Laboratory Information

NameNL View on WormBase
Allele designationpk
HeadPlasterk, Ronald
InstitutionHubrecht Laboratory, Utrecht, The Netherlands
Address Minister of Education, Science and Culture Government of the Netherlands 2500 BJ Den Haag

Website http://www.ocw.nl/
Gene classes cde  drsh  gpc  mrp  nucb  pash  pgp  ppw  prk  rap  rsd  sgs  sox  tsn 
vig 

Strains contributed by this laboratory

Strain Genotype Species Description
NL1100 mut-2(r459) I; prk-1(pk86::Tc1) III. C. elegans Insertion in CCTTCAGAAG TA TGTCATTTGG.
NL1106 prk-2(pk278) III. C. elegans Deletion between: (exon 2): CCCAGAAGGCTT and (intron 4): ATATATATATATAGAC (complex rearrangement in between).
NL1136 mut-2(r459) I; gpa-5(pk375) X. C. elegans
NL1137 gpa-5(pk376) X. C. elegans
NL1140 dpy-20(e1282) IV; pkIs379. C. elegans pkIs379 [gpa-5XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.
NL1142 gpa-8(pk345) V. C. elegans
NL1146 gpa-6(pk480) X. C. elegans
NL1147 gpa-10(pk362) V. C. elegans
NL1236 acy-1(pk393) III; pkIs296 X. C. elegans pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.
NL1242 acy-2(pk465) V; pkEx467. C. elegans pkEx467 [acy-2(+) + rol-6(su1006)]. pk465 was isolated from a chemical deletion library and has a deletion of the first catalytic domain and the two multiple transmembrane regions of the predicted ACY-2 protein. The phenotype of pk465 is early larval lethality. The lethal phenotype of pk465 is rescued in NL1242 by a transgene containing WT acy-2 (cosmid C10F3) and rol-6.
NL130 pgp-1(pk17) IV; pgp-3(pk18) X. C. elegans Drug sensitive. No visible phenotype. pgp-1 and pgp-3 deletion alleles.
NL131 pgp-3(pk18) X. C. elegans pgp-3 deletion allele. No visible phenotype. Drug sensitive (colchicine, chloroquine). Throws males: outcrossed with him-8(e1489) so probably contains this mutation.
NL132 pgp-1(pk17) IV. C. elegans pgp-1 deletion allele. No visible phenotype. Might be sensitive to drugs.
NL147 mrp-1(pk89) C. elegans mrp-1 deletion mutant. WT under normal lab conditions. Sensitive to cadmium and arsenite.
NL152 pgp-1(pk17) IV; pgp-3(pk18) X; mrp-1(pk89) C. elegans pgp-1, pgp-3 and mrp-1 triple deletion mutant. Hypersensitive to cadmium and arsenite.
NL1533 dpy-20(e1282) IV; pkIs533. C. elegans pkIs533[gpa-10XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.
NL1581 dpy-20(e1282) IV; pkIs503. C. elegans pkIs503[gpa-1XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.
NL1584 dpy-20(e1282) IV; pkIs515. C. elegans pkIs515 [gpa-4XS(+) + dpy-20(+)]. Not known to which LG the insertion is attached.
NL1585 dpy-20(e1282) IV; pkIs519. C. elegans pkIs519 [gpa-6XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.
NL1586 dpy-20(e1282) IV; pkIs523. C. elegans pkIs523 [gpa-7(+) + dpy-20(+)].
NL1587 dpy-20(e1282) IV; pkIs527. C. elegans pkIs527 [gpa-8XS(+) + dpy-20(+)]. Not know to which LG the insertion is attached.
NL1588 dpy-20(e1282) IV; pkIs531. C. elegans pkIs531[gpa-9XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.
NL1590 dpy-20(e1282) IV; pkIs539. C. elegans pkIs539 [gpa-11(XS)(+) + dpy-20(+)]. Not know to which LG the insertion is attached.
NL1593 dpy-20(e1282) IV; pkIs552. C. elegans pkIs552[gpa-14XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.
NL1594 dpy-20(e1282) IV; pkIs555. C. elegans pkIs555 [gpa-15XS(+) + dpy-20(+)]. Not know to which LG the insertion is attached.
NL1604 dpy-20(e1282) IV; pkIs584. C. elegans pkIs584 [gpa-7::GFP + dpy-20(+)]. GFP expression in many neurons, muscle cells, and many neurons in the male tail.
NL1606 dpy-20(e1282) IV; pkIs586. C. elegans pkIs586 [gpa-9::GFP + dpy-20(+)]. GFP expression in ASJ, PHB, PVQ, pharynx muscle and spermatheca.
NL1607 dpy-20(e1282) IV; pkIs587. C. elegans pkIs587 [gpa-10::GFP + dpy-20(+)].
NL161 pkEx589. C. elegans pkEx589 [mrp-1::lacZ + rol-6(su1006)]. Rollers. Maintain by picking Rol.
NL1610 dpy-20(e1282) IV; pkIs590. C. elegans pkIs590 [gpa-14::GFP + dpy-20(+)]. GFP+.
NL1611 dpy-20(e1282) IV; pkIs591. C. elegans pkIs591[dpy-20(+) + gap-15::GFP]. GFP expression in ADL, ASH, ASK, PHA, PHB, distal tip cell, anchor cell, and many male-specific neurons.
NL1787 unc-13(e51) I. NL subclone of KR1787. C. elegans NL subclone of KR1787. NL received strain KR1787 from Ann Rose 11/93. High copy Tc1 strain. See WBG 14(4): 16-17.
NL1800 mut-16(pk700) I. C. elegans
NL1810 mut-16(pk710) I. C. elegans
NL1820 mut-7(pk720) III. C. elegans Mutator. Flanking sequence: gatttatccattttcaatcca cattttggatggtaaattctca.Mutator.
NL1832 T24C4.1(pk732) III. C. elegans
NL1834 mut-9(pk734) C. elegans Mutator.
NL1838 mut-14(pk738) C. elegans Mutator strain. TS. RNAi defect. TATTCTGGAC A AAGCTGATAA.
NL1888 pash-1(pk2083)/+ I; pkIs2084. C. elegans pkIs2084 [col-10::LacZ::lin-41 + goa-1::GFP]. Heterozygous. pash-1(pk2083)/+ heterozygotes look wild-type and will segregate pash-1(pk2083)/+ heterozygotes, sterile pk2083 homozygotes, and wild-type. Pick wild-type heterozygotes and check for segregation of sterile progeny to maintain.
NL1908 acy-1(pk866) III; dpy-20(e1362) IV; pkIs296 X. C. elegans pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NL1909 acy-1(pk867) III; dpy-20(e1362) IV; pkIs296 X. C. elegans pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.
NL1921 acy-1(pk880) III; dpy-20(e1362) IV; pkIs296 X. C. elegans pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NL1925 acy-1(pk884) III; dpy-20(e1362) IV; pkIs296 X. C. elegans pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.
NL1947 acy-1(pk907) III; dpy-20(e1362) IV; pkIs296 X. C. elegans pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NL1999 acy-1(pk1279)/dpy-17(e164) III. C. elegans Heterozygotes are WT and segregate Dpys, Wt and arrested larvae that hardly move or pump. Suppressor of activated Gs. sgs-1 also called acy-1.
NL2001 gpb-2(pk751) I. C. elegans Flanking sequence: AGTCACTCTT - deletion - GAAGACTACT.
NL2010 mut-6(st702) IV; rsd-3(pk2010) X. C. elegans Mut. RNAiR.
NL2013 rsd-3(pk2013) X. C. elegans Resistant to feeding dsRNA.
NL2035 rsd-6(pk2011) I. C. elegans Tc1 insertion in F16D3.2. Resistant to feeding dsRNA. Sensitive to gonadal injection of dsRNA.
NL2037 rsd-3(pk2013) X. C. elegans Tc1 insertion in C34E11.1. Resistant to feeding dsRNA. Sensitive to gonadal injection of dsRNA.
NL2098 rrf-1(pk1417) I. C. elegans Homozygous rrf-1 deletion allele. RNAi interference for genes expressed in somatic tissue is lost in rrf-1 deletion mutants.
NL2099 rrf-3(pk1426) II. C. elegans Homozygous rrf-3 deletion allele. Increased sensitivity to RNAi when compared to WT animals. Deletion sequence (deletion in lower case letters, flanking undeleted sequence in capital letters): TGCACATATTctacagaatt ------- --------tacccgattaAATGGACAATT (from Plasterk Lab 11/05).
NL2328 dpy-20(e1282) IV; pkIs1269. C. elegans pkIs1269 [gpa-13XS(+) + dpy-20(+)].
NL2330 gpa-13(pk1270) V. C. elegans
NL242 mut-2(r459) I; flp-1(pk41::Tc1) IV. C. elegans TTTAAAACG TA CTTACCTTT
NL243 mut-2(r459) I; ZK637.13(pk42) III. C. elegans insertion: TTCTGTGAAC TA TGTCAAAAT
NL244 nhr-2(pk43::Tc1) mut-2(r459) I. C. elegans Dpyish.
NL245 mut-2(r459) I; elt-2(pk46::Tc1) X. C. elegans Insertion in GGTCAAACG TA AGTTAAAGT.
NL2507 pkIs1582. C. elegans pkIs1582 [let-858::GFP + rol-6(su1006)]. Rollers.
NL2511 msh-6(pk2504) I. C. elegans Mutator phenotype. Enhanced level of spontaneous mutations (frameshifts and single base pair substitutions). The genomic region that is deleted in NL2511 is from nt 24180-25956 (takes out exon 5 and part of exon 6).
NL2550 ppw-1(pk2505) I. C. elegans ppw-1 animals are resistant to feeding of ds RNA directed against germline genes. Multiple polymorphisms in C18E3.7 including a single base deletion in ppw-1 resulting in an early stop codon.
NL3161 pkIs1330 I; tpa-1(pk1401) dpy-20(e1282) IV. C. elegans pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.
NL3223 nxf-1(pk386) V. C. elegans Suppressor of activated Gs. Temperature sensitive allele.
NL3231 acy-1(pk484) III; dpy-20(e1362) IV; pkIs296 X. C. elegans pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NL3300 rsd-6(pk3300) I. C. elegans Resistant when fed dsRNA. Contains a point mutation at position 7120 (c to t) (W575 STOP).
NL3304 rsd-4(pk3304) III. C. elegans Resistant to feeding dsRNA but sensitive to dsRNA injection.
NL3307 rsd-2(pk3307). C. elegans Resistant when fed dsRNA. Contains a point mutation at position 13832 (c to t) (R1000 STOP).
NL332 gpa-1(pk15) V. C. elegans
NL3321 sid-1(pk3321) V. C. elegans Resistant to feeding dsRNA but sensitive to dsRNA injection. PKA rsd-8.
NL334 gpa-2(pk16) V. C. elegans Reduced response to exogenously added dauer pheromone and thus defective in the regulation of dauer formation.
NL335 gpa-3(pk35) V. C. elegans Reduced response to exogenously added dauer pheromone and thus defective in the regulation of dauer formation.
NL3400 pkIs1604. C. elegans pkIs1604 [hsp-16.2::ATG(A)17GFP::LacZ + rol-6(su1006)]. Rollers.
NL3401 pkIs1605. C. elegans pkIs1605 [hsp-16.2p::GFP::LacZ + rol-6(su1006)]. Rollers.
NL344 gpb-1(pk44)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT (heterozygotes), L1 arrested animals (pk44 homozygotes), and paralyzed Dpy Uncs (mnC1 homozygotes).
NL348 gpa-2(pk16) gpa-3(pk35) V. C. elegans Reduced response to exogenously added dauer pheromone and thus defective in the regulation of dauer formation.
NL3511 ppw-1(pk1425) I. C. elegans ppw-1 animals are resistant to feeding of ds RNA directed against germline genes. The genomic region that is deleted: nt 2479-3982 of C18E3 (intragenic deletion in C18E3.7). This strain was formerly called NL2557.
NL3531 rde-2(pk1657) I. C. elegans Mutator. Flanking sequence: cctatgatcatattattgacgactttagtc aatggcaaagaaagagtttttaaatgtcat. AKA mut-8.Mutator. Flanking sequence: cctatgatcatattattgacgactttagtc aatggcaaagaaagagtttttaaatgtcat.Mutator.
NL361 gpb-1(pk44) II; pkEx170. C. elegans pkEx170 [gpb-1(+) + rol-6(su1006)]. Rollers. Pick Rollers to maintain. NL361 is homozygous for the gpb-1 deletion allele pk44; this results in an L1 arrest if the larvae has maternally derived GPB-1 or in an early embryonic lethality if there is no maternally derived GPB-1 for the developing embryo. This phenotype is rescued by the extrachromosomal transgene which contains the WT gpb-1 gene.
NL3630 pkIs32 III; eri-1(mg366) IV. C. elegans pkIs32[pie-1::GFP::H2B]. RNAi hypersensitive.
