGTTCGTTTATCATCGAAAAGCACA. Deletion right flank: TTCAAGCATAATTGTTGATTGAAGATTTAT. Insertion Sequence: ATTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2022 ZK1307.1(ok2675) II. C. elegans ZK1307.1 Homozygous. Outer Left Sequence: tcacctccttattggttgcc. Outer Right Sequence: atttgccggtgtcttttgag. Inner Left Sequence: tgcaggtgggtagtagaggg. Inner Right Sequence: agatttacaagggttcgggg. Inner Primer PCR Length: 1192. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2023 btb-13(ok2676) II. C. elegans ZC204.11. Homozygous. Outer Left Sequence: AATGAGAGAAGAGACGGCGA. Outer Right Sequence: CTGCTGAGCGTCCATTATGA. Inner Left Sequence: TTGGGATACACTGTAACAAAACC. Inner Right Sequence: CAAGAATCCTGTCTGACGCA. Inner Primer PCR Length: 1210 bp. Deletion Size: 686 bp. Deletion left flank: ATCCGAAAGCTGTGGGAACTCGGCGCACGT. Deletion right flank: GCTGTAAATTTGCATGTTAATTTTGCTCAA. Insertion Sequence: TTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2024 gly-15(ok2682) I. C. elegans C54C8.11. Homozygous. Outer Left Sequence: TCAAGCTGACAACGTTCCTG. Outer Right Sequence: CTTGTCCTTGCGTTGTCCTT. Inner Left Sequence: GGGTCCTGCCACTCAGACTA. Inner Right Sequence: CCGACACTACTTGAATAACCCC. Inner Primer PCR Length: 1138 bp. Deletion Size: 449 bp. Deletion left flank: TTTGTCACGTTTTTGCCATTGGTTTTGGTA. Deletion right flank: TTTGAGGTGATACAAAAAAACTGTCAACTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2025 eri-1(ok2683) IV. C. elegans T07A9.5. Homozygous. Outer Left Sequence: CCAAAGAACTTCCATCTGCC. Outer Right Sequence: TGCGGGTCATCACTAATCCT. Inner Left Sequence: TTTCGATAGGATGACGAAACG. Inner Right Sequence: GGGCTTTAACACAATTCTCCC. Inner Primer PCR Length: 1218 bp. Deletion Size: 811 bp. Deletion left flank: CCCGGAAAAAATGATTTTCTTGCGGGAAAA. Deletion right flank: TTTTCAGATTCGTCGGTTCTGGTTTCAGCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2026 gla-3(ok2684) I. C. elegans T02E1.3. Homozygous. Outer Left Sequence: AGACCCTGAATGAATCCGTG. Outer Right Sequence: GTGGCTCCTTGAGAGTTTCG. Inner Left Sequence: TACCATATCCCACCACAGCA. Inner Right Sequence: ATCGAGCAGATTCTCGTTGC. Inner Primer PCR Length: 1125 bp. Deletion Size: 657 bp. Deletion left flank: CAGAGTGATCAAATGAGTAATGGTCATCAC. Deletion right flank: GAAAGCTCAAGTCCTGTCGTGATGTCTTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2027 src-1(ok2685) I. C. elegans Y92H12A.1 Homozygous. Outer Left Sequence: ctggcaccacgtgatatttg. Outer Right Sequence: tatccgctcacctctgcttt. Inner Left Sequence: catttacatggtggtgagcg. Inner Right Sequence: attcctcggcacataaccag. Inner Primer PCR Length: 2697. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2028 set-12(ok2686) X. C. elegans K09F5.5. Homozygous. Outer Left Sequence: AAACCGTTTGAAAGTCCACG. Outer Right Sequence: GACAGTTTTGCGGTGTTGAA. Inner Left Sequence: AGATTGCCCATGATGCTTCT. Inner Right Sequence: CTTTCCTCACTGACAATGGC. Inner Primer PCR Length: 1090 bp. Deletion Size: 448 bp. Deletion left flank: TGGCTAGTGGAACAGGAGCTGTGACATCGG. Deletion right flank: TTGTTTTCAAAGTATTACAAAGTCAACTTA. Insertion Sequence: AACAGGAGCTGTGACAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2029 add-2(ok2687) V. C. elegans F57F5.4 Homozygous. Outer Left Sequence: aacgaatccgtggttacgaa. Outer Right Sequence: tcggatggaagtgatgatga. Inner Left Sequence: catcacatttcgatcaccca. Inner Right Sequence: caaacaacgatggaaattattg. Inner Primer PCR Length: 3279. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2030 nlp-3(ok2688) X. C. elegans F48C11. Homozygous. Outer Left Sequence: ATACCCGCCATCATCTCAAA. Outer Right Sequence: TATTTCGGTATCTGCCGAGC. Inner Left Sequence: TCAGCAGCACTTGACAAACA. Inner Right Sequence: AAAATGTTCTTGACGCGGAG. Inner Primer PCR Length: 3211 bp. Deletion Size: 1618 bp. Deletion left flank: AACCCAAGTTGCTACAAATCATTTGAAACA. Deletion right flank: TGCTTACAATGAACAATTGTGTCCCGGATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2031 D2005.1(ok2689) I. C. elegans D2005.1. Homozygous. Outer Left Sequence: TGCAAACTCCACCATTCTCA. Outer Right Sequence: AAGAAATTCAACGTGCCACC. Inner Left Sequence: TCGAAAGCAGCAAGAGTGAA. Inner Right Sequence: GATGACTGAATACTATCAAATACCT. Inner Primer PCR Length: 1124 bp. Deletion Size: 512 bp. Deletion left flank: ATGAGATATGCCCATATGCATTCTCATTTG. Deletion right flank: ACATTGCTCTGCGGGCAAGAATAATAGCAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2032 rop-1(ok2690) V. C. elegans C12D8.11. Homozygous. Outer Left Sequence: AAGGCCACAATCTGTTCTGC. Outer Right Sequence: GACAAGAAGCAACCCCAAAA. Inner Left Sequence: CTTGTCCGATCTTCCAATCC. Inner Right Sequence: ACACCATGAGCTGGTTCACA. Inner Primer PCR Length: 3130 bp. Deletion Size: 1172 bp. Deletion left flank: TAATCTGAGTAGGCATTGAGCATTGGACAT. Deletion right flank: GTTTTGCACACAGTAACTACTAAATTCAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2033 C49A1.2(ok2691) I. C. elegans C49A1.2. Homozygous. Outer Left Sequence: ACAACCCCAGGTCAATGGTA. Outer Right Sequence: AGGAGATAACGTGGTGGTGG. Inner Left Sequence: AGAACCGTTCGGCTACAAAA. Inner Right Sequence: GCCCATAAAAACCTGACACC. Inner Primer PCR Length: 3118 bp. Deletion Size: 1707 bp. Deletion left flank: CGTCCAATCTATCAACTTCTACTTGCACTT. Deletion right flank: AGTTTTAAGCTCCTCTGATAGCTCTGTTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2034 F52H3.4(ok2692) II. C. elegans F52H3.4. Homozygous. Outer Left Sequence: TTAGCGAAGCATTTTTGCCT. Outer Right Sequence: CGACCCGAAGAATTGACATT. Inner Left Sequence: GGAAAAACGCGACTGTCAAT. Inner Right Sequence: CACGAAAATTATCGGGATGC. Inner Primer PCR Length: 1138 bp. Deletion Size: 455 bp. Deletion left flank: ACGCGACTGTCAATTTGGACGATGATGGAA. Deletion right flank: AGTACTATGACTTCGAGTTCTGCTATTCCG. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2035 asp-4(ok2693) X. C. elegans R12H7.2. Homozygous. Outer Left Sequence: ATCTGTTGCTTAGTGGCGCT. Outer Right Sequence: GTGAACTGATGCTGACCGAA. Inner Left Sequence: CCATGGATTCCTCACTTTCG. Inner Right Sequence: TGCTTCATCACCGTTACGAC. Inner Primer PCR Length: 1185 bp. Deletion Size: 613 bp. Deletion left flank: AGACAGAACGGAATGGTCGTGGAGCTGGAT. Deletion right flank: GAGAAAAGATTCGATGGGACCTTCTTCTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2036 Y42A5A.4(ok2694) V. C. elegans Y42A5A.4. Homozygous. Outer Left Sequence: CTGCGCTCATTTTCCTTTTC. Outer Right Sequence: CGATCTCCGGCATATTGATT. Inner Left Sequence: GAACCGGAAACTTCATCTCG. Inner Right Sequence: TTCCCATGATTTCCTCCTTG. Inner Primer PCR Length: 1092 bp. Deletion Size: 647 bp. Deletion left flank: CATACTAGTTCATACCAGTCAAATTGAAAT. Deletion right flank: GGAAATTCGAACAATTTGGTTTCAAAAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2037 dkf-1(ok2695) I. C. elegans W09C5.5. Homozygous. Outer Left Sequence: TCCTCTAGCAAAACCTTCCG. Outer Right Sequence: GTGGTACACGGGAAATGGTC. Inner Left Sequence: AAAATGTTTTAAAATACAAAAGAGA. Inner Right Sequence: AGTTTCCAACCGCGCTCTAT. Inner Primer PCR Length: 1154 bp. Deletion Size: 876 bp. Deletion left flank: TTTTTTCAATTTTTTTTTTTTGTTTTTTTC. Deletion right flank: GAGGTACATATTCCTGGTATCCAAATTCCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2038 W09C5.5(ok2696) I. C. elegans W09C5.5 Homozygous. Outer Left Sequence: tcctctagcaaaaccttccg. Outer Right Sequence: gtggtacacgggaaatggtc. Inner Left Sequence: aaaatgttttaaaatacaaaagagagg. Inner Right Sequence: agtttccaaccgcgctctat. Inner Primer PCR Length: 1153. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2039 set-13(ok2697) II. C. elegans K12H6.11. Homozygous. Outer Left Sequence: CTCTAGGTCTTTTGCGCAGG. Outer Right Sequence: CAGTGAGATGTCGGCTGCTA. Inner Left Sequence: GGACTATAACTCGAGAACCGC. Inner Right Sequence: CGAAAACGGTTACTTTTCGAG. Inner Primer PCR Length: 1249 bp. Deletion Size: 759 bp. Deletion left flank: ACTCAGAATTTTATTTTAAACATTTTGTTA. Deletion right flank: TTGAATTTATTTTTTCAGAGTTTTCCAAGG. Insertion Sequence: AATTGTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2040 T19F4.1(ok2698) V. C. elegans T19F4.1. Homozygous. Outer Left Sequence: CGGATTTCCATACATCACCC. Outer Right Sequence: CTGTCTTGTGAGCATCTGCC. Inner Left Sequence: CCACCTTTTCATCCCACATT. Inner Right Sequence: TTGCAACTATCACATGCCCA. Inner Primer PCR Length: 1155 bp. Deletion Size: 579 bp. Deletion left flank: CGGTTGTAATCGGTTCACATTTTCGGAGCG. Deletion right flank: ATCACTTTCAACATATATGGCATATATTCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2041 try-7(ok2699) I. C. elegans ZC581.6. Homozygous. Outer Left Sequence: ATCACATCACAAACGCCAGA. Outer Right Sequence: TGTTCTGACTCCGCCTCTTT. Inner Left Sequence: ATGATGCAGGCAGCAATACA. Inner Right Sequence: TGCCATCATGTGGAATTTCT. Inner Primer PCR Length: 1257 bp. Deletion Size: 452 bp. Deletion left flank: CAACTTTAACTGTGTTTTTCTAATCAATAA. Deletion right flank: GAAGAGTACAGTTCCATTGTTTCGTTACCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2042 grl-5(ok2700) V. C. elegans Y47D7A.5. Homozygous. Outer Left Sequence: TTTTTCCCTCTTTATCCCGC. Outer Right Sequence: TGTAAATGTTGTTCCACCGC. Inner Left Sequence: CCAGCCCAACCTAAGCCTAA. Inner Right Sequence: AAACTTTCTGCAAAATGCTCTACA. Inner Primer PCR Length: 1187 bp. Deletion Size: 365 bp. Deletion left flank: AGAAATTATTAGTTCAAAAGTACACCAGTC. Deletion right flank: AACTCCAGTGTCAATATCCATAACATCCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2043 ZK1307.1(ok2701) II. C. elegans ZK1307.1. Homozygous. Outer Left Sequence: TCACCTCCTTATTGGTTGCC. Outer Right Sequence: ATTTGCCGGTGTCTTTTGAG. Inner Left Sequence: TGCAGGTGGGTAGTAGAGGG. Inner Right Sequence: AGATTTACAAGGGTTCGGGG. Inner Primer PCR Length: 1193 bp. Deletion Size: 626 bp. Deletion left flank: ATCTGGAAGACCCTCTGTTTGCTCCATTGT. Deletion right flank: AACAATGTACACCCGTGGTCATTTTATTAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2044 C30A5.3(ok2702) III. C. elegans C30A5.3 Homozygous. Outer Left Sequence: aacgtcttggtgtcgagctt. Outer Right Sequence: ggtgatccgttcgtagagga. Inner Left Sequence: ggtcgcatttgttccagaat. Inner Right Sequence: cagcccatttttgcagtttt. Inner Primer PCR Length: 3126. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2045 spp-1&umps-1(ok2703) III. C. elegans T07C4.4 & T07C4.1 Homozygous. Outer Left Sequence: agaaccgaggagcttcaaca. Outer Right Sequence: acgagaagcgacgatagcat. Inner Left Sequence: gatgctgcgttgtccagtag. Inner Right Sequence: tgaaaaatccggagagccta. Inner Primer PCR Length: 1229. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2046 cyp-35A3(ok2709) V. C. elegans K09D9.2. Homozygous. Outer Left Sequence: AAACGGCGGTAAATATGCAG. Outer Right Sequence: GTTTTCCATGTGGCTCGAAT. Inner Left Sequence: AGACTTTCCGGAATATGGGG. Inner Right Sequence: TTTGCCAAAGATTCTCCCAG. Inner Primer PCR Length: 1107 bp. Deletion Size: 345 bp. Deletion left flank: ATTACTAAGTTCATATCCATTCAGATGCTC. Deletion right flank: AAGAATAGAAGACATAAAATCTGGAAAATA. Insertion Sequence: TGACATTGATAAATCAGCAAAGAAAAATCAGCATTGATAAATCAGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2047 prmt-1(ok2710) V. C. elegans Y113G7B.17. Homozygous. Outer Left Sequence: AACTACGAGTTTTGGGGGCT. Outer Right Sequence: TTTCGTGTGTGTTGGGTCTC. Inner Left Sequence: TTTCAGCCCAAAAATCGAAG. Inner Right Sequence: GGCCCTAAAAGTGGATTTCA. Inner Primer PCR Length: 1126 bp. Deletion Size: 532 bp. Deletion left flank: CGTAGAGACGAGCCTTGTCCGGGAACAACA. Deletion right flank: CTTCCCGTTTTCGGTACTCATTGTCCCGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2048 Y48G1C.10(ok2711) I. C. elegans Y48G1C.10. Homozygous. Outer Left Sequence: TCGCTACGCGATACTTTGTG. Outer Right Sequence: AACCCGGTGATTTAATGCAG. Inner Left Sequence: TTGTGCATTACGCATTTTCAG. Inner Right Sequence: TAAAGTTCTGGCGGAGGAAA. Inner Primer PCR Length: 1187 bp. Deletion Size: 575 bp. Deletion left flank: GAGAATCGGATAAAAATAATTTATTTAAGT. Deletion right flank: CCGAATAACGAGAAGCCGCATGTTATAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2049 grl-12(ok2712) V. C. elegans F28A12.2. Homozygous. Outer Left Sequence: CATGCACTTTTTCCCTTGTG. Outer Right Sequence: AATCCAGTTCATTCGTTCCG. Inner Left Sequence: TCTTCTCATCAAGATTCCAAAAGTT. Inner Right Sequence: TACCTTTGTCCGCAGGTCTC. Inner Primer PCR Length: 1291 bp. Deletion Size: 998 bp. Deletion left flank: ATTCCTTGAATATCTTAATATTTCCATTTA. Deletion right flank: TGCGGAAGCTGGAGCAGAAAAGAGAAGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2050 W05G11.4(ok2713) III. C. elegans W05G11.4. Homozygous. Outer Left Sequence: AAGTTGGCTTCCTCTCACCA. Outer Right Sequence: TGAGTAAAAATTTTCGGCGG. Inner Left Sequence: TTATATTCTGCGCAATCATCG. Inner Right Sequence: TGGAAAATATTTGGCTGGAAA. Inner Primer PCR Length: 3073 bp. Deletion Size: 1767 bp. Deletion left flank: CTCGTAAGAGGTGACATTGGAACACTTTCA. Deletion right flank: AGAAATCATCAACAATTATTACTTCCCATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2051 inx-10(ok2714) V. C. elegans T18H9.5. Homozygous. Outer Left Sequence: CTTGGTCTCATGTGTGCGTT. Outer Right Sequence: GGCTGGACATTCTGGTGAGT. Inner Left Sequence: GCTTCTCCATTAAATCTTGTGTTG. Inner Right Sequence: AAATCCAGCGATGCAACAAT. Inner Primer PCR Length: 1112 bp. Deletion Size: 689 bp. Deletion left flank: TGAAGCGTCATCATTCGTATCACAAAAACT. Deletion right flank: TAACTTGACAATCTCATTGATTTTTATTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2052 ttbk-2(ok2715) IV. C. elegans F36H12.8. Homozygous. Outer Left Sequence: CAATGCAGGTGCTCAAAATG. Outer Right Sequence: GAATGACCTCGTTCCCTTGA. Inner Left Sequence: AAGTGTTGGTGCTCGGAGAG. Inner Right Sequence: CCAAAACCACATACTTCGGC. Inner Primer PCR Length: 1207 bp. Deletion Size: 525 bp. Deletion left flank: AAGCTCTTGAGGATCTCCACAACATTGGAT. Deletion right flank: TGCTATAGAGTTAGTTGAACTTATAGTAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2053 ges-1(ok2716) V. C. elegans R12A1.4 Homozygous. Outer Left Sequence: ggagcacatttgcctcattt. Outer Right Sequence: caaaacattgtaggggtcgg. Inner Left Sequence: ttttcaggttttgagctattttca. Inner Right Sequence: tgccacaaacgaaattatgg. Inner Primer PCR Length: 1139. