Strain Information
| Name | OH17241-deleted View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | unc-86(ot1158) III. |
| Description | unc-86(ot1158) is a CRISPR-engineered null allele removing the enrite unc-86 coding region. The repair ssODN isTCTGTCTCCTCCCAGCTTCAAGGTCCCCCTCTTTTACCTTGATTCTTTGATTAGTTTCGT TTTCGTGAAC, and the two sgRNAs are acaacatacaatgggctacc (start) caaggtccccctcttttcca (end). Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Tessa Tekieli |
| Laboratory | OH |
| Reference | Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
Sign in
or
register an account if you want to order this strain.