NL3643 unc-22(st136) IV. C. elegans Twitcher Unc. Flanking sequence: agattgacgagatccataaggaaggatgta cattgaactggaagcctccaactgataacg.Twitcher Unc.
NL3847 pkIs1600 I; ruIs32 III. C. elegans pkIs1600 [dpy-30::GFP(truncated) + rol-6(su1006)] I. ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Rollers.
NL4000 sma-1(e30) V. NL subclone of CB4000. C. elegans NL subclone of CB4000. High Tc1 copy number strain. See WBG 14(4): 16-17.
NL4005 nxf-1(pk864) V. C. elegans Suppressor of activated Gs. Temperature sensitive allele.
NL4258 pkIs1330 I; tpa-1(pk1585) dpy-20(e1282) IV. C. elegans pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.
NL4266 nucb-1(pk1654) C. elegans
NL4609 C27H5.7(pk1745) II. C. elegans Right flanking sequence of Tc1: 5'-TATATTCCAGAAA.
NL5117 ppw-2(pk1673) I. C. elegans
NL542 gsa-1(pk75) I; pkEx270. C. elegans pkEx270 [rol-6(su1006) + gsa-1(+)]. pk75 is an L1 larval lethal. The strain segregates Rollers and L1 lethals.
NL545 dpy-20(e1362) IV; pkIs296 X. C. elegans pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Heat-shock conditions are 2 hours at 33C, which results in degeneration of neurons.
NL557 dpy-20(e1362) IV; pkIs334. C. elegans pkIs334 [gsa-1(+) + dpy-20(+)]. gsa-1 overexpression. The strain is Egl-c and moves actively.
NL585 acy-1(pk301) III; dpy-20(e1362) IV; pkIs296 X. C. elegans pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.
NL587 acy-1(pk311) III; dpy-20(e1362) IV; pkIs296 X. C. elegans pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.
NL5901 pkIs2386. C. elegans pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. YFP expression in the muscles. unc-119 was in the background, but it may have been crossed out.
NL594 gpa-12(pk322) X. C. elegans Deletion sequence: Flanking undeleted sequence in uppercase, deleted sequence in lower case: CGGTGAATCTggaaagtccacg . . . aaatgcttatTCACAATGTT .
NL597 acy-1(pk384) III; dpy-20(e1362) IV; pkIs296 X. C. elegans pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NL665 mut-6(st702) IV. C. elegans
NL687 dcr-1(pk1351)/+ III. C. elegans Heterozygotes are WT and segregate WT and animals with protruding vulvas (dcr-1 homozygotes).
NL7000 NL subclone of RW7000 Bergerac BO. C. elegans NL subclone of strain RW7000. NL7000 seems to have diverged from RW7000 strains in other labs. Some polymorphisms are different; the two strains may actually be quite diverged. NL received RW7000 in 1988. See WBG 14(4): 16-17. Rec'd new stock 5/97 from NL.
NL705 glc-2(pk55); mut-2(r459) I. C. elegans glc-2(pk55) previously called avm-2(pk55).
NL706 mut-2(r459) cap-1(pk56::Tc1) I. C. elegans
NL708 mut-2(r459) I; cct-1(pk58::Tc1) II. C. elegans TTCTCACA TA ATTCCGATCT. Somewhat Dpyish.
NL711 mut-2(r459) I; feb-1(pk61). C. elegans
NL712 mut-2(r459) I; sem-2(pk64). C. elegans
NL713 mut-2(r459) I; sox-2(pk65). C. elegans K08A8.2. Location of the insertion: TCACGTATCT TA CATATTATAT.
NL714 mut-2(r459) I; sox-3(pk66). C. elegans F40E10.2. Location of the insertion: ATTAATAATA TA ACTATTGAAA.
NL716 mut-2(r459) I; sod-4(pk68) III. C. elegans F55H2.
NL721 cdh-3(pk77) III. C. elegans ZK112.7. Insertion sequence: TGGAGATACG TA GGTTTTTGAT.
NL723 mpk-1(pk79) mut-2(r459) I. C. elegans
NL724 old-1(pk69) III. C. elegans C08H9.5 Previously called tkr-1.
NL726 mut-2(r459) I; kin-18(pk71) III. C. elegans T17E9.1
NL728 cey-1(pk81) II. C. elegans Tc1 allele.
NL735 unc-2(pk95::Tc1) X. C. elegans
NL737 mut-2(r459) I; mek-1(pk97) X. C. elegans K08A8.1 Previously called kin-17(pk97).
NL742 rskn-1(pk209::Tc1) mut-2(r459) I. C. elegans Dpyish. Primers used to isolate pk209 are: cgatcctcgacagtttgaactgc & cgagattcagggcatgtctatgc.
NL746 pax-3(pk233) II. C. elegans
NL772 clp-2(pk323) III. C. elegans
NL787 gpa-11(pk349) II. C. elegans
NL788 gpa-14(pk347) I. C. elegans [NOTE: (07/16/2015) The correct genotype of this strain is gpa-14(pk347) I. not gpa-14(pk342) as previously reported.]
NL790 gpa-4(pk381) IV. C. elegans
NL791 prk-2(pk439) I. C. elegans Homozygous prk-2 deletion allele.
NL793 gpa-9(pk438) V. C. elegans
NL795 gpa-7(pk610) IV. C. elegans
NL796 cln-3.1(pk479). C. elegans F07B10.1 TAAACAACTT GATCCAATTC. Df.
NL797 gpa-15(pk477) I. C. elegans
NL917 mut-7(pk204) III. C. elegans Mutator strain. Throws males. See WBG 14(2): 24. Strain has a ts phenotype: dies out at 25C, grows at 20C, but best kept at 18-20C. Not known whether it is the mut-7 allele that is ts or something else.
temp_name108 mut-2(r459) avm-1(pk54::Tc1) I. Not sure of gene -Tuli and Thijssen concur - removed 1/31/06
temp_name109 mut-2(r459) I; pk202. Not sure of gene -Tuli and Thijssen concur - removed 1/31/06
TW332 mut-2(r459) I. C. elegans Mutator.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
pkP727 Allele insertion
pkP664 Transposon insertion insertion
pkP644 Allele insertion
pkP706 Allele insertion
pkP5165 Transposon insertion insertion
pkP5017 Transposon insertion insertion
pkP701 Transposon insertion insertion
pkP682 Transposon insertion insertion
pkP5167 Allele insertion
pkP5058 Transposon insertion insertion
pkP507 Allele insertion
pkP670 Transposon insertion insertion
pkP687 Allele insertion
pkP5170 Transposon insertion insertion
pkP5037 Transposon insertion insertion
pkP704 Transposon insertion insertion
pkP5154 Transposon insertion insertion
pkP729 Allele insertion
pkP503 Transposon insertion insertion
pkP643 Transposon insertion insertion
pkP504 Transposon insertion insertion
pkP689 Transposon insertion insertion
pkP720 Transposon insertion insertion
pkP5179 Transposon insertion insertion
pkP5144 Transposon insertion insertion
pkP645 Transposon insertion insertion
pkP5162 Transposon insertion insertion
pkP5184 Transposon insertion insertion splice_site
pkP668 Allele insertion
pkP683 Allele insertion
pkP672 Transposon insertion insertion
pkP649 Transposon insertion insertion
pkP651 Transposon insertion insertion
pkP5132 Transposon insertion insertion
pkP5149 Transposon insertion insertion
pkP710 Transposon insertion insertion
pkP667 Transposon insertion insertion
pkP5091 Transposon insertion insertion
pkP5151 Transposon insertion insertion
pkP5181 Transposon insertion insertion
pkP652 Transposon insertion insertion
pkP5168 Transposon insertion insertion
pkP5175 Transposon insertion insertion
pkP5141 Transposon insertion insertion
pkP703 Transposon insertion insertion
pkP5161 Transposon insertion insertion
pkP5127 Transposon insertion insertion
pkP698 Transposon insertion insertion
pkP5172 Transposon insertion insertion
pkP501 Transposon insertion insertion
pkP692 Transposon insertion insertion
pkP642 Transposon insertion insertion
pkP686 Transposon insertion insertion
pkP5147 Transposon insertion insertion
pkP728 Transposon insertion insertion
pkP500 Transposon insertion insertion
pkP5026 Transposon insertion insertion
pkP646 Transposon insertion insertion
pkP700 Transposon insertion insertion
pkP693 Transposon insertion insertion
pkP5186 Transposon insertion insertion
pkP709 Transposon insertion insertion
pkP506 Transposon insertion insertion
pkP679 Transposon insertion insertion
pkP5185 Transposon insertion insertion
pkP640 Transposon insertion insertion
pkP656 Transposon insertion insertion
pkP657 Transposon insertion insertion
pkP658 Transposon insertion insertion
pkP661 Transposon insertion insertion
pkP5142 Transposon insertion insertion
pkP676 Transposon insertion insertion
pkP5160 Transposon insertion insertion
pkP677 Transposon insertion insertion
pkP712 Transposon insertion insertion
pkP724 Transposon insertion insertion
pkP5002 Transposon insertion insertion
pkP5081 Transposon insertion insertion
pkP5164 Transposon insertion insertion
pkP5171 Transposon insertion insertion
pkP5173 Transposon insertion insertion
pkP5180 Transposon insertion insertion
pkP638 Transposon insertion insertion
pkP655 Transposon insertion insertion
pkP5156 Transposon insertion insertion
pkP659 Transposon insertion insertion
pkP5102 Transposon insertion insertion
pkP665 Transposon insertion insertion splice_site
pkP5001 Transposon insertion insertion
pkP5019 Transposon insertion insertion
pkP5140 Transposon insertion insertion
pkP5157 Transposon insertion insertion
pkP5163 Transposon insertion insertion
pkP688 Allele insertion
pkP650 Allele insertion
pk1426 Allele deletion
pk54 Transposon insertion insertion
pk2358
pk1389 Allele deletion
pk1393 Allele deletion
pk16 Transposon insertion insertion
pk35 Transposon insertion insertion
pk1270 Transposon insertion insertion
pk376 Transposon insertion insertion
pk480 Allele deletion
pk486 Allele
pk1427 Allele deletion
pk440 Allele
pkP520 Transposon insertion insertion
pkP538 Transposon insertion insertion
pkP512 Transposon insertion insertion
pkP521 Transposon insertion insertion
pkP744 Transposon insertion insertion
pkP754 Transposon insertion insertion
pkP532 Transposon insertion insertion
pkP515 Transposon insertion insertion
pkP757 Transposon insertion insertion
pkP511 Transposon insertion insertion
pkP5009 Transposon insertion insertion
pkP514 Transposon insertion insertion
pkP753 Transposon insertion insertion
pkP524 Transposon insertion insertion
pkP735 Transposon insertion insertion
pkP758 Transposon insertion insertion
pkP756 Transposon insertion insertion
pkP738 Transposon insertion insertion
pkP733 Transposon insertion insertion
pkP534 Transposon insertion insertion splice_site
pkP528 Transposon insertion insertion
pkP526 Transposon insertion insertion
pkP5010 Transposon insertion insertion
pkP5014 Transposon insertion insertion
pkP5192 Transposon insertion insertion
pkP5016 Transposon insertion insertion
pkP5006 Transposon insertion insertion
pkP5007 Transposon insertion insertion
pkP740 Transposon insertion insertion
pkP522 Transposon insertion insertion
pkP539 Transposon insertion insertion
pkP734 Transposon insertion insertion
pkP759 Transposon insertion insertion
pkP5008 Transposon insertion insertion
pkP523 Transposon insertion insertion
pkP5198 Transposon insertion insertion
pkP531 Transposon insertion insertion
pkP5005 Transposon insertion insertion
pkP732 Transposon insertion insertion
pkP5197 Transposon insertion insertion
pkP510 Transposon insertion insertion
pkP5011 Transposon insertion insertion
pkP730 Transposon insertion insertion
pkP747 Transposon insertion insertion
pkP750 Transposon insertion insertion
pkP5012 Transposon insertion insertion
pkP5193 Transposon insertion insertion
pkP751 Transposon insertion insertion
pkP755 Transposon insertion insertion
pkP5191 Transposon insertion insertion
pkP530 Transposon insertion insertion
pk1417 Allele
pk93 Transposon insertion insertion
pk87 Allele
pk278 Allele
pk375 Transposon insertion insertion
pk345 Transposon insertion insertion
pk362 Allele insertion
pk393 Allele substitution
pk465 Allele
pk17 Transposon insertion deletion
pk18 Transposon insertion deletion
pk89 Allele deletion
pk700 Allele substitution nonsense
pk710 Allele substitution nonsense
pk720 Allele insertion
pk732 Allele
pk734 Allele
pk738 Allele substitution
pk2083 Allele
pk866 Allele substitution
pk867 Allele substitution
pk880 Allele substitution
pk884 Allele substitution
pk907 Allele substitution
pk1279 Allele
pk751 Allele deletion
pk690 Allele
pk2010 Transposon insertion insertion
pk2013 Transposon insertion insertion
pk2011 Transposon insertion insertion
pk481 Allele deletion
pk42 Transposon