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2054 fbxb-44(ok2717) II. C. elegans K05F6.5. Homozygous. Outer Left Sequence: TGGCTAGCCCTACCTTTCCT. Outer Right Sequence: GCGCCGATATGTGTGTATGT. Inner Left Sequence: TCAACATGGGAGTTATGGAGC. Inner Right Sequence: GCGTGAAACGAGTAGCTTGG. Inner Primer PCR Length: 1230 bp. Deletion Size: 408 bp. Deletion left flank: TGAAAAGAATGGAGCTGCTTACAATCCAAA. Deletion right flank: GCTTCCAAAAATTACCTGATCGCACTACGT. Insertion Sequence: CATTGTTTTGGAAGGAATTCATCACGAGTTTGCACCAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2055 ugt-1(ok2718) V. C. elegans AC3.7. Homozygous. Outer Left Sequence: AGCCATGAGGACAAAGTTCG. Outer Right Sequence: TGTTGAAAATGCTTTGCCAG. Inner Left Sequence: TTGCTCTTCCATGTCTCGAA. Inner Right Sequence: TCGTCTAGATTCCGCCATTT. Inner Primer PCR Length: 1255 bp. Deletion Size: 787 bp. Deletion left flank: TTGCATTTCCAACACCATCACTTCCAAAAC. Deletion right flank: TTTGTTCAGTACTACATGTTAGATGCTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2056 C45B2.1(ok2719) X. C. elegans C45B2.1. Homozygous. Outer Left Sequence: CTCGGCCACGATTTATCTTC. Outer Right Sequence: ATCGGAGTCCAGTCAGCATT. Inner Left Sequence: AAAACTTGCCGAAAACAATCT. Inner Right Sequence: TTTACACCGTCAGGCTTCAA. Inner Primer PCR Length: 1338 bp. Deletion Size: 495 bp. Deletion left flank: GCGTTCTGATTTGTCAGAAAACTGTTACAA. Deletion right flank: GTACGGACGATACGGATTCCCAGGAGGAAA. Insertion Sequence: ACCGATTCCAGCAACCATCTGCAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2057 grl-14(ok2720) V. C. elegans T03D8.4. Homozygous. Outer Left Sequence: TCAATTAGCCACTGCACCAA. Outer Right Sequence: TGGCAAACATTCGTGGTAAA. Inner Left Sequence: CGAAGTGAAGGGAGGATCAC. Inner Right Sequence: GCCTTTTATTGCCTATCCCC. Inner Primer PCR Length: 1308 bp. Deletion Size: 405 bp. Deletion left flank: CCAGCCACAAATAATCTATCAACAAACGAC. Deletion right flank: AAAAAATTAGTTAAATTGAGCAAAAATTAA. Insertion Sequence: TTCGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2058 grl-2(ok2721) V. C. elegans T16G1.8. Homozygous. Outer Left Sequence: GGCTCCTCCACCTCTTATCC. Outer Right Sequence: ATTTTCTATCGCCTGGCCTT. Inner Left Sequence: GCTCCAGTATCTGCTCCATCA. Inner Right Sequence: CTTTTTCACAACCGGGAATC. Inner Primer PCR Length: 1196 bp. Deletion Size: 397 bp. Deletion left flank: GGGCCATTTCCACCGGCACCTCTTTATGTG. Deletion right flank: TTAATTCTAGAAACAATTGGAAAAATATGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2059 ins-28(ok2722) I. C. elegans ZC334.9. Homozygous. Outer Left Sequence: AATTGGAGAAACTTGGCAGG. Outer Right Sequence: CAAAAGCGCCAGATAAAAGG. Inner Left Sequence: GGGTTCATTCCCTGGAAAA. Inner Right Sequence: TTTCACCCCAAATGTTCAGA. Inner Primer PCR Length: 1129 bp. Deletion Size: 584 bp. Deletion left flank: ACCTTTGTACCTACCGTCCGCCTAGGTGCC. Deletion right flank: AAGAGCACAAAGAATGAGCGCATCATATTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2060 W10C8.5(ok2723) I. C. elegans W10C8.5. Homozygous. Outer Left Sequence: ACATGATGGCTCAAGTGGGT. Outer Right Sequence: GCCGTGTTGAAACTCTGTCA. Inner Left Sequence: CGAGCCTGAGAAGTTGGAAA. Inner Right Sequence: AGAAAATATTCCGGGAACGC. Inner Primer PCR Length: 1180 bp. Deletion Size: 927 bp. Deletion left flank: TCATAGACTCCTCCAACAGATTCCGAGTGT. Deletion right flank: TTGGCTCCTTCTGGACCATTGAGCTTGGCG. Insertion Sequence: CCGAGTGATTCCGATTCCGATTCCGATTCCGTGATTCGTGATTCCGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2061 ora-1(ok2724) IV. C. elegans F57H12.3. Homozygous. Outer Left Sequence: CGCTGAGATCAGCATCAAAA. Outer Right Sequence: CAGAATGTTTTTCGCCCAAT. Inner Left Sequence: CGGAGAAAGGGGGTATGTTT. Inner Right Sequence: GGGAAATCGGGAATGAATAAA. Inner Primer PCR Length: 1158 bp. Deletion Size: 464 bp. Deletion left flank: TCAGCTGCTCTTCTTCTTTTGACTATTGTA. Deletion right flank: GAAATCATGGAATCTCTTCCAAAGGATGTT. Insertion Sequence: AAAAAAAAAAAAGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2062 C13B9.3(ok2725) III. C. elegans C13B9.3. Homozygous. Outer Left Sequence: ACCAACAAAACGATAAGCCG. Outer Right Sequence: TGAAGTAAATCGCATCGCAA. Inner Left Sequence: CGAAAATTTTTGGGTTTTTGA. Inner Right Sequence: CAGATTTGAGGCGCTGTGTA. Inner Primer PCR Length: 3129 bp. Deletion Size: 1627 bp. Deletion left flank: CTGAGTTAACTGGATATGGTTTTCCGTTCG. Deletion right flank: AAAAAATTTAAAGCTAGAAACTATTAAAAA. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2063 gst-5(ok2726) II. C. elegans R03D7.6. Homozygous. Outer Left Sequence: AATGCATCACAAAAGGGAGC. Outer Right Sequence: AATCTTCTGCCACCATCGAC. Inner Left Sequence: CGGAAGTGGTGGCAGATATT. Inner Right Sequence: TGCCGTTTGGAGAGGTTAGT. Inner Primer PCR Length: 3286 bp. Deletion Size: 1265 bp. Deletion left flank: CACATAAATTGTGAAAAATCAATGAGACCA. Deletion right flank: AGAGGCTCAAGTGAACTCTCTTGCCGATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2064 cpg-2(ok2727) III. C. elegans B0280.5. Homozygous. Outer Left Sequence: ATTCCAATTGAACCAACCCA. Outer Right Sequence: ACGGAAGGAAACTAAGGGGA. Inner Left Sequence: GGTACCCACCCCTTTTCAA. Inner Right Sequence: GTCATCTCTCTCGTCGGCTT. Inner Primer PCR Length: 3031 bp. Deletion Size: 1791 bp. Deletion left flank: ACGATGGCACGGCCGTTAGTGCAAGCAGTG. Deletion right flank: CGAGTTATTTTTTTGGCTTTTTTCTTTAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2065 C45B2.1(ok2728) X. C. elegans C45B2.1. Homozygous. Outer Left Sequence: CTCGGCCACGATTTATCTTC. Outer Right Sequence: ATCGGAGTCCAGTCAGCATT. Inner Left Sequence: AAAACTTGCCGAAAACAATCT. Inner Right Sequence: TTTACACCGTCAGGCTTCAA. Inner Primer PCR Length: 1338 bp. Deletion Size: 663 bp. Deletion left flank: GGAACATACTTCCTTTGCCTTGGAATAATA. Deletion right flank: AGCGTAATCTCAACGATTTGTACGATGACT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2066 F39E9.7(ok2729) II. C. elegans F39E9.7. Homozygous. Outer Left Sequence: AGAATGAGGGGAGAAGGGAA. Outer Right Sequence: TACAACCGAGGAACTGAGGG. Inner Left Sequence: ATTTAATTGAAAACCCCGCA. Inner Right Sequence: CAGGTTTGTAGCAAATTTGTTGTT. Inner Primer PCR Length: 1169 bp. Deletion Size: 485 bp. Deletion left flank: TACAGATTTAATTGAAAACCCCGCATGACC. Deletion right flank: TCATGTGGCCTCTCTGCTTTTCCCGTACCG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2067 flp-9(ok2730) IV. C. elegans C36H8.3. Homozygous. Outer Left Sequence: AAGGGGATGGGAGAGAAGAA. Outer Right Sequence: GTAGATTTGCGGCGTTGATT. Inner Left Sequence: TGATGGCTTTCTCTTGTCCA. Inner Right Sequence: GAGCCAGATTTGGATGCACT. Inner Primer PCR Length: 1134 bp. Deletion Size: 432 bp. Deletion left flank: AAAACATTTTCTGTCGCGTTGAGGCCGTTA. Deletion right flank: CTTTAATTTTCAAAAAATTATTTCAAGAAT. Insertion Sequence: TTTTCTGTCGCGTTGAGGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2068 C43G2.2(ok2731) IV. C. elegans C43G2.2. Homozygous. Outer Left Sequence: CACATCGCCAATCTTGACAC. Outer Right Sequence: GTTCAAAAGGCGCATGAAAT. Inner Left Sequence: CAAAACTTGGCGCAATAACA. Inner Right Sequence: CTTTTAACGGACCACACGCT. Inner Primer PCR Length: 1156 bp. Deletion Size: 547 bp. Deletion left flank: TGATAAAGTTGATCGGAGACTTGAATCATT. Deletion right flank: GGTTTATCACACTCCAAATCAAACTGAAAT. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2069 wrt-9(ok2732) X. C. elegans B0344.2. Homozygous. Outer Left Sequence: GCAAAAATTGGGCCATTAAA. Outer Right Sequence: TAATTTTGAAAACCGCCGAG. Inner Left Sequence: CTCCCCATTTGTTGAACACC. Inner Right Sequence: TGGTCCTGAATCTGTTGCTG. Inner Primer PCR Length: 1246 bp. Deletion Size: 979 bp. Deletion left flank: CCAACCTCTTCCAGCCCAACCGCCGAAAAT. Deletion right flank: GTCTATACGAGGTCGTTACTTACCAATCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2070 Y110A7A.6(ok2733) I. C. elegans Y110A7A.6. Homozygous. Outer Left Sequence: TGTTGCAGGAGAACGAGATG. Outer Right Sequence: CGCACACTTTTTGGCATTTA. Inner Left Sequence: CGTATTTCGTGCCGAAGAGT. Inner Right Sequence: TCGCGTCGAGACCTGTTAC. Inner Primer PCR Length: 1306 bp. Deletion Size: 840 bp. Deletion left flank: AAACGAGCAGGTTCGAGTTCCAAACGTCAT. Deletion right flank: AATATTCATCTTCTTCCAAGAAGTATTTAT. Insertion Sequence: TGCACTTGTCGGACTGCCGGCACGTGGCAAAACATACATCTCAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2071 ced-3(ok2734) IV. C. elegans C48D1.2. Homozygous. Outer Left Sequence: CAAAAGGACGCTCTGCCTAT. Outer Right Sequence: TGTCGTGTCGAGACCAGGTA. Inner Left Sequence: AGCAGATCGATTGTTGTTCAAG. Inner Right Sequence: TTGGTCCCAAAAACCAAAAA. Inner Primer PCR Length: 1118 bp. Deletion Size: 682 bp. Deletion left flank: GGCTTTCGCTCCAAAGAATATAAAATAATC. Deletion right flank: TTAAATATCAGTTTACATTAGGAACAAGGC. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2072 grd-6(ok2735) V. C. elegans T18H9.1. Homozygous. Outer Left Sequence: TAAATCATTTTTCAGGGGCG. Outer Right Sequence: CTTGTGAAGGCACAGTTGGA. Inner Left Sequence: CCACTGTTGCCCCGTATATC. Inner Right Sequence: TATGAACACGCAAGCTCACC. Inner Primer PCR Length: 1190 bp. Deletion Size: 825 bp. Deletion left flank: CAACTCCTTATATTGAGCGCCCGGTTCCAG. Deletion right flank: GAGGCAATAACACTTTTCCATTGCCATCTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2073 unc-53(ok2736) II. C. elegans ok2736. Homozygous. Outer Left Sequence: TTCCACAATCGAATGAACCA. Outer Right Sequence: TCAATTTCCGGATCTCAAGG. Inner Left Sequence: TCACGGGATCCATCGACA. Inner Right Sequence: AGCAAGAGCTCAAAGAACGC. Inner Primer PCR Length: 1282 bp. Deletion Size: 301 bp. Deletion left flank: TGCGGCACCGTGCATGAACATTCGGATTGT. Deletion right flank: GAGTTGCAGCCAGAGGATCGTTTCGAAGAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2074 fbxa-121(ok2737) I. C. elegans Y18D10A.18. Homozygous. Outer Left Sequence: CTTGGAAGCCAGTTGGACAT. Outer Right Sequence: TGACATTTACCGATCTGCCA. Inner Left Sequence: GTGATCTCGAACTTCCAGGG. Inner Right Sequence: ATGGATGCCCTCTACGAATG. Inner Primer PCR Length: 1117 bp. Deletion Size: 765 bp. Deletion left flank: CAACAGTAACCAATTTGGCATAGCGATGAT. Deletion right flank: GTTATTACCTCTCCAGATAATCCAATTGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2075 phg-1(ok2741) II. C. elegans F27E5.4. Homozygous. Outer Left Sequence: GGTGATTCTCCCGTTGGTAA. Outer Right Sequence: AAACGGAAATGGCAGAGAGA. Inner Left Sequence: GACAGTTACGCTGTGCTTGG. Inner Right Sequence: CTCCCGGGGTATTCTGAAAT. Inner Primer PCR Length: 1222 bp. Deletion Size: 472 bp. Deletion left flank: GCTCAGAACATGCAACTTCCTTCCAGCCGA. Deletion right flank: CACTGATCGAGTTTTCTTTTTTACTTTTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2076 ora-1(ok2742) IV. C. elegans F57H12.3. Homozygous. Outer Left Sequence: CGCTGAGATCAGCATCAAAA. Outer Right Sequence: CAGAATGTTTTTCGCCCAAT. Inner Left Sequence: CGGAGAAAGGGGGTATGTTT. Inner Right Sequence: GGGAAATCGGGAATGAATAAA. Inner Primer PCR Length: 1158 bp. Deletion Size: 312 bp. Deletion left flank: ACTACAAACATTCCAGCGTCCACCACCACC. Deletion right flank: GAAGAAATTCCAAGAATTCAAAGAGAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2077 W09C5.7(ok2743) I. C. elegans W09C5.7. Homozygous. Outer Left Sequence: GACTCACAAAACGGGACGAT. Outer Right Sequence: AGTGTGAAGCCCCACTCAAT. Inner Left Sequence: CGAAATCGGCGTGTTAGAAT. Inner Right Sequence: TACTTTTTGAAAATTAAGCCCTCT. Inner Primer PCR Length: 1299 bp. Deletion Size: 480 bp. Deletion left flank: TTCACATGCCCAATTATGCAAGGATATGTG. Deletion right flank: ACGTCACGTTTTTCTCGTTTGATTTGCATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2078 M28.9(ok2744) II. C. elegans M28.9 Homozygous. Outer Left Sequence: gaaacccgaaccatctgaaa. Outer Right Sequence: agcactgcggaaggtagtgt. Inner Left Sequence: gcttcatagccctgatctcg. Inner Right Sequence: aaattccccaaaatcgaagg. Inner Primer PCR Length: 1142. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2079 B0303.7(ok2745) III. C. elegans B0303.7 Homozygous. Outer Left Sequence: agagcaccaggaagcttgaa. Outer Right Sequence: atatttggatgcaccaagcc. Inner Left Sequence: tctggagatcccacgagaac. Inner Right Sequence: cgcagagaaatgagctatttgaa. Inner Primer PCR Length: 3072. Deletion size: about 2300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2080 Y50E8A.9(ok2746) V. C. elegans Y50E8A.9 Homozygous. Outer Left Sequence: cgcaacagcaaaacgttaga. Outer Right Sequence: atgtgtttgtgcatgcctgt. Inner Left Sequence: tggacgaaaatcatggtgaa. Inner Right Sequence: ctaccttctaggcgacaccg. Inner Primer PCR Length: 1249. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2081 ZK637.13(ok2747) III. C. elegans ZK637.13 Homozygous. Outer Left Sequence: gaaaaactcgtcgaagccac. Outer Right Sequence: gaagtttcaggggttgagca. Inner Left Sequence: cgaattctaaaaaggcgacg. Inner Right Sequence: tttccatctttacccaaccc. Inner Primer PCR Length: 3001. Deletion size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2082 F53C3.4(ok2748) II. C. elegans F53C3.4 Homozygous. Outer Left Sequence: cctcgccattttcatcattt. Outer Right Sequence: atgatgcagttaaatgcggg. Inner Left Sequence: aaatggaacacgtaaatgatcg. Inner Right Sequence: tcactctcgaactaaaaatagatacca. Inner Primer PCR Length: 1169. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2083 T24H10.1(ok2749) II. C. elegans T24H10.1 Homozygous. Outer Left Sequence: cggattattgacgcgtttct. Outer Right Sequence: tggcaaaactaccacgtgaa. Inner Left Sequence: cgcgtccacatcttttctct. Inner Right Sequence: gcaaaacttccagcgatttc. Inner Primer PCR Length: 1157. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2084 clp-7(ok2750) IV. C. elegans Y77E11A.11 Homozygous. Outer Left Sequence: ttccgcattggaaaagattc. Outer Right Sequence: atgggatcactcttcggatg. Inner Left Sequence: aacaagaacgaggcgtcatc. Inner Right Sequence: ggaatggagccaagtgga. Inner Primer PCR Length: 1114. Deletion size: about 200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2085 nhr-74(ok2751) I. C. elegans C27C7.3 Homozygous. Outer Left Sequence: caactgatttgcccgaattt. Outer Right Sequence: gttggcgttgaggacacttt. Inner Left Sequence: aaaaatatgccgaacatccg. Inner Right Sequence: ttgcaacacgattcgaaataa. Inner Primer PCR Length: 1195. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2086 C29E4.10(ok2752) III. C. elegans C29E4.10 Homozygous. Outer Left Sequence: tcattccttcaatcatcccc. Outer Right Sequence: ttctcgccatacatccttcc. Inner Left Sequence: aattatcttgattttaccaagtattgc. Inner Right Sequence: gtgtgctctgaaacgctgaa. Inner Primer PCR Length: 1161. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2088 F11E6.8(ok2754) IV. C. elegans F11E6.8 Homozygous. Outer Left Sequence: gaatgcatctgagcagcaaa. Outer Right Sequence: gccaggcaagaacagaaaag. Inner Left Sequence: ttagtgaaaagacggcctgg. Inner Right Sequence: tgcggtcaaaacactgaaag. Inner Primer PCR Length: 1244. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2089 R166.5(ok2755) II. C. elegans R166.5 Homozygous. Outer Left Sequence: gtgctcggacatttgttgaa. Outer Right Sequence: aattccgcgcattagaagaa. Inner Left Sequence: aagtctcacaatctccgcgt. Inner Right Sequence: tcaggagacgtattgaaggtaattt. Inner Primer PCR Length: 1217. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2090 Y105C5A.23(ok2765) IV. C. elegans Y105C5A.23(ok2765) IV. Homozygous. Outer Left Sequence: ggcctgttcttggaaaatga. Outer Right Sequence: gtagcaaggaaactcgcagg. Inner Left Sequence: cagagctcctccaacgtgat. Inner Right Sequence: tttctgaatttttacctgtttttga. Inner Primer PCR Length: 1181. Deletion size: about 200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2091 F23A7.7(ok2766) X. C. elegans F23A7.7 Homozygous. Outer Left Sequence: ttgaggaaggaatgtttggc. Outer Right Sequence: gcgacgagaaaaaggaagtg. Inner Left Sequence: ttctctaccatctcgattccg. Inner Right Sequence: gtttgttagcataacccggc. Inner Primer PCR Length: 1103. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2092 T09A5.1(ok2767) II. C. elegans T09A5.1 Homozygous. Outer Left Sequence: gcaggagaatctaatgggca. Outer Right Sequence: aaaagtttgaccacaacccg. Inner Left Sequence: gactccaaagtacccgagca. Inner Right Sequence: cgcagcttactgcttttcaa. Inner Primer PCR Length: 1115. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2093 F52C6.3(ok2768) II. C. elegans F52C6.3 Homozygous. Outer Left Sequence: catgctgctctccatcaaaa. Outer Right Sequence: ttcacaatgaacacaatgcg. Inner Left Sequence: aaaaacatcacagtggaagcg. Inner Right Sequence: gtgcgcaacagcgtacttt. Inner Primer PCR Length: 1167. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2094 F25C8.3(ok2769) V. C. elegans F25C8.3 Homozygous. Outer Left Sequence: agtcctgcgatttcatccac. Outer Right Sequence: gccttgttttggatcattgg. Inner Left Sequence: tatgttcgggctcagtgtga. Inner Right Sequence: tggcagatttgaatgaagca. Inner Primer PCR Length: 3167. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2095 F56D6.2(ok2770) IV. C. elegans F56D6.2 Homozygous. Outer Left Sequence: gccttttgcggtaatttgaa. Outer Right Sequence: tagtggcatccatccaatga. Inner Left Sequence: attcatggaagaggctgacg. Inner Right Sequence: ttttaagttgaaatgtgtggagc. Inner Primer PCR Length: 1331. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2096 Y57G11C.43&Y57G11C.44(ok2771) IV. C. elegans Y57G11C.43, Y57G11C.44. Homozygous. Outer Left Sequence: CAAACTCTTCAACACGCCAA. Outer Right Sequence: CAGGAAATTGGAAATCGCAT. Inner Left Sequence: GGGAAACAAAAAGCGGAAAT. Inner Right Sequence: CGTCGTTTCTTCAACACGAA. Inner Primer PCR Length: 2809 bp. Deletion Size: 2090 bp. Deletion left flank: GGTTCATTACCGTGAATTACTTTTTTTAGA. Deletion right flank: TCTTTTATTCTAACAAACACTGGCTTCAAG. Insertion Sequence: AGAAAAATTTACAAAACACTGAGCTTGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2097 Y92H12BR.6(ok2772) I. C. elegans Y92H12BR.6 Homozygous. Outer Left Sequence: caccatgtgtatcccccttc. Outer Right Sequence: gcaccacgtgatcagagaaa. Inner Left Sequence: ttggattttctgtacgacgtg. Inner Right Sequence: aagaaaaacccccgaaaatc. Inner Primer PCR Length: 1197. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2098 ins-25(ok2773) I. C. elegans ZC334.8 Homozygous. Outer Left Sequence: cgttgggaaaagtcttgagg. Outer Right Sequence: accaaaacctgaaatggcac. Inner Left Sequence: ttggacgaaaatcacgaaaa. Inner Right Sequence: tttttcaacaaactgtgggg. Inner Primer PCR Length: 1200. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2099 C44B9.5(ok2774) III. C. elegans C44B9.5 Homozygous. Outer Left Sequence: tgtatttccagcgctaccgt. Outer Right Sequence: cactgctgccagaacaccta. Inner Left Sequence: cccggaaaccatacgtaaaa. Inner Right Sequence: attcttgggacttggtgtcg. Inner Primer PCR Length: 1116. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2100 wht-2(ok2775) IV. C. elegans C10C6.5. Homozygous. Outer Left Sequence: GGCGATGGGAAAATAGGATT. Outer Right Sequence: TACAAACCGGTAAAGACGGC. Inner Left Sequence: TTTTTAATTTCAGGTGGCGAA. Inner Right Sequence: CGATGAGGCATGCGTATAGA. Inner Primer PCR Length: 1301 bp. Deletion Size: 800 bp. Deletion left flank: GGTTTCGCATGCCCTCGTAACTTCAATCCT. Deletion right flank: ACAAAACACTTTCGAATCCATGGATTTGCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2101 R09B5.6(ok2776) V. C. elegans R09B5.6 Homozygous. Outer Left Sequence: aagctcaatggctttttcca. Outer Right Sequence: cgtttttctgccaagctttc. Inner Left Sequence: cagaaattttcccccacaaa. Inner Right Sequence: cagcgaccaatttgtccataa. Inner Primer PCR Length: 1097. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2102 C10H11.10(ok2777) I. C. elegans C10H11.10 Homozygous. Outer Left Sequence: gcggtgaaaccgtcattact. Outer Right Sequence: actccacatccatcgaaagg. Inner Left Sequence: cttcggcttatccaaatcca. Inner Right Sequence: caaactccctcctcgtgtgt. Inner Primer PCR Length: 1105. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2103 grd-3(ok2778) IV. C. elegans W05E7.1 Homozygous. Outer Left Sequence: gagaagtttgccgagtttgc. Outer Right Sequence: gagatagctcggctccagaa. Inner Left Sequence: acgcaacgtttgagtgacaa. Inner Right Sequence: aggctttgggatttagacgg. Inner Primer PCR Length: 1302. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2104 grl-26(ok2779) IV. C. elegans K02D7.6 Homozygous. Outer Left Sequence: ccaccattgctggaaaaatc. Outer Right Sequence: ccaaacaaaagttcccgtgt. Inner Left Sequence: tcgatttattaccgttttgcg. Inner Right Sequence: gtgagtatccgcgtctgtca. Inner Primer PCR Length: 1212. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2105 T07D10.2(ok2780) I. C. elegans T07D10.2 Homozygous. Outer Left Sequence: atgggagccttctttcctgt. Outer Right Sequence: gtcaaggcacccaaatcagt. Inner Left Sequence: ctcaccccaacaccaatttc. Inner Right Sequence: tcgatgcaccatgaaggtaa. Inner Primer PCR Length: 1161. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2106 F23B2.5(ok2781) IV. C. elegans F23B2.5 Homozygous. Outer Left Sequence: atgtgtcccgttttggatgt. Outer Right Sequence: agcgtccgaatctgaagaaa. Inner Left Sequence: cggtacttgcaaagaaggct. Inner Right Sequence: ctgcagatcgttttccgaat. Inner Primer PCR Length: 1193. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2107 Y51F10.4(ok2782) I. C. elegans Y51F10.4 Homozygous. Outer Left Sequence: taccggaaattttcaatccg. Outer Right Sequence: ggctaagatcgtgagaccca. Inner Left Sequence: aatttgccaatttgccgtaa. Inner Right Sequence: aatggggaactttgacacca. Inner Primer PCR Length: 1198. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2108 inx-11(ok2783) V. C. elegans W04D2.3 Homozygous. Outer Left Sequence: ttgtttgttccgtttggaca. Outer Right Sequence: tatgaaaaccgcaggaatgg. Inner Left Sequence: tttcgacccgaaacatttta. Inner Right Sequence: ggttttcacgcgttttagatg. Inner Primer PCR Length: 1205. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2109 R166.5(ok2784) II. C. elegans R166.5 Homozygous. Outer Left Sequence: gtgctcggacatttgttgaa. Outer Right Sequence: aattccgcgcattagaagaa. Inner Left Sequence: aagtctcacaatctccgcgt. Inner Right Sequence: tcaggagacgtattgaaggtaattt. Inner Primer PCR Length: 1217. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2110 C39B10.1(ok2789) X. C. elegans C39B10.1 Homozygous. Outer Left Sequence: tgtggacaaccaggagcata. Outer Right Sequence: gtgtttccgggattcacaac. Inner Left Sequence: tgaagcatcagtgaggtagaatg. Inner Right Sequence: tcttgtcctgatccttctaggc. Inner Primer PCR Length: 1189. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2111 F46F2.3(ok2790) X. C. elegans F46F2.3 Homozygous. Outer Left Sequence: ggtgaaggttcaggcttctg. Outer Right Sequence: gtgatcatctccaagtggca. Inner Left Sequence: ccgtatgttagtgcgagtagaa. Inner Right Sequence: ggagctgaacaaggtctcca. Inner Primer PCR Length: 1189. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2112 grl-21(ok2791) IV. C. elegans ZC168.5 Homozygous. Outer Left Sequence: ccacgtcaatctggtcacac. Outer Right Sequence: aagctcatcgctgcttgaat. Inner Left Sequence: ttcgttgagcgaccatacac. Inner Right Sequence: cgctggtgtttgattgtgtt. Inner Primer PCR Length: 1287. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2113 F57G12.2(ok2792) X. C. elegans F57G12.2 Homozygous. Outer Left Sequence: gctgccattttcagatggtt. Outer Right Sequence: ccccaattgttttcgatcat. Inner Left Sequence: cacatgattcaaggcactcg. Inner Right Sequence: cacatgattcaaggcactcg. Inner Primer PCR Length: 1274. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2114 K12G11.3(ok2799) V. C. elegans K12G11.3 Homozygous. Outer Left Sequence: aatggaccacttgaagtccg. Outer Right Sequence: atcaacgaatgaaagacggg. Inner Left Sequence: cagtcccatctccagctgat. Inner Right Sequence: cgatttttcaatgcgatgag. Inner Primer PCR Length: 1362. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2115 aqp-8(ok2800) X. C. elegans K02G10.7. Homozygous. Outer Left Sequence: AAGCAGAAAAGGAGCGTGAA. Outer Right Sequence: TCAGGGCCTACCGTAACATC. Inner Left Sequence: ATGTTTTAGAGGGCGGTTGC. Inner Right Sequence: GCCCATTCTGAAGTTTCGAC. Inner Primer PCR Length: 1177 bp. Deletion Size: 436 bp. Deletion left flank: TAACTATGTATAAACATGGATCAGAAGTTG. Deletion right flank: ATTCCCCAGGCAATATGGCAAGACGTTGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2116 M01H9.3(ok2801) IV. C. elegans M01H9.3 Homozygous. Outer Left Sequence: ttgtttgtttgacggaacca. Outer Right Sequence: tgggtcccaattcaaatcat. Inner Left Sequence: tgggaaaagcgtgagctact. Inner Right Sequence: gctgaatacttctcaccgcc. Inner Primer PCR Length: 1207. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2117 D1086.6(ok2802) V. C. elegans D1086.6 Homozygous. Outer Left Sequence: cgatgatcaaaaacgctgtg. Outer Right Sequence: gagaagcagcacgtgttcag. Inner Left Sequence: cgacaagacaaaagaagttatttaca. Inner Right Sequence: gactgatcacagtgcggaaa. Inner Primer PCR Length: 1203. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2119 acr-23(ok2804) V. C. elegans F59B1.9 Homozygous. Outer Left Sequence: acatgtagacgtcgatggca. Outer Right Sequence: cagaatgagccgcaacaata. Inner Left Sequence: gtttccaaacgcacacattg. Inner Right Sequence: cgtgggcggtagaggtaaat. Inner Primer PCR Length: 1100. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2120 Y6B3B.5(ok2805) I. C. elegans Y6B3B.5 Homozygous. Outer Left Sequence: aaattccttgatttggtgcg. Outer Right Sequence: cattccacacgacgaaaatg. Inner Left Sequence: tccgcgtccaatacaataca. Inner Right Sequence: aatgcaggtcaaactccacc. Inner Primer PCR Length: 1131. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2121 F35C5.7(ok2806) II. C. elegans F35C5.7 Homozygous. Outer Left Sequence: ccggaaatttttattccggt. Outer Right Sequence: aatttttgtttgtgccccac. Inner Left Sequence: gcaggaaattttcattccga. Inner Right Sequence: ggctccaaaacagcaaagtc. Inner Primer PCR Length: 1104. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2122 C56E6.3(ok2807) II. C. elegans C56E6.3 Homozygous. Outer Left Sequence: ttttgtcgcagttcaacgag. Outer Right Sequence: gcgacaatatcggaagaagc. Inner Left Sequence: gccaaaatctctgtttttcagg. Inner Right Sequence: caggcttggaggagattctg. Inner Primer PCR Length: 1177. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2123 Y39A3CL.5(ok2808) III. C. elegans Y39A3CL.5 Homozygous. Outer Left Sequence: cttttggtttttgcggagtc. Outer Right Sequence: caaggcgggacttgattaaa. Inner Left Sequence: cagggatcactggagccac. Inner Right Sequence: tcgaaaaatttcgggaaaaa. Inner Primer PCR Length: 1206. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2124 grl-8(ok2809) V. C. elegans ZC487.5 Homozygous. Outer Left Sequence: caagaagccaactcctcgtc. Outer Right Sequence: acttcgcggttttcttctga. Inner Left Sequence: accccatccttaaaaccgac. Inner Right Sequence: cctcagccatcattccactt. Inner Primer PCR Length: 1292. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2125 wrt-2(ok2810) X. C. elegans F52E4.6 Homozygous. Outer Left Sequence: ccgaaaaatttggcaacact. Outer Right Sequence: atcaaaaacatgcgaggagg. Inner Left Sequence: gttagaatggcacgctggac. Inner Right Sequence: tggaggagaggttttggatg. Inner Primer PCR Length: 1100. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2126 F23B2.5(ok2811) IV. C. elegans F23B2.5 Homozygous. Outer Left Sequence: atgtgtcccgttttggatgt. Outer Right Sequence: agcgtccgaatctgaagaaa. Inner Left Sequence: cggtacttgcaaagaaggct. Inner Right Sequence: cggtacttgcaaagaaggct. Inner Primer PCR Length: 1193. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2127 plk-3(ok2812) IV. C. elegans F55G1.8 Homozygous. Outer Left Sequence: gtaggacggcatggagagtc. Outer Right Sequence: tcacgcatttgaggtggata. Inner Left Sequence: catagacgacatgctcctgg. Inner Right Sequence: ttcttctcttcgggtctcca. Inner Primer PCR Length: 1307. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2128 F59B8.2(ok2832) IV. C. elegans F59B8.2 Homozygous. Outer Left Sequence: cttgtcccttttggtgcatt. Outer Right Sequence: cgtccaacagaaccgctaat. Inner Left Sequence: gagtgacagttccgtgagca. Inner Right Sequence: atttttctccgaaaatccgc. Inner Primer PCR Length: 1200. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2129 cpr-2(ok2833) V. C. elegans F36D3.9 Homozygous. Outer Left Sequence: caatccagcgacaatacgag. Outer Right Sequence: ccggtctgtgtgaagactca. Inner Left Sequence: ctcgattccacactcgtcaa. Inner Right Sequence: v. Inner Primer PCR Length: 1214. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2130 C03A3.3(ok2834) X. C. elegans C03A3.3 Homozygous. Outer Left Sequence: aaagtacccccagctcacct. Outer Right Sequence: tgggagaaattctttggcac. Inner Left Sequence: acggtaaaagaggtcaccga. Inner Right Sequence: acacaccagagcacgatgag. Inner Primer PCR Length: 1138. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2131 Y7A9A.1(ok2835) IV. C. elegans Y7A9A.1 Homozygous. Outer Left Sequence: gctttcaaaagattggctgc. Outer Right Sequence: tttcgatcctccagttccac. Inner Left Sequence: gtatacaggatccatcgccg. Inner Right Sequence: ccattttcacatttccactgc. Inner Primer PCR Length: 1171. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2132 F55A12.8(ok2836) I. C. elegans F55A12.8 Homozygous. Outer Left Sequence: aaacgagatgtatgggcctg. Outer Right Sequence: aggaccaaacttgatggtcg. Inner Left Sequence: gcggcttcatcaattacgat. Inner Right Sequence: gatcgatgttcgcggtagtt. Inner Primer PCR Length: 1244. Deletion size: about 400 bp. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: www.mutantfactory.ouhsc.edu/
RB2133 C39B10.1(ok2841) X. C. elegans C39B10.1 Homozygous. Outer Left Sequence: tgtggacaaccaggagcata. Outer Right Sequence: gtgtttccgggattcacaac. Inner Left Sequence: tgaagcatcagtgaggtagaatg. Inner Right Sequence: tcttgtcctgatccttctaggc. Inner Primer PCR Length: 1189. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2134 ZK287.2(ok2842) V. C. elegans ZK287.2 Homozygous. Outer Left Sequence: tgttgaaaggcatgcgacta. Outer Right Sequence: tcatttttccaggcgtcttc. Inner Left Sequence: tgacgtttagcgatttttagca. Inner Right Sequence: ttcaatgatggtaggagccg. Inner Primer PCR Length: 1157. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2135 F33D4.4(ok2843) IV. C. elegans F33D4.4. Homozygous. Outer Left Sequence: CGACGTGATATCCGACATTG. Outer Right Sequence: CTTGGGCTTACACGGAAGAG. Inner Left Sequence: ACAAAGTGACCAGCACATGG. Inner Right Sequence: CATGCTTCAAGACGCAAAGA. Inner Primer PCR Length: 1174 bp. Deletion Size: 655 bp. Deletion left flank: CCTCCGAACAAAAAGAAAAATGATTTTGCT. Deletion right flank: TTTTATTTCTCATCAACATAATCAAAATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2136 ZC123.4(ok2844) I. C. elegans ZC123.4. Homozygous. Outer Left Sequence: CGACTCCCCTGCAAAGTTAG. Outer Right Sequence: AAGCTGGGGGAAGGATCTTA. Inner Left Sequence: CCACATATCCAGGGAAGTTGA. Inner Right Sequence: GCAACGGTGTATAAGTGCGA. Inner Primer PCR Length: 1173 bp. Deletion Size: 306 bp. Deletion left flank: TCAAGAGTTATGGCCGCAACGGCGCCTCCG. Deletion right flank: AACAACTCCCTTTCGCAATACGTTGAGCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2137 grl-18(ok2845) V. C. elegans T05C3.4. Homozygous. Outer Left Sequence: AAAAATCCCCGTAGCCATTT. Outer Right Sequence: TATCACAACAACTGAGGCCG. Inner Left Sequence: CGCTGAGTTCAAGCAGAAAA. Inner Right Sequence: ACCAATCGAGACTACGGCAA. Inner Primer PCR Length: 1203 bp. Deletion Size: 586 bp. Deletion left flank: AGGACTGCTTGTTGAACTTTCTAAGATATT. Deletion right flank: TGAGTTGACGTCTCATAATTTCTTTTTGCC. Insertion Sequence: GAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2138 nep-2(ok2846) II. C. elegans T05A8.4. Homozygous. Outer Left Sequence: TTTACCTGTTTTGCCGGTTC. Outer Right Sequence: TTCAAACTTCCCAGTCCACC. Inner Left Sequence: CTTTTCACCCTTCCTACCCC. Inner Right Sequence: TCCTACTTCCAGATGGCACC. Inner Primer PCR Length: 1323 bp. Deletion Size: 362 bp. Deletion left flank: AGCAAACGCGCCCCACTGAACTTCTTTCAC. Deletion right flank: GAATTCGTAGAAATCATCGCAGGGGTCGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2139 F54D12.7(ok2852) II. C. elegans F54D12.7. Homozygous. Outer Left Sequence: TGGCTAAATCCAACTCCGAC. Outer Right Sequence: GGAAAAATGTGCAAGGGGTA. Inner Left Sequence: TGCCAGGTAATTTCCAGTTG. Inner Right Sequence: AAAACTGACGGAGAATTCGAT. Inner Primer PCR Length: 1210 bp. Deletion Size: 250 bp. Deletion left flank: ATTTGTGCTTCCCGATAAGTCCATCCAGTT. Deletion right flank: TTGTTACAGCCATCCGTGAAAGTGTATTCT. Insertion Sequence: TGTTACAGCCATCCGTGAAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2140 mec-9(ok2853) V. C. elegans C50H2.3. Homozygous. Outer Left Sequence: AACTCTCGGAGCACAAATGC. Outer Right Sequence: TTGGCACAACAACGACAAGT. Inner Left Sequence: GAATTGTAAGCAGGGACATCG. Inner Right Sequence: TTGGCGTCATCGTCAAAAT. Inner Primer PCR Length: 1113 bp. Deletion Size: 408 bp. Deletion left flank: TCCACCAATTCCACCACCGGTTTCTTTTAA. Deletion right flank: AGCACCGTTCAAACAGGGTTTTTCGGCGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2141 F53B6.2(ok2854) I. C. elegans F53B6.2. Homozygous. Outer Left Sequence: GCTGTTCACGTGCTTTTTCA. Outer Right Sequence: AATGAGCAGGGTTTTTGTGG. Inner Left Sequence: CATTTGGTGCGGTAAGCAAT. Inner Right Sequence: TTCCAGATCAAGAGCAACCA. Inner Primer PCR Length: 1290 bp. Deletion Size: 962 bp. Deletion left flank: TCTTTGCTCACTTGAACTCGTTGTCTATTC. Deletion right flank: ATCGCATTGAGACCATTGTACAGACTTTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2142 K09C4.1(ok2855) X. C. elegans K09C4.1. Homozygous. Outer Left Sequence: TTAGCCACTTCCTTCCAAGC. Outer Right Sequence: AAGCTGATTGAATGATGCCC. Inner Left Sequence: TTCTTGGAATACAAAGCCCG. Inner Right Sequence: CAACTGACCTGTCCAACTGC. Inner Primer PCR Length: 1253 bp. Deletion Size: 1070 bp. Deletion left flank: GTAAATTTCAATTTATGGAATTTCAACAAT. Deletion right flank: AAACTCAATAAGAGTGTTGTTTGTTACAGA. Insertion Sequence: GTTTGTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2143 W02D9.3(ok2857) I. C. elegans W02D9.3. Homozygous. Outer Left Sequence: CACAATTTTCTCCTCGCGTT. Outer Right Sequence: TGTAGGCCTGATGTGGATGA. Inner Left Sequence: AAGAAGGTCCGACTCCACAA. Inner Right Sequence: GGGCTCAAAAGTGGACAAAA. Inner Primer PCR Length: 1114 bp. Deletion Size: 476 bp. Deletion left flank: AAGCCTGCACGAGAAACGCGCCAACGTCCA. Deletion right flank: AAAGTACGTAAACACCGTACACTCTACGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2144 F26E4.3(ok2858) I. C. elegans F26E4.3. Homozygous. Outer Left Sequence: CCCAGGCTCCTGTAATTTGA. Outer Right Sequence: AGGTTTGAAAATTTGCAGCG. Inner Left Sequence: CCAAAGTTCGTAGAGCCTCG. Inner Right Sequence: CACCTCTAATTTTGAAGAGTTTACA. Inner Primer PCR Length: 1165 bp. Deletion Size: 313 bp. Deletion left flank: TTCGTAAAACAATTGACACGGGAAAACGTT. Deletion right flank: GAGTTGATTCTACCTTCCGATATGATGGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2145 tir-1(ok2859) III. C. elegans F13B10.1. Homozygous. Outer Left Sequence: CGGGAGATAGAAGGCATCTG. Outer Right Sequence: ACGGGGCTTAATTTCCTCAT. Inner Left Sequence: AAACCTTCGAAAATCGAGCA. Inner Right Sequence: CTGCCAGTCCTGTTGCTCTT. Inner Primer PCR Length: 1356 bp. Deletion Size: 354 bp. Deletion left flank: ATTTGTGAGCATTTGGTAGGTGTAAACAGA. Deletion right flank: GGAGGCCACTTCTTTTAATGCTTGGATTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2146 C50F4.14(ok2860) V. C. elegans C50F4.14. Homozygous. Outer Left Sequence: AAGCAGTGGCTACCAACCAT. Outer Right Sequence: CCCGCCTTAACTACCATTCA. Inner Left Sequence: AAATGCAAACTTCGAGCAGC. Inner Right Sequence: GAATCCAACCAAATGGGAGA. Inner Primer PCR Length: 1274 bp. Deletion Size: 722 bp. Deletion left flank: GCTTCACTTTGTCAGATTTTGCCTCGCTAG. Deletion right flank: AAAACGGTCGTTAAACTACGTCCAACATAG. Insertion Sequence: TTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2147 acs-13(ok2861) I. C. elegans Y65B4BL.5. Homozygous. Outer Left Sequence: TATTCGGCTTTGAGGAGAGC. Outer Right Sequence: AAAGGCCACTGGTGAGTTTG. Inner Left Sequence: TGAACAAATGATTGAGCGACA. Inner Right Sequence: ACCGATGAGCTCAAAACGAC. Inner Primer PCR Length: 1131 bp. Deletion Size: 603 bp. Deletion left flank: GGATCACCATTCCGACGTGTCCGGCTAGCG. Deletion right flank: TGAGTGAGCATCACACCTTTCGGTGTTCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2148 F53B6.2(ok2862) I. C. elegans F53B6.2. Homozygous. Outer Left Sequence: GCTGTTCACGTGCTTTTTCA. Outer Right Sequence: AATGAGCAGGGTTTTTGTGG. Inner Left Sequence: CATTTGGTGCGGTAAGCAAT. Inner Right Sequence: TTCCAGATCAAGAGCAACCA. Inner Primer PCR Length: 1290 bp. Deletion Size: 631 bp. Deletion left flank: GCCACTCCACCAATTCCCAATGTCAATTTC. Deletion right flank: CTGAATGCATTTGAGAGCAGCTTTTTGTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2149 srw-100(ok2880) V. C. elegans Y46H3C.1. Homozygous. Outer Left Sequence: GGAATTGAGCATGTCAAGCA. Outer Right Sequence: GGGAATTCACCGAAAATCAA. Inner Left Sequence: TGCCGACATACAACAAGTTCA. Inner Right Sequence: CAAATCGGCAAATCGGTAAT. Inner Primer PCR Length: 1118 bp. Deletion Size: 373 bp. Deletion left flank: AACTCAATTCACAATACTCCTTTTAATTTC. Deletion right flank: ATGGCCACTGTGAGATTGGTACTAGTTAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2150 F13B12.6(ok2881) IV. C. elegans F13B12.6 Homozygous. Outer Left Sequence: cgaacgatgctacgagatga. Outer Right Sequence: aacacggaaaaatcaaacgg. Inner Left Sequence: ctggttgtcttgctgtccaa. Inner Right Sequence: aaaggataccgccgaaaaat. Inner Primer PCR Length: 1294. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2151 F17C11.2(ok2895) V. C. elegans F17C11.2. Homozygous. Outer Left Sequence: ATGTGTGTGCTGCAAGAAGG. Outer Right Sequence: CGGAACGTCGCCTATAAAAA. Inner Left Sequence: GGTATTCAATCGCAGCGG. Inner Right Sequence: ATTCGGTTTGTCATCGCACT. Inner Primer PCR Length: 1325 bp. Deletion Size: 1048 bp. Deletion left flank: GACGTTGCTAACTGTGTTAATGCGTGTTTC. Deletion right flank: ATAATATTTCCTAAATTCTCTCATCTCAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2152 R144.3(ok2897) III. C. elegans R144.3 Homozygous. Outer Left Sequence: atgacggatgatgatgacga. Outer Right Sequence: cgagacgacgcaataacatc. Inner Left Sequence: catcgtcttggaaaaatcgg. Inner Right Sequence: gggatcaattgaaatcaggg. Inner Primer PCR Length: 1125. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2153 C47E12.3(ok2898) IV. C. elegans C47E12.3 Homozygous. Outer Left Sequence: attgaacagcggggatattg. Outer Right Sequence: ctaggggcttgaatctgcac. Inner Left Sequence: cgattccattcgatcttcaa. Inner Right Sequence: attttcaggagacgcagacg. Inner Primer PCR Length: 1158. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2154 T12B3.1(ok2899) IV. C. elegans T12B3.1 Homozygous. Outer Left Sequence: cgagtagggtccaacgagaa. Outer Right Sequence: ccaaaacgttggagaccaat. Inner Left Sequence: ttgtcgacattttcccaatg. Inner Right Sequence: caagttcgcgataagtggaa. Inner Primer PCR Length: 1239. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2155 Y71D11A.5(ok2900) III. C. elegans Y71D11A.5 Homozygous. Outer Left Sequence: ccagtttcagctgtgtcgaa. Outer Right Sequence: gttttgcacgtacttccacg. Inner Left Sequence: aaactaggcttgttgggggt. Inner Right Sequence: cgaagctaataatggtgccaa. Inner Primer PCR Length: 1313. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2156 R02F11.1(ok2901) V. C. elegans R02F11.1 Homozygous. Outer Left Sequence: atgaagcaactcgccatctc. Outer Right Sequence: agaaagactgggggcaattt. Inner Left Sequence: atccgactttcagctccaga. Inner Right Sequence: aggtgtatccagttgggcag. Inner Primer PCR Length: 1108. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2157 cdh-12(ok2902) III. C. elegans Y71D11A.1 Homozygous. Outer Left Sequence: atggccgagtacaccttcac. Outer Right Sequence: ccagagtcctgagcttccac. Inner Left Sequence: attccgcaaaactccacg. Inner Right Sequence: aggatcgtaacgttcaaccg. Inner Primer PCR Length: 1102. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2158 Y41E3.3(ok2918) IV. C. elegans Y41E3.3 Homozygous. Outer Left Sequence: ctcggcacatatttcggttt. Outer Right Sequence: atatgcccagtcaactccca. Inner Left Sequence: gaaattttcccgaactttcaa. Inner Right Sequence: aaaaagtttcccaaaaaccg. Inner Primer PCR Length: 1098. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2159 ins-16(ok2919) III. C. elegans Y39A3A.5 Homozygous. Outer Left Sequence: gagcgcgtaaatcttagcca. Outer Right Sequence: ttaattccggcaaagtaccg. Inner Left Sequence: gtctgaaccttggtcaagca. Inner Right Sequence: ggaaaatttcaatttcggca. Inner Primer PCR Length: 1191. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2160 cdh-10(ok2920) IV. C. elegans C45G7.5 Homozygous. Outer Left Sequence: acctcaaatccccgatcttt. Outer Right Sequence: taggccaccaacttcaatcc. Inner Left Sequence: tcaaaaaccgtggtgatcatt. Inner Right Sequence: cccactctgcagttttcaca. Inner Primer PCR Length: 1163. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2161 ZK858.6(ok2921) I. C. elegans ZK858.6 Homozygous. Outer Left Sequence: agttcgatgaacatggctcc. Outer Right Sequence: cgacaatttgccagttgcta. Inner Left Sequence: ctccagcgatgagtgaactg. Inner Right Sequence: ctgttatcaatccagcgcaa. Inner Primer PCR Length: 1327. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2162 C18H9.8(ok2922) II. C. elegans C18H9.8 Homozygous. Outer Left Sequence: gatgcctgtgtcaagagctg. Outer Right Sequence: ccacttcaaccttgccaact. Inner Left Sequence: ggacctccaagagcacctact. Inner Right Sequence: acgcacaattccatgaagaa. Inner Primer PCR Length: 1309. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2163 hmit-1.1(ok2923) V. C. elegans Y51A2D.4 Homozygous. Outer Left Sequence: aaggccgttttagtccgaat. Outer Right Sequence: tatttgtgcatgagcccgta. Inner Left Sequence: tttggatttccaggttctcg. Inner Right Sequence: atcaaagcctgctggaagac. Inner Primer PCR Length: 1151. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2164 T04D3.3(ok2924) I. C. elegans T04D3.3 Homozygous. Outer Left Sequence: tctcacagttcacctgacgc. Outer Right Sequence: cggaagttttggctagcagt. Inner Left Sequence: ttcaaggataaatttgccgc. Inner Right Sequence: agggtcactgcatttttcca. Inner Primer PCR Length: 1290. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2165 C06E7.1(ok2932) IV. C. elegans C06E7.1 Homozygous. Outer Left Sequence: gttctcgtccgaaacgtcat. Outer Right Sequence: gaaattggggaggaatttgg. Inner Left Sequence: tgcaatgttcttgttgcactc. Inner Right Sequence: ggatatcgaggatattgcgg. Inner Primer PCR Length: 1179. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2166 his-70(ok2933) III. C. elegans E03A3.4 Homozygous. Outer Left Sequence: tccgtaaactttaggccacg. Outer Right Sequence: tgttcattgaaatcaccgga. Inner Left Sequence: ccatccactgcagacacagt. Inner Right Sequence: acgtttttgaacgaaatggg. Inner Primer PCR Length: 1316. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2167 secs-1(ok2934) V. C. elegans D1054.13 Homozygous. Outer Left Sequence: accttgccagcgtcataatc. Outer Right Sequence: cacgcagtgaaatcttgcat. Inner Left Sequence: aaatgattcgttgatcggga. Inner Right Sequence: tgttgtacccctttgcactg. Inner Primer PCR Length: 1121. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2168 ZK1240.2(ok2935) II. C. elegans ZK1240.2 Homozygous. Outer Left Sequence: tgtagtggttttgctctgcg. Outer Right Sequence: cttggcgatacagttggctt. Inner Left Sequence: aattgccagacgacaaatcc. Inner Right Sequence: tggccggaaattagcataaa. Inner Primer PCR Length: 1130. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2169 F29G6.3(ok2936) X. C. elegans F29G6.3 Homozygous. Outer Left Sequence: tgtggtgctcatgcttcttc. Outer Right Sequence: tcacacacctacaggtccca. Inner Left Sequence: ctcaaactttctgcgaaggg. Inner Right Sequence: tccgctttgactcatgacag. Inner Primer PCR Length: 1207. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2170 F44G3.10(ok2937) V. C. elegans F44G3.10. Homozygous. Outer Left Sequence: TAGCACACAAGGTGGCACTC. Outer Right Sequence: AAAACTCCCAACTCTTCGCA. Inner Left Sequence: CTCACATCCCAGGAAGCATT. Inner Right Sequence: AACGTTTTTGCTGACACACG. Inner Primer PCR Length: 1145 bp. Deletion Size: 664 bp. Deletion left flank: AGTAATAATAAGAATTTAATAAACGAGTAA. Deletion right flank: AACGATTCCAACGCTGCCTCCATCATCCGT. Insertion Sequence: AACGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2171 Y4C6A.1(ok2938) IV. C. elegans Y4C6A.1. Homozygous. Outer Left Sequence: GAAAACTCCAAACGGGACAA. Outer Right Sequence: ATTCGGCATACCTTCAAACG. Inner Left Sequence: AAATCAAAAGCCGTTCGTG. Inner Right Sequence: CCCCAACTGAAAATGGCTTA. Inner Primer PCR Length: 1236 bp. Deletion Size: 408 bp. Deletion left flank: CTGTTCAAGTGCAACTTTTCAACTTCTGAA. Deletion right flank: CTGTATTCATCGGTTCGTTTTCTTAAAAAA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2172 ttr-30(ok2939) X. C. elegans T08A9.2. Homozygous. Outer Left Sequence: TAGCGGTGACTCAACGGATT. Outer Right Sequence: AGAAACACGAGTCCCGAGAA. Inner Left Sequence: AAAACGAAGTCACATCATTGAAAA. Inner Right Sequence: CGTGGTTTTTGATAGGAGTACCA. Inner Primer PCR Length: 1116 bp. Deletion Size: 501 bp. Deletion left flank: GAAACATTTGCTATAAAACTTCTCGTCCTC. Deletion right flank: AATCTTCAATCGGTTTCTGTGAACGGAACA. Insertion Sequence: AGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2173 F12D9.1(ok2940) X. C. elegans F12D9.1. Homozygous. Outer Left Sequence: TAATGTGGTCCGCACAAAAA. Outer Right Sequence: GAGCAAAGTTGCGATTGTGA. Inner Left Sequence: TTTACTTGTGCATTTTTCCCA. Inner Right Sequence: TAGCGCAGCGTAGTTGGATA. Inner Primer PCR Length: 1192 bp. Deletion Size: 543 bp. Deletion left flank: ACGCGGCCACATTCTTCCCAGTCACGTTTT. Deletion right flank: TTTCAGATGCTGTAATTAGGATTTAGTTGA. Insertion Sequence: TTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2174 F59D6.7(ok2941) V. C. elegans F59D6.7. Homozygous. Outer Left Sequence: ACGGGCAAATTCCACATATT. Outer Right Sequence: AATACAAAACGGTATGCGCC. Inner Left Sequence: TTCATACATTTGATTGGTGTACTAA. Inner Right Sequence: AAATGCACACGTGGGGTTAG. Inner Primer PCR Length: 1297 bp. Deletion Size: 570 bp. Deletion left flank: TAGAAATTAATTCAAAAATCGCATCGACAT. Deletion right flank: CTGGGACATTCAAGAAGTCGTCACGTGACA. Insertion Sequence: CATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2175 klp-20(ok2942) III. C. elegans Y50D7A.6. Homozygous. Outer Left Sequence: ATCACAACGGGAATCTGGAG. Outer Right Sequence: TTCAACGGCAAAAATGTTCA. Inner Left Sequence: GAATTTGGAATCCTCCCGAT. Inner Right Sequence: TCATATTTCTCACCTCAATTTCTCA. Inner Primer PCR Length: 1133 bp. Deletion Size: 588 bp. Deletion left flank: CAAGGAGAGCGGTTGAAGGAGGCGGCGAAG. Deletion right flank: CAAATCGTGCGAAGAATATTCAAAACGTCG. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2176 gly-4(ok2943) V. C. elegans Y116F11B.12. Homozygous. Outer Left Sequence: TGACACCAGATTTGACGGAA. Outer Right Sequence: CAAAAACCTCCGAAGCACAT. Inner Left Sequence: AAATTTTGCTTTTTGGGCCT. Inner Right Sequence: CCAAATTTTGCGACTTACTATCG. Inner Primer PCR Length: 1177 bp. Deletion Size: 617 bp. Deletion left flank: ATCATCACGGCACAATGAGAAAAGTTGCTC. Deletion right flank: ATTAGATGTCGATAGTAAGTCGCAAAATTT. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2177 hlh-11(ok2944) III. C. elegans F58A4.7. Homozygous. Outer Left Sequence: AAGCTTGCGTCTTGAGAAGG. Outer Right Sequence: AAACTTGGCAATGTTGGAGG. Inner Left Sequence: GAGGAGATGATGAGTTCGGG. Inner Right Sequence: GGAATATACGTTGAGACGCCA. Inner Primer PCR Length: 1099 bp. Deletion Size: 432 bp. Deletion left flank: GGACACAAAGGAGAAGATATACCTGACGGT. Deletion right flank: CACATTGCCATCTTCATATGCTTCATCGGC. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2178 sre-48(ok2945) II. C. elegans Y39G8B.3. Homozygous. Outer Left Sequence: AGGTGCACACCTTTTTGCAT. Outer Right Sequence: ACCTTTTGGAAAAATTGCGA. Inner Left Sequence: AGCGACTGGGTGAAACAGAA. Inner Right Sequence: GCACCTGAATAATGCGAAAAA. Inner Primer PCR Length: 1272 bp. Deletion Size: 508 bp. Deletion left flank: GTCTCTGTCTCCTTTTTCAGCTCTTCGCAC. Deletion right flank: AGAATTTTCTAGAATTTTCCAAAAGGTTTC. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2179 F59A3.10(ok2955) I. C. elegans F59A3.10 Homozygous. Outer Left Sequence: ttgccgaaaataagtttgcc. Outer Right Sequence: ttagtgtcgtcagtggggaa. Inner Left Sequence: acggctatttcctctgaacg. Inner Right Sequence: tcaaaatgggtcaaaaagaaaaa. Inner Primer PCR Length: 1236. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2180 W07B8.1(ok2956) V. C. elegans W07B8.1. Homozygous. Outer Left Sequence: TGTGGGAATTTGCCAAAACT. Outer Right Sequence: GTCGACCTGTTGCGACCTAT. Inner Left Sequence: GGCCGGAAATTATTAGGTCA. Inner Right Sequence: ACTTTCAGCCACTTTCGTCG. Inner Primer PCR Length: 1352 bp. Deletion Size: 561 bp. Deletion left flank: CACGGTATTCCTACCGGAGGATCCTATGAA. Deletion right flank: AACTTCCAGTTATTGCAAAAGAAAAACGGA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2181 ZK643.3(ok2957) III. C. elegans ZK643.3. Homozygous. Outer Left Sequence: AACTCGCAAAGCTCCAAAAA. Outer Right Sequence: TCGCTTCAAGACCCAGTACC. Inner Left Sequence: CTATTCTAACGGCTCGCCAA. Inner Right Sequence: CCGATCCATTTCAATTTGCT. Inner Primer PCR Length: 1177 bp. Deletion Size: 534 bp. Deletion left flank: CTCATCTCATGTCTCTTATACGGAGCATTC. Deletion right flank: ATAGAATTCCAAGCATTGGATAATGATTAA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2182 ZK632.3(ok2958) III. C. elegans ZK632.3. Homozygous. Outer Left Sequence: CGCTCATCGTCAGTGAAAAA. Outer Right Sequence: GTCAGTTTTGCGGATGTCCT. Inner Left Sequence: CCCATTCCACGTTTTTGAGT. Inner Right Sequence: ACTTGCTCTTCAACGCCATT. Inner Primer PCR Length: 1108 bp. Deletion Size: 371 bp. Deletion left flank: GCCGACCATATCGCCTGTTGGAAGGGTGTT. Deletion right flank: AAGACGAGAATTCGTTGCATTTTCCTCATC. Insertion Sequence: TCCCTTCCAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2183 grl-16(ok2959) I. C. elegans Y65B4BR.6. Homozygous. Outer Left Sequence: AACTGAAGTGTGGGTGAGGG. Outer Right Sequence: TCATTCGGAAATGAACACGA. Inner Left Sequence: GGAGTGGTGCGAATCTGACT. Inner Right Sequence: CTTCCCCCTATTCTGCAACA. Inner Primer PCR Length: 1236 bp. Deletion Size: 473 bp. Deletion left flank: TCCGGCGTTGTAGCCTCCTTGTGGGGCGAC. Deletion right flank: AAGTAGAATGGACTTTGTCGCTCCTTAAGG. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2184 F10A3.1(ok2960) V. C. elegans F10A3.1. Homozygous. Outer Left Sequence: TGCGGACTGCAAATAAAGTG. Outer Right Sequence: CGTGTGCTTTGTACGCTGAT. Inner Left Sequence: TCCCGTTTCTACTTGGTTTTT. Inner Right Sequence: TTCCGAAACAAAATGCACAA. Inner Primer PCR Length: 1208 bp. Deletion Size: 327 bp. Deletion left flank: TTCAGGGTAAGCACTAAATTGAGTTCCGTG. Deletion right flank: GTGTGTAAGCAAGTGCGTTATGAAATTGTG. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2185 glt-4(ok2961) X. C. elegans T22E5.2. Homozygous. Outer Left Sequence: GCCTCATTGGATTCTGGAAC. Outer Right Sequence: TTTTATCGGATTACGGCGAG. Inner Left Sequence: GCAGGAAGATTAGGAATGGTG. Inner Right Sequence: GCCAAAAAGCTCAAAATTGG. Inner Primer PCR Length: 1130 bp. Deletion Size: 343 bp. Deletion left flank: ATCGGATGGGTCATTATGTAATATTGAAAT. Deletion right flank: TTAATCTTGACTCGAATCGAGAATGATAGG. Insertion Sequence: TTAATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2186 H25K10.5(ok2962) IV. C. elegans H25K10.5. Homozygous. Outer Left Sequence: TGGGCCCTAACGCATACTAC. Outer Right Sequence: CCGGTTGTACAGCCCTACTC. Inner Left Sequence: CGGTTATCTAGGTGTGGCCT. Inner Right Sequence: AGGCGAAACTCACTACATCCA. Inner Primer PCR Length: 1227 bp. Deletion Size: 570 bp. Deletion left flank: TGATAAAACTCACTTCCACACTTTCGAGCC. Deletion right flank: TGTCACATAGAAAACGAAAGTATAATCCTT. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2187 lgc-47(ok2963) X. C. elegans F47A4.1. Homozygous. Outer Left Sequence: GCCCGAAGAAGATTACCAAA. Outer Right Sequence: ACGACCCAACGAACAGAAAC. Inner Left Sequence: TCCTTTCATTCTTTTGCTCACA. Inner Right Sequence: AAGCGGAAAGTGTTTCTCCTC. Inner Primer PCR Length: 1179 bp. Deletion Size: 521 bp. Deletion left flank: GTCATATAGGTTGGAATGTAACCTTGCAAG. Deletion right flank: TACTAAAGTTTGTCATTGTGAAATCAGGTA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2188 flp-20(ok2964) X. C. elegans E01H11.3 Homozygous. Outer Left Sequence: ccgattgccaaaacgattac. Outer Right Sequence: agcccgcttccttcatagtt. Inner Left Sequence: tcatgaagctatcggaagatca. Inner Right Sequence: tcctccatcaccagacaaca. Inner Primer PCR Length: 1194. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2189 Y41E3.3(ok2969) IV. C. elegans Y41E3.3 Homozygous. Outer Left Sequence: ctcggcacatatttcggttt. Outer Right Sequence: atatgcccagtcaactccca. Inner Left Sequence: gaaattttcccgaactttcaa. Inner Right Sequence: aaaaagtttcccaaaaaccg. Inner Primer PCR Length: 1098. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2191 C35D10.11(ok2971) III. C. elegans C35D10.11 Homozygous. Outer Left Sequence: ttacatgggtgcaaatgtcg. Outer Right Sequence: ataccccaacataatgccca. Inner Left Sequence: ttcagcttctccgccactac. Inner Right Sequence: caactgaacacgtcattgtgg. Inner Primer PCR Length: 1257. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2192 grd-10(ok2972) IV. C. elegans F09D12.1 Homozygous. Outer Left Sequence: tcgtcatctttttgtcgctg. Outer Right Sequence: attgaaccaatagttgcggg. Inner Left Sequence: ttcttgtgttccaaaagggc. Inner Right Sequence: ttgagatagggtaaaagaagatcg. Inner Primer PCR Length: 1202. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2193 F44G3.2(ok2973) V. C. elegans F44G3.2 Homozygous. Outer Left Sequence: tgcacagattggtcttcgac. Outer Right Sequence: aggtccaaatgatgtcagcc. Inner Left Sequence: tttcaactctgtgtcttggca. Inner Right Sequence: ccgcattattcgttaagggt. Inner Primer PCR Length: 1144. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2194 math-33(ok2974) V. C. elegans H19N07.2 Homozygous. Outer Left Sequence: gaaagttcgcggactgaatc. Outer Right Sequence: cttgtcggtcattgtgtcgt. Inner Left Sequence: cgtgcattcgaagcttacac. Inner Right Sequence: cgaaaaatagaaggtcccct. Inner Primer PCR Length: 1180. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2195 C16E9.2(ok2975) X. C. elegans C16E9.2 Homozygous. Outer Left Sequence: tgttgctgaagcaattcgac. Outer Right Sequence: ccccctttgaaaacaagaca. Inner Left Sequence: gttggcaacacagcaaggta. Inner Right Sequence: cagctcgttctcctcgtttc. Inner Primer PCR Length: 1373. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2196 K08D10.14(ok2976) IV. C. elegans K08D10.14 Homozygous. Outer Left Sequence: aatttagcgtacgccactcg. Outer Right Sequence: aggagaatgtggtaaggcga. Inner Left Sequence: agcacgcgctttgtgttt. Inner Right Sequence: agaccaaattctgtgggtgtg. Inner Primer PCR Length: 1275. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2197 srw-99(ok2977) V. C. elegans Y46H3C.2 Homozygous. Outer Left Sequence: tttcgtcgctgtagttcgtg. Outer Right Sequence: gggaattcctggccatttac. Inner Left Sequence: gctggcaagcgtcagatac. Inner Right Sequence: cagtggcgagcgttaacata. Inner Primer PCR Length: 1122. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2198 C27B7.7(ok2978) IV. C. elegans C27B7.7 Homozygous. Outer Left Sequence: catgacgtcggttacactgg. Outer Right Sequence: ctccgggtcctgaaacatta. Inner Left Sequence: gccaaatctgtttgaagaactg. Inner Right Sequence: gcatggattcgtgtcttcct. Inner Primer PCR Length: 1143. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2199 K06A4.3(ok2979) V. C. elegans K06A4.3 Homozygous. Outer Left Sequence: gccaccagagagtggaagac. Outer Right Sequence: gaaatacgatggttgtgggg. Inner Left Sequence: gaatcaagggaatggctcgt. Inner Right Sequence: gttctgcacggatcgaactt. Inner Primer PCR Length: 1119. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2200 gst-24(ok2980) II. C. elegans F37B1.1 Homozygous. Outer Left Sequence: gcgacgattcatggtctttt. Outer Right Sequence: ctctccctcccctcaatttc. Inner Left Sequence: caaactccccaggtgtgact. Inner Right Sequence: ggagattttcgaaacgactttg. Inner Primer PCR Length: 1156. Deletion size: about 600 bp. ttggtcagctcccattcctc [ 603 bp deletion] caagttatctaggcacgagg -- Wild type ttggtcagctcccattcctc ------------------ caagttatctaggcacgagg -- ok2980 Sequence shown is on the minus strand. Deletion starts in the second exon and removes the downstream part of that exon, the 3'-UTR, and approximately 0.1 kb of downstream flanking sequence. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2201 M60.6(ok2981) X. C. elegans M60.6 Homozygous. Outer Left Sequence: cacgtacgaaaccccaaagt. Outer Right Sequence: agttgcacaatccttttcgc. Inner Left Sequence: ttctcctgagaaagaatttggttt. Inner Right Sequence: gttatcggaaacaacgacgg. Inner Primer PCR Length: 1302. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2202 vit-4(ok2982) X. C. elegans F59D8.2 Homozygous. Outer Left Sequence: cagcgtgagcattttgagaa. Outer Right Sequence: caaagctgaggtcaacccat. Inner Left Sequence: cgaagacggtttcgaatgat. Inner Right Sequence: tcaaggctatcgagatagagca. Inner Primer PCR Length: 1165. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2203 F01G12.6(ok2983) X. C. elegans F01G12.6 Homozygous. Outer Left Sequence: ttgggacgagaaaatgaagg. Outer Right Sequence: ccaagttgagggtctcggta. Inner Left Sequence: ttgtgcatgggagaagttga. Inner Right Sequence: tgcaacattcataaaaatgcaa. Inner Primer PCR Length: 1279. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2204 W10G6.1(ok2984) X. C. elegans W10G6.1 Homozygous. Outer Left Sequence: tgcatgcaactggaaacatt. Outer Right Sequence: ttatcacgtcggaagaggct. Inner Left Sequence: tgtgaatcagcagaaatgtcaa. Inner Right Sequence: accttcaactgcaggacgat. Inner Primer PCR Length: 1190. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2205 hex-2(ok2985) V. C. elegans C14C11.3 Homozygous. Outer Left Sequence: acactcggttttcggctatg. Outer Right Sequence: tttcccaccaagcacctaac. Inner Left Sequence: atttccagaatccttgcgtg. Inner Right Sequence: agcgcatttttctgcatctc. Inner Primer PCR Length: 1120. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2206 T25D3.3(ok2986) II. C. elegans T25D3.3 Homozygous. Outer Left Sequence: caaaattggagccaaaggaa. Outer Right Sequence: tctcgaacgtcttcgtgatg. Inner Left Sequence: gacccgagagcgtgatttta. Inner Right Sequence: ttggtgacaaaatgttcgga. Inner Primer PCR Length: 1186. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2207 K08F8.1(ok2987) II. C. elegans K08F8.1 Homozygous. Outer Left Sequence: cagaatcacgccatgagcta. Outer Right Sequence: tcgtgtgggaacgcataata. Inner Left Sequence: tggtgattgggggttaagaa. Inner Right Sequence: agcgacacctttcatcgagt. Inner Primer PCR Length: 1298. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2208 H22K11.2(ok2990) X. C. elegans H22K11.2 Homozygous. Outer Left Sequence: cttggtggctcatcaggaat. Outer Right Sequence: gtaaagggcaccctgaacaa. Inner Left Sequence: ggaaagtaccggagcagtga. Inner Right Sequence: ttggcacgtttttaattttgg. Inner Primer PCR Length: 1266. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2209 ZK1240.2(ok2991) II. C. elegans ZK1240.2 Homozygous. Outer Left Sequence: tgtagtggttttgctctgcg. Outer Right Sequence: cttggcgatacagttggctt. Inner Left Sequence: aattgccagacgacaaatcc. Inner Right Sequence: tggccggaaattagcataaa. Inner Primer PCR Length: 1130. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2210 C04G2.8(ok2992) IV. C. elegans C04G2.8 Homozygous. Outer Left Sequence: tgtcctgggtaggttgggta. Outer Right Sequence: atcccgaatctgtccaatca. Inner Left Sequence: gaccttttcacgaggcaatc. Inner Right Sequence: ggtccttcgacaaccatagc. Inner Primer PCR Length: 1314. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2211 F44G3.2(ok2993) V. C. elegans F44G3.2 Homozygous. Outer Left Sequence: tgcacagattggtcttcgac. Outer Right Sequence: aggtccaaatgatgtcagcc. Inner Left Sequence: tttcaactctgtgtcttggca. Inner Right Sequence: ccgcattattcgttaagggt. Inner Primer PCR Length: 1144. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2212 M02D8.1(ok2994) X. C. elegans M02D8.1 Homozygous. Outer Left Sequence: gataaaccacttgccggaga. Outer Right Sequence: tgtgcatgggacacaaagtt. Inner Left Sequence: ccgatggagagaacagctcta. Inner Right Sequence: tcgaaaatcagaagcaacga. Inner Primer PCR Length: 1159. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2213 C09F9.2(ok2995) II. C. elegans C09F9.2 Homozygous. Outer Left Sequence: aatccactgctccaacaacc. Outer Right Sequence: gtgactccatcctcctggaa. Inner Left Sequence: aagtgtgaacggggatgtct. Inner Right Sequence: aggtgtagccttcgatggtg. Inner Primer PCR Length: 1257. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2214 C16E9.2(ok2996) X. C. elegans C16E9.2 Homozygous. Outer Left Sequence: tgttgctgaagcaattcgac. Outer Right Sequence: ccccctttgaaaacaagaca. Inner Left Sequence: gttggcaacacagcaaggta. Inner Right Sequence: cagctcgttctcctcgtttc. Inner Primer PCR Length: 1373. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2215 F40F9.2(ok2997) V. C. elegans F40F9.2 Homozygous. Outer Left Sequence: tcgctactttcccgcttaaa. Outer Right Sequence: tttcagtttgccatcacagc. Inner Left Sequence: tcgtaattatttgtgaaatgaaactt. Inner Right Sequence: cagaaccgtttcaggattgg. Inner Primer PCR Length: 1253. Deletion size: about 800bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2216 K07C6.4(ok2998) V. C. elegans K07C6.4 Homozygous. Outer Left Sequence: aattctctgctcgtcggaaa. Outer Right Sequence: tcaatatgcacacagcgaca. Inner Left Sequence: tcgaggccgaagataaggat. Inner Right Sequence: gctttttaggctttctcgtgg. Inner Primer PCR Length: 1143. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2217 R08C7.6(ok2999) IV. C. elegans R08C7.6 Homozygous. Outer Left Sequence: acggaacatttttcaaggca. Outer Right Sequence: accccaccaatcaacgataa. Inner Left Sequence: gcgacatttgcacaattaca. Inner Right Sequence: gagttggacgccactgattt. Inner Primer PCR Length: 1201. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2218 jac-1(ok3000) IV. C. elegans Y105C5B.21. Homozygous. Outer Left Sequence: ACATCTCACGGGTTCCACTC. Outer Right Sequence: TCGTAAGATTCAGCGCAATG. Inner Left Sequence: AAGTTCCCGATTCCTTGGAT. Inner Right Sequence: GCGTTCTACCAAAGCTACCG. Inner Primer PCR Length: 1249 bp. Deletion Size: 456 bp. Deletion left flank: CTCAAGGATCACAGGCTTCAACATATCCGC. Deletion right flank: AAACAAAGTTTTGAGCTTTTAACGTAAGTT. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2219 C28C12.9(ok3004) IV. C. elegans C28C12.9 Homozygous. Outer Left Sequence: tcgtcgatcaatcctgacaa. Outer Right Sequence: cgttaatacttcgtggccgt. Inner Left Sequence: caacgaagactctagggcgt. Inner Right Sequence: cccggccatattatttttga. Inner Primer PCR Length: 1333. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2220 R13H9.5(ok3005) IV. C. elegans R13H9.5 Homozygous. Outer Left Sequence: aatgaactcaaaacgggacg. Outer Right Sequence: tgtaatgacgcttgtcggaa. Inner Left Sequence: cggttccagtccagtctgat. Inner Right Sequence: agtctttgcaggtaaatacgagtt. Inner Primer PCR Length: 1218. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2221 Y113G7B.14(ok3006) V. C. elegans Y113G7B.14 Homozygous. Outer Left Sequence: ggacccctgacatgaacttg. Outer Right Sequence: gtctcgaaagtcgtcttggc. Inner Left Sequence: tgtccgacaatgagaatgga. Inner Right Sequence: tttcatcatcggaacaagca. Inner Primer PCR Length: 1147. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2222 fkb-2(ok3007) I. C. elegans Y18D10A.19 Homozygous. Outer Left Sequence: agtcgaagctcacgattgct. Outer Right Sequence: cggagatttcgacttcaagg. Inner Left Sequence: ccgtagccaggagaaaaatg. Inner Right Sequence: ttatggagaggttgcacacg. Inner Primer PCR Length: 1148. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2223 grd-10(ok3008) IV. C. elegans F09D12.1 Homozygous. Outer Left Sequence: tcgtcatctttttgtcgctg. Outer Right Sequence: attgaaccaatagttgcggg. Inner Left Sequence: ttcttgtgttccaaaagggc. Inner Right Sequence: ttgagatagggtaaaagaagatcg. Inner Primer PCR Length: 1202. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2224 F38B6.6(ok3009) X. C. elegans F38B6.6 Homozygous. Outer Left Sequence: aaacgtgtaccgagattcgc. Outer Right Sequence: tggtgaatggatttgaagca. Inner Left Sequence: aacaaaactgaagttggattcagaaacaaaactgaagttggattcaga. Inner Right Sequence: gggatgcatttcctccatta. Inner Primer PCR Length: 1214. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2225 col-179(ok3010) X. C. elegans C34F6.3 Homozygous. Outer Left Sequence: cctgccactaaagagaacgc. Outer Right Sequence: gcggaaacaaggattatgga. Inner Left Sequence: ggttgcaaagtgattgcaga. Inner Right Sequence: tggtaagaaacgttcacgca. Inner Primer PCR Length: 1291. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2226 ZC416.2(ok3011) IV. C. elegans ZC416.2 Homozygous. Outer Left Sequence: ctggggtcaaaagtcggtta. Outer Right Sequence: gttaaaattgtctgccgcgt. Inner Left Sequence: tcccaaactccaatttccag. Inner Right Sequence: gcatcggggtgactcttact. Inner Primer PCR Length: 1235. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2227 K06H6.3(ok3012) V. C. elegans K06H6.3 Homozygous. Outer Left Sequence: gcaaatactgaacccgcaat. Outer Right Sequence: ccgacgaatttttcagcatt. Inner Left Sequence: ttttatttcggattgccagg. Inner Right Sequence: ttttcaaagtagacgccttcaa. Inner Primer PCR Length: 1395. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2228 klp-20(ok3013) III. C. elegans Y50D7A.6 Homozygous. Outer Left Sequence: atcacaacgggaatctggag. Outer Right Sequence: ttcaacggcaaaaatgttca. Inner Left Sequence: gaatttggaatcctcccgat. Inner Right Sequence: tcatatttctcacctcaatttctca. Inner Primer PCR Length: 1132. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2229 cyn-7(ok3014) V. C. elegans Y75B12B.2 Homozygous. Outer Left Sequence: acttccggattgttgacctg. Outer Right Sequence: agctcatccgtgtgcttctt. Inner Left Sequence: gtgaagagctggcaacaatg. Inner Right Sequence: tgattcccgctctattaccg. Inner Primer PCR Length: 1175. Deletion size: about 600 bp. cyn-7 was formerly known as cyp-7. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2230 ZC395.10(ok3015) III. C. elegans ZC395.10 Homozygous. Outer Left Sequence: cttgcccatggaaactgatt. Outer Right Sequence: caatgccattcgcacttaaa. Inner Left Sequence: gaaaaacgaatgcgggataa. Inner Right Sequence: tcttgcttgttattgccgtg. Inner Primer PCR Length: 1195. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2231 F47A4.1(ok3016) X. C. elegans F47A4.1 Homozygous. Outer Left Sequence: gcccgaagaagattaccaaa. Outer Right Sequence: acgacccaacgaacagaaac. Inner Left Sequence: tcctttcattcttttgctcaca. Inner Right Sequence: aagcggaaagtgtttctcctc. Inner Primer PCR Length: 1179. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2232 grl-17(ok3017) V. C. elegans C56A3.1 Homozygous. Outer Left Sequence: tgattggcacatagtcggaa. Outer Right Sequence: ctacgttcaaagcggaggag. Inner Left Sequence: aaatgacagattgaagcggg. Inner Right Sequence: gaaaaacatggcaaccttcc. Inner Primer PCR Length: 1162. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2233 Y50D7A.10(ok3020) III. C. elegans Y50D7A.10. Homozygous. Outer Left Sequence: CCGCCCCTTTAATAGAAACC. Outer Right Sequence: GTACGAGGAGTCCGCACATT. Inner Left Sequence: TTTGTTTTCCGCCTGTTTTC. Inner Right Sequence: ATATTTGCCAAGAAAGGGGC. Inner Primer PCR Length: 1152 bp. Deletion Size: 741 bp. Deletion left flank: TTTTTTTGCGAAAATCTCGGCTTTTTCACC. Deletion right flank: TGTAGAGCTAAACTTAAACGAAAAATGGTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2234 E04A4.6(ok3021) IV. C. elegans E04A4.6. Homozygous. Outer Left Sequence: GAGACATGCGTCAGCAAAGA. Outer Right Sequence: GCAATTTCAGCATCCGATTT. Inner Left Sequence: GCTTGCGTCCTTCTTGACTT. Inner Right Sequence: TGGAACTCAAAATGTGATAACGA. Inner Primer PCR Length: 1379 bp. Deletion Size: 515 bp. Deletion left flank: AAGGAAGAACACAGGAGATGGTGCAATAGA. Deletion right flank: CTGTCATATTCCTTTTCGTTATCACATTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2235 cyp-35B1(ok3022) V. C. elegans K07C6.4. Homozygous. Outer Left Sequence: AATTCTCTGCTCGTCGGAAA. Outer Right Sequence: TCAATATGCACACAGCGACA. Inner Left Sequence: TCGAGGCCGAAGATAAGGAT. Inner Right Sequence: GCTTTTTAGGCTTTCTCGTGG. Inner Primer PCR Length: 1144 bp. Deletion Size: 480 bp. Deletion left flank: ATCTCTGGTTAGCTGGTCAAGATACCACTT. Deletion right flank: TTGGAAATCTTATCCTGCGATATGACATTA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2236 ZK1236.1(ok3023) III. C. elegans ZK1236.1 Homozygous. Outer Left Sequence: taattgaccgtgttccagca. Outer Right Sequence: ttgagtcgttccattcctcc. Inner Left Sequence: tatttcgatcattttcgcgg. Inner Right Sequence: ccaccaaagtttcccttcaa. Inner Primer PCR Length: 1178. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2237 tub-2(ok3024) I. C. elegans Y71G12A.3. Homozygous. Outer Left Sequence: AGGCGACTTCTCTCCCTCTC. Outer Right Sequence: TCATCATTATCGCCGATTCA. Inner Left Sequence: GTGTGTGTGTGTGTGTGCGT. Inner Right Sequence: TCCTTTCCACCAACGGATTA. Inner Primer PCR Length: 1267 bp. Deletion Size: 522 bp. Deletion left flank: GGTGTTAGGCTTTTCCACTGGAACTATTCA. Deletion right flank: TAAGCTGCCGATTCCACTCAAGGAGATGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2238 C25F6.6(ok3025) X. C. elegans C25F6.6. Homozygous. Outer Left Sequence: AAAGACGATGGAGGCAAATG. Outer Right Sequence: CCCCTAGGTGGCTTGACTTT. Inner Left Sequence: CAACATCTTCACCGTCACCA. Inner Right Sequence: CAACGTCACAATTCACTTGC. Inner Primer PCR Length: 1278 bp. Deletion Size: 637 bp. Deletion left flank: ATGCGGGACTCAAACTTCTGAGTGAAAAGT. Deletion right flank: AAAAAAATAGAATGTTACTAAGGACAAGGA. Insertion Sequence: ATAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2239 W03G1.5(ok3026) IV. C. elegans W03G1.5. Homozygous. Outer Left Sequence: TCGAGATGTCTTCGCCTTTT. Outer Right Sequence: GTGGTGAAGCTGTACGCTGA. Inner Left Sequence: GGAGTCTGGTGGAAATTGGA. Inner Right Sequence: GGTGAGAAGGATCTGAAGGG. Inner Primer PCR Length: 1356 bp. Deletion Size: 612 bp. Deletion left flank: TCCATGGCGTCCTGGACAATGTGGTGGGCC. Deletion right flank: TCATTTTCGTCATCGCTGCTTTCCGATCCT. Insertion Sequence: TCG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2240 sams-1(ok3033) X. C. elegans C49F5.1. Homozygous. Outer Left Sequence: AGGACTTGCGAGAGTACGGA. Outer Right Sequence: CTTGAGAGCTTTTGGCTGCT. Inner Left Sequence: AGTGAATCTGTGTCCGAGGG. Inner Right Sequence: GGGAACTCAGAGTGACCGAA. Inner Primer PCR Length: 1248 bp. Deletion Size: 480 bp. Deletion left flank: ACTCCGCGTTCACACTGTTGTGGTCTCTAC. Deletion right flank: TAGATAGGAGAAATTTCATTGGTTTTTTAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2241 Y116A8C.5(ok3034) IV. C. elegans Y116A8C.5. Homozygous. Outer Left Sequence: ACGAATGTTGATCGGTGACA. Outer Right Sequence: AAATGTGGCTCTTTTGCAGC. Inner Left Sequence: GCTGCCAGGATTTATGCTTC. Inner Right Sequence: GCCGACACTTTTTGGGTTT. Inner Primer PCR Length: 1161 bp. Deletion Size: 672 bp. Deletion left flank: GGTAAGTTCCTAGCACTCTGGTTTCCAACT. Deletion right flank: TCTAGACGATTTGGCAGAGTATGTTAATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2242 bbs-2(ok3035) IV. C. elegans F20D12.3 Homozygous. Outer Left Sequence: gaatcggatcaaggacctca. Outer Right Sequence: tatgtggatcaacgttgcca. Inner Left Sequence: tggatgataatgtcgaacttgc. Inner Right Sequence: tttacacatctcaaaaatcagtgaa. Inner Primer PCR Length: 1215. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2243 lact-4(ok3036) II. C. elegans M05D6.4. Homozygous. Outer Left Sequence: ACTGTTGGGCCATACTCGAC. Outer Right Sequence: AGCAAAAATGCGCTTCATCT. Inner Left Sequence: CAATTGGAGAGAAGCCGAAG. Inner Right Sequence: AAAACAATGGCAAGATATAAACTGT. Inner Primer PCR Length: 1228 bp. Deletion Size: 539 bp. Deletion left flank: ATTGTGTTCAAATTCTTTAAGCATAAAACC. Deletion right flank: ATGCTCAATTGAAAACATTAAGTTTTTATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2244 grl-9(ok3038) V. C. elegans ZC487.4. Homozygous. Outer Left Sequence: CGATGTGATTTATTGCACGG. Outer Right Sequence: CTCTCCTGGCTTTTACGCAG. Inner Left Sequence: GTGAATGGAGGAAAGCGAAG. Inner Right Sequence: CCGAATGGACAAGTTGGAAG. Inner Primer PCR Length: 1291 bp. Deletion Size: 253 bp. Deletion left flank: GTGGAAGTTGAACCTGTTGCTGTTGCAGTT. Deletion right flank: AATTTTAGGCGAGTGAACACACAAAAGTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2245 C47D12.8(ok3039) II. C. elegans C47D12.8 Homozygous. Outer Left Sequence: ctcaacgccttccaagactc. Outer Right Sequence: caggatcccataaaggctca. Inner Left Sequence: tttgtaccgcgaaaagaagc. Inner Right Sequence: tgaaaatggcgagaaaaacc. Inner Primer PCR Length: 1181. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2246 T11F1.9(ok3040) II. C. elegans T11F1.9. Homozygous. Outer Left Sequence: ATTCCCGCTGTGATGAAAAG. Outer Right Sequence: CCGCAGATTTCAACAAGGAT. Inner Left Sequence: GAAGATGATGTACTCACTCCCAA. Inner Right Sequence: TGAAAGAACTCAAAGCGCAA. Inner Primer PCR Length: 1360 bp. Deletion Size: 675 bp. Deletion left flank: TATGAAATGATAAGGAGACTTACGGCAATC. Deletion right flank: TTCCAAGTTTTCCCCAAAATGATTCGAATG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2247 eat-17(ok3041) X. C. elegans T24D11.1. Homozygous. Outer Left Sequence: GGATTGAAGTGGCTTTCCAA. Outer Right Sequence: AGAGTCAAATGCCGAAAAGC. Inner Left Sequence: TTTTCAGGCAAAATGCAGC. Inner Right Sequence: AGGCTCAAGTAGGCTCAAGTG. Inner Primer PCR Length: 1237 bp. Deletion Size: 856 bp. Deletion left flank: AGATTGAGAGAAAATGGGAATGGATCGGAG. Deletion right flank: TGATAACGTTGAACAGAAGTGATTGGCCTC. Insertion Sequence: TGGGAATGGATCGGAGTGGATCGGAAATGGAATGGATCGGAAATGGGAATGGATCGGAG . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2248 gst-24(ok3042) II. C. elegans F37B1.1. Homozygous. Outer Left Sequence: GCGACGATTCATGGTCTTTT. Outer Right Sequence: CTCTCCCTCCCCTCAATTTC. Inner Left Sequence: CAAACTCCCCAGGTGTGACT. Inner Right Sequence: GGAGATTTTCGAAACGACTTTG. Inner Primer PCR Length: 1157 bp. Deletion Size: 555 bp. Deletion left flank: TCATTAACCTTCTCACGGAGCGCTGCAAGC. Deletion right flank: AGTTATACAAATACCACTAAAAATGTTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2249 F32H2.6(ok3043) I. C. elegans F32H2.6. Homozygous. Outer Left Sequence: GGAAGACGAGCTTCCAGATG. Outer Right Sequence: TCTCGACGGTTTCCGTTATC. Inner Left Sequence: GAGGAAGAAGCTCAGGGTCC. Inner Right Sequence: CATCTGTGCCGTGCAGTAAT. Inner Primer PCR Length: 1288 bp. Deletion Size: 380 bp. Deletion left flank: ATGCCACCGAACATTTTGACTTCTTTATTA. Deletion right flank: GACGACTATCCTTTGTGGCAAAAGAAGAGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2250 puf-6(ok3044) II. C. elegans F18A11.1. Homozygous. Outer Left Sequence: GCGAAATTTCACGTTTTTCC. Outer Right Sequence: AAAATCCGCAGCAATGAAAG. Inner Left Sequence: AATACGGTACCCGGGGTCT. Inner Right Sequence: TTGGTCTTTTTAGGCCTTGC. Inner Primer PCR Length: 1113 bp. Deletion Size: 722 bp. Deletion left flank: TTTAAAGGCGCACTTTTTTCGAATTTAACC. Deletion right flank: GAGAGGAAATGCACGAAAAAGGTCCACATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2251 cpg-8(ok3045) V. C. elegans K03B4.7. Homozygous. Outer Left Sequence: TCGAGGATCTCAAGGATTGG. Outer Right Sequence: CCAAATAGACCCGCAACATT. Inner Left Sequence: CTCGACTCGTTGACGACCTT. Inner Right Sequence: TTTGATCTACTCTTTTAGCCAGTTT. Inner Primer PCR Length: 1258 bp. Deletion Size: 979 bp. Deletion left flank: TGCTTTGAGCAAAAAAAATTGAAAGAACGT. Deletion right flank: GTGCGGGGAGAGTGACCAGAAACTGATGAG. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2252 nas-3(ok3046) V. C. elegans K06A4.1. Homozygous. Outer Left Sequence: CTTAAAGGTCGAAGCATGGC. Outer Right Sequence: TGTTGAAGCACAAAGATCGG. Inner Left Sequence: TTCACCCACTCCAACTTCTAA. Inner Right Sequence: CGGCGCTTTCTGAAATAAAA. Inner Primer PCR Length: 1162 bp. Deletion Size: 377 bp. Deletion left flank: CTCCGAACCACCAAAGGATGACGATATCGC. Deletion right flank: TGGCTCTTCGGAACTCGTGATGGAAAAGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2253 ZK896.9(ok3050) IV. C. elegans ZK896.9. Homozygous. Outer Left Sequence: GGCTCACAAAAGCAGAAACC. Outer Right Sequence: TGCCCATTTTCCACTTTTTC. Inner Left Sequence: TCAAATACTCATCACTGGTGGTTC. Inner Right Sequence: ACGGTCACTCGTCCATTTTC. Inner Primer PCR Length: 1146 bp. Deletion Size: 590 bp. Deletion left flank: TTGCCAAGTGAGATTATTAGCTTAAAATCC. Deletion right flank: ATCACGAATTCTTCGTCAACTGGAGGGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2254 scrm-8(ok3051) IV. C. elegans K08D10.7. Homozygous. Outer Left Sequence: GCAATTAGCTTAACGTCCGC. Outer Right Sequence: GTTTGCAAGTGAAATGGGCT. Inner Left Sequence: GTCACCTGAGGAGGTTGAGC. Inner Right Sequence: ACATCTCCTGCATGAATCCC. Inner Primer PCR Length: 1122 bp. Deletion Size: 407 bp. Deletion left flank: GACTGTAAGTCATTCTAGCTAATGGTGACC. Deletion right flank: CAGTAATAACTACAGTACTACATTAAACTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2255 ZC395.10(ok3052) III. C. elegans ZC395.10. Homozygous. Outer Left Sequence: CTTGCCCATGGAAACTGATT. Outer Right Sequence: CAATGCCATTCGCACTTAAA. Inner Left Sequence: GAAAAACGAATGCGGGATAA. Inner Right Sequence: TCTTGCTTGTTATTGCCGTG. Inner Primer PCR Length: 1196 bp. Deletion Size: 816 bp. Deletion left flank: AAGAATTAAATTAGAGAAATTCAAATTGTA. Deletion right flank: ATTCGAAAAGAGAACTAGACGGATACGAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2256 F55A4.1(ok3053) X. C. elegans F55A4.1. Homozygous. Outer Left Sequence: GCATTGGGACAGAGGAGGTA. Outer Right Sequence: TGCACTGACCAAAAGGAATG. Inner Left Sequence: ATGCACATCCCACAACACAT. Inner Right Sequence: GTGGCGACTGGCTTAAAAAT. Inner Primer PCR Length: 1221 bp. Deletion Size: 736 bp. Deletion left flank: TCCTTTCAATGCGTATTTCACCATCGTTTT. Deletion right flank: AAACACGCAATGAATACGGTATCCAATGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2257 apd-3(ok3058) II. C. elegans W09G10.4. Homozygous. Outer Left Sequence: CGGAAAATCGAAAAATGTCC. Outer Right Sequence: AAATCACCAATTTTCGCCAC. Inner Left Sequence: TCTCAATCTCCTGTTCCCTCA. Inner Right Sequence: ATTTTCCCCCAATTTTCCAG. Inner Primer PCR Length: 1120 bp. Deletion Size: 457 bp. Deletion left flank: GCTTTGAGCATTGATTCGAGCACACCTTGT. Deletion right flank: ACGGTTACATCTTGGATCTGGAAAATTGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2258 F17A2.3(ok3059) X. C. elegans F17A2.3. Homozygous. Outer Left Sequence: CGGGGCCTAAATATGAGGTT. Outer Right Sequence: ACCAGTGAAGGATTTGTGGC. Inner Left Sequence: GTACACGCCACGCAGTTTTA. Inner Right Sequence: GAACAACGTGAAAGTGGCAA. Inner Primer PCR Length: 1321 bp. Deletion Size: 578 bp. Deletion left flank: AAGCAAACAAACACGGTTGGAATAGGATCC. Deletion right flank: CACTAACGACAGCCTCGACACCACAGCATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2259 srh-16(ok3060) V. C. elegans F55C5.9 Homozygous. Outer Left Sequence: gcaggaaatgcattgtcaaa. Outer Right Sequence: cttcaagatgagccccaaaa. Inner Left Sequence: tctgattgtgataatcgccc. Inner Right Sequence: tccgtgaacgaatgtctgaa. Inner Primer PCR Length: 1173. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2260 alfa-1(ok3062) II. C. elegans F18A1.6. Homozygous. Outer Left Sequence: GTCGAGACCGAACACCGTAT. Outer Right Sequence: CCACATACGATGCGCTTAAA. Inner Left Sequence: GGCAATATTTTGTGCCTGGT. Inner Right Sequence: TGCCGCTGTTAAAAGACTGA. Inner Primer PCR Length: 1259 bp. Deletion Size: 486 bp. Deletion left flank: GTCATCATTCCAAATGCATCTTCATACTTT. Deletion right flank: GTACTTGTTGTAGCAGATTCAGTCATATAT. Insertion Sequence: CAATCATCCATTGTCAATGTTTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2262 acr-10(ok3064) X. C. elegans R02E12.8. Homozygous. Outer Left Sequence: GACATTTGACGGTTCCGTTT. Outer Right Sequence: GCGAAATTGTGCATTTCTTG. Inner Left Sequence: CGATCCGTAACTTGGAAACAA. Inner Right Sequence: GAATTAGGAGCACACGACCA. Inner Primer PCR Length: 1151 bp. Deletion Size: 386 bp. Deletion left flank: TACTCAAGAAGATGCATAGGTTAGTCCAGC. Deletion right flank: CGCAATGGCTTTAGACAGATTATGCTTACT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2263 Y23B4A.2(ok3065) X. C. elegans Y23B4A.2. Homozygous. Outer Left Sequence: TCGGCATTCTGTTAGGAAGC. Outer Right Sequence: ACGGAACAGATCTCCTCGAA. Inner Left Sequence: GACCGTAATCCCGTTCACAA. Inner Right Sequence: TGTATTTTGGTAACGCGTCG. Inner Primer PCR Length: 1292 bp. Deletion Size: 598 bp. Deletion left flank: TTCCTTTTCTGTCTTTTATTAATTTCCTTT. Deletion right flank: AAAATTTTGTTTTTCAGTAACAATTCCGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2264 C12C8.2(ok3066) I. C. elegans C12C8.2. Homozygous. Outer Left Sequence: GATGCGGAAATCCAACAACT. Outer Right Sequence: TCAAATGCAATCATTCCAGC. Inner Left Sequence: AATGAGATAGAAGGCGGTGC. Inner Right Sequence: GCATATTGATGCTGTGGGTG. Inner Primer PCR Length: 1191 bp. Deletion Size: 491 bp. Deletion left flank: GTTTTGGAGTTGAAATAACTTCTGTTGACG. Deletion right flank: AGTAAAAGACTTTAGTAAAAAGCTTCCAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2266 skr-5(ok3068) V. C. elegans F47H4.10 Homozygous. Outer Left Sequence: atttgttgggcggttatgaa. Outer Right Sequence: ccgtctccacatccatctct. Inner Left Sequence: ttgatttaagatggttgtggaaga. Inner Right Sequence: gcctccaccaactgaagaag. Inner Primer PCR Length: 1341. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2267 prk-2(ok3069) III. C. elegans F45H7.4. Homozygous. Outer Left Sequence: ACGCACGAATCATGTTCAAA. Outer Right Sequence: ACCGAGCATACTGGCTTGTT. Inner Left Sequence: TCTTACCGTATTCGAAGAACTCG. Inner Right Sequence: CTGATTGTGGGTTTCAAGCA. Inner Primer PCR Length: 1347 bp. Deletion Size: 617 bp. Deletion left flank: GAGTTTTGTGGAGCCGGTGACCAAGTCGAT. Deletion right flank: ATGAGCCTTAAATTTAAGCACAAAAATATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2268 cah-5(ok3070) X. C. elegans R173.1. Homozygous. Outer Left Sequence: ATTTTGCGTCTTCCATTTGC. Outer Right Sequence: CAACTTATTTGCGTGGGCTT. Inner Left Sequence: GCCTCCCCATCAAACACTAC. Inner Right Sequence: TTTGATTCCAAAACACAGGG. Inner Primer PCR Length: 1243 bp. Deletion Size: 320 bp. Deletion left flank: TAACATTGAAGATTACTGTCTATTCCTTCT. Deletion right flank: TCGCGAAGGTTTAACTCTAAAAGAAGCACT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2269 R09A1.5(ok3071) V. C. elegans R09A1.5. Homozygous. Outer Left Sequence: CCGTAATCGTTCCGCATTAT. Outer Right Sequence: GCCGAAATGGGACACTCTAA. Inner Left Sequence: CCAGGGAGTCTCTGTTCAGC. Inner Right Sequence: CTGTAGCAATAGTTTCAGCTGTG. Inner Primer PCR Length: 1333 bp. Deletion Size: 610 bp. Deletion left flank: CGGGCTATAGGCCTAGGCCAGGCTATAGGT. Deletion right flank: GTTCCTCGATGCACCATATCTTACGCGCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2270 nas-7(ok3080) II. C. elegans C07D10.4. Homozygous. Outer Left Sequence: AAATGTGTTACGGTGTGCGA. Outer Right Sequence: TCGCATTCGCATAGTTTCAG. Inner Left Sequence: CTCACATTTGACTTTCGGCA. Inner Right Sequence: CTTCTCCATGCTTTTGCCAT. Inner Primer PCR Length: 1205 bp. Deletion Size: 760 bp. Deletion left flank: TAATTGTTGCATATTCCATACATCCATTAT. Deletion right flank: TTAATGAATCTGTGCTATCTGATATAACAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2271 Y106G6H.14(ok3081) I. C. elegans Y106G6H.14. Homozygous. Outer Left Sequence: CAGCATCCGAGTCTGACAAA. Outer Right Sequence: GACCGTCTTCGTCCATCATT. Inner Left Sequence: TTCAGCATACTCTTCTTCATTCAC. Inner Right Sequence: GCGGACCGTTGACTTTCTAT. Inner Primer PCR Length: 1296 bp. Deletion Size: 333 bp. Deletion left flank: TCAACAACGTATCCACTGCTGGCGCGTGTC. Deletion right flank: TAAAAACTGTAAAACCATGTGAATTAATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2272 F49C5.4(ok3082) II. C. elegans F49C5.4. Homozygous. Outer Left Sequence: ATGCCCCGACCCTATAAACT. Outer Right Sequence: AGTCCCCTAGGTGGCTTGAT. Inner Left Sequence: GGTTTTGCACGGTTAAGAGC. Inner Right Sequence: TCATCAATCGCCTTCTTTTC. Inner Primer PCR Length: 1154 bp. Deletion Size: 661 bp. Deletion left flank: CACAAGTTATGAAAAATTCCAGAAAAAGTA. Deletion right flank: TTAATTTTCAGAGATACATCCTACGCCGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2273 C49D10.10(ok3083) II. C. elegans C49D10.10. Homozygous. Outer Left Sequence: TTTGAAATCCACACTTGGCA. Outer Right Sequence: TTTTGGCGGGAGAGAATAAA. Inner Left Sequence: AGCTCCGCAAATGACAATTC. Inner Right Sequence: TTCTCCGTTTCAAGATTTAGCA. Inner Primer PCR Length: 1256 bp. Deletion Size: 248 bp. Deletion left flank: TCAGTAGGATAATCAGATGTGATCTGAAAA. Deletion right flank: GAGCAGGTTTAATTTCCACAAATGCATCTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2274 clec-106&Y18D10A.23(ok3084) I. C. elegans Y18D10A.12, Y18D10A.23. Homozygous. Outer Left Sequence: ACCACGACTGGGAAGTTCAG. Outer Right Sequence: GCCTAACATCTGCCTTCTCG. Inner Left Sequence: ACTGGATTCTAGGCCCACG. Inner Right Sequence: GTTGCTCCATGCTACGTGAA. Inner Primer PCR Length: 1318 bp. Deletion Size: 719 bp. Deletion left flank: TTCTTCCGCCAACCCATACCTCGGCTGTTC. Deletion right flank: AATGCTCCGCAACAATGCAACGATCCACCC. Insertion Sequence: GCTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2275 flp-16(ok3085) II. C. elegans F15D4.8. Homozygous. Outer Left Sequence: TTTTCGAAGCCTGTTAGCGT. Outer Right Sequence: TTTAAGTTTCCACAGGCGCT. Inner Left Sequence: AAAGTCCTGAAAAAGAAGCAGC. Inner Right Sequence: TTGAAAACAACGGTCTCGAA. Inner Primer PCR Length: 1201 bp. Deletion Size: 548 bp. Deletion left flank: CCTAAATTTGATGAATGAGTGTGGATCCGA. Deletion right flank: CCTATAGGCATCATCCATCAAAACCCCACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2276 nas-19(ok3086) V. C. elegans K03B8.5. Homozygous. Outer Left Sequence: TACGTCATGTCGAGACTGGG. Outer Right Sequence: GAAAAATTCCCCACCGATTT. Inner Left Sequence: TGCTCAAGAATGAAAGCACG. Inner Right Sequence: TATTCCCCTCGATTTTTCGT. Inner Primer PCR Length: 1212 bp. Deletion Size: 785 bp. Deletion left flank: AGCCATTAATTCGTATGAATCTTGTTGTCT. Deletion right flank: GCGTAGGAAAAGAGTAGAATAATAGCTCCA. Insertion Sequence: ATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2277 ser-5(ok3087) I. C. elegans F16D3.7. Homozygous. Outer Left Sequence: GGATAAGTACGGGCAACGAA. Outer Right Sequence: AATGCGGAACGTTTGAACTC. Inner Left Sequence: TGGAGAACAATTACCCCCTG. Inner Right Sequence: AGATGATGGGATTGAGCATTG. Inner Primer PCR Length: 1119 bp. Deletion Size: 410 bp. Deletion left flank: ATTGTCACGAAAACAAAAGTAATATCAGTG. Deletion right flank: GAAAGACAAACGGGATGGTGGAGCATCAGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2278 chhy-1(ok3088) II. C. elegans T22C8.2. Homozygous. Outer Left Sequence: TCCATTGCATTTTGGAAACA. Outer Right Sequence: AGAGGAAAAAGAGGCGAAGG. Inner Left Sequence: TATCCCCATTTTGCATTTGG. Inner Right Sequence: GCCTGCACCATTTTCAGATT. Inner Primer PCR Length: 1114 bp. Deletion Size: 377 bp. Deletion left flank: AATCTTGATAATGCAATATACAGGACGTCA. Deletion right flank: GCTGCTCTTAAATGCCGAGAAAACTTATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2279 pde-5(ok3102) I. C. elegans C32E12.2. Homozygous. Outer Left Sequence: GTGGCTTCAACTGGAGAAGG. Outer Right Sequence: CTATGTTCCTGCCGGTTGAT. Inner Left Sequence: TCGGAGTTGTTCAAATGGTG. Inner Right Sequence: CAAATGTGTTGTTATCCAAAATGA. Inner Primer PCR Length: 1115 bp. Deletion Size: 410 bp. Deletion left flank: GAGTTGCATTGGAAGTATTGGCATATCATA. Deletion right flank: CCAAATTGGAGGTTAGATTTCCAGATTTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2280 skp-1(ok3103) V. C. elegans T27F2.1. Homozygous. Outer Left Sequence: ACGAGATCCTTGGTTTGGTG. Outer Right Sequence: TATCATCGTCCATTGCTCCA. Inner Left Sequence: GGACCAGTTTTCGACCAAGA. Inner Right Sequence: TCGAAGAAGGAACTGAAACCT. Inner Primer PCR Length: 1179 bp. Deletion Size: 716 bp. Deletion left flank: CCACCGCCGTACGGAAAACGGACCAGTTTT. Deletion right flank: TCTCCAACAGACTCATATTAATGAAAACTT. Insertion Sequence: TCGACCAAGAGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2281 lrx-1(ok3104) V. C. elegans T04H1.6. Homozygous. Outer Left Sequence: TGGAGGCTACGTTCCAAATC. Outer Right Sequence: TGAGAAGAAGGGAGGCAGAA. Inner Left Sequence: CTGTTCAGCAGCCATATCCA. Inner Right Sequence: CCACACATGAAACACCTCCA. Inner Primer PCR Length: 1313 bp. Deletion Size: 432 bp. Deletion left flank: AAGCTATTTTTATTTGTATGCTATCAATAT. Deletion right flank: GCCTCAATCCTGTATCCATGTGAGCAAACG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2282 Y106G6E.4(ok3105) I. C. elegans Y106G6E.4 Homozygous. Outer Left Sequence: cacctcggaaggctagaatg. Outer Right Sequence: ccgatccctgacgatatcaa. Inner Left Sequence: tcacaaaaccatttgaggaatg. Inner Right Sequence: ggcaaaacatttccatgtgc. Inner Primer PCR Length: 1244. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2283 lys-4(ok3106) IV. C. elegans F58B3.1. Homozygous. Outer Left Sequence: TGTTCACAATTGCGGTTTGT. Outer Right Sequence: GGGGCCCTTATGATCACTTT. Inner Left Sequence: CGCAAGAAGTTGCATGTTGA. Inner Right Sequence: TGGAATAATCAGATCATAAGGATGA. Inner Primer PCR Length: 1175 bp. Deletion Size: 601 bp. Deletion left flank: TATCTGCTTTTTGAAATGTAAAGCCATTTT. Deletion right flank: CTGGCCAAGCGAGACGTTCAATGTCAAGCC. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2284 tgt-1(ok3107) IV. C. elegans ZK829.6. Homozygous. [NOTE: it has been reported that ok3107 disrupts the native locus, this strain appears to also carry at least a partial duplication of the tgt-1 locus.] Outer Left Sequence: GACATCCTACCGTTTCCTGG. Outer Right Sequence: CTCCTTTGCAACACGTACCA. Inner Left Sequence: TACGGTAGGCCCGATAATGA. Inner Right Sequence: CTTGGACATCGTCCCGGT. Inner Primer PCR Length: 1172 bp. Deletion Size: 684 bp. Deletion left flank: AAAAAAATTGTGTTCGAACGTTATTTTTAT. Deletion right flank: GTTGTCAATACATGAATTACATGATCCAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2285 asns-2(ok3108) X. C. elegans M02D8.4. Homozygous. Outer Left Sequence: TGGATCTTGGTTCTTTTGCC. Outer Right Sequence: AAACCCATTGCGATTCAGAG. Inner Left Sequence: CTCAGATGGGAACTGCTCGT. Inner Right Sequence: GCATTTGTTCTTTGTTGCGA. Inner Primer PCR Length: 1250 bp. Deletion Size: 375 bp. Deletion left flank: TCCGTGTTGAAAGCTGATCGGAGAACAAAC. Deletion right flank: AGGTTCTTGATACCTTCCTTAAAACATATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2287 C09E8.2(ok3110) II. C. elegans C09E8.2 Homozygous. Outer Left Sequence: tcttctggagcagggcttta. Outer Right Sequence: ccgttgcggaaatttttagt. Inner Left Sequence: tgaacaaagttatggtactttggaa. Inner Right Sequence: tgacaacttaccccgtttttc. Inner Primer PCR Length: 1219. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2288 gst-8(ok3111) II. C. elegans F11G11.1. Homozygous. Outer Left Sequence: CGAATCATCATGAAAAGGCA. Outer Right Sequence: CATTTCCCACGCTTGAGTCT. Inner Left Sequence: GCGCAGTGGGAAGAGTAAAT. Inner Right Sequence: CCTTCTGCCGCAATTTTACA. Inner Primer PCR Length: 1208 bp. Deletion Size: 482 bp. Deletion left flank: TCAGATGTTTTTTTAGTTGTCATTGGCTTC. Deletion right flank: TGATCCAGCTCTTCTCGAAGAATTCCCACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 [NOTE: (06/03/2021) A user reported the original stock of RB2288 received by the CGC was heterozygous. A homozygous line was isolated and verified by PCR.]
RB2289 wht-8(ok3112) III. C. elegans Y47D3A.11. Homozygous. Outer Left Sequence: TTCCAGGTCAAAGAGCACCT. Outer Right Sequence: CCTTTGTAGCTGGCAAGTCC. Inner Left Sequence: CATCCAGGCTAAACTCCGTC. Inner Right Sequence: CAAAAGTACGCAGAAACCGA. Inner Primer PCR Length: 1206 bp. Deletion Size: 414 bp. Deletion left flank: GAGTTGTGGGTATCAGGTTCCGGATCATAC. Deletion right flank: TTTTCATTGGAACACTGTTTTACGGACTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2290 Y54G2A.17(ok3113) IV. C. elegans Y54G2A.17. Homozygous. Outer Left Sequence: CCAAAATGGCTTGTGAGGAT. Outer Right Sequence: ATTCCAGAATCAATCGACGG. Inner Left Sequence: ATCTGACCGGCTTGTCAATG. Inner Right Sequence: ATGAACGGACAAGACTCGCT. Inner Primer PCR Length: 1165 bp. Deletion Size: 235 bp. Deletion left flank: AAAACGCAAGATAATCGCATTGTATACTCA. Deletion right flank: TGAATTCAAAGCAAAATCGCCCATAATTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2291 PDB1.1(ok3114) X. C. elegans PDB1.1 Homozygous. Outer Left Sequence: tgtgttcgtttcagtctcgc. Outer Right Sequence: atgaaaaccaaaatgcgctc. Inner Left Sequence: acggaatatgctccctgatg. Inner Right Sequence: gcccacaaagaagatatgcaa. Inner Primer PCR Length: 1113. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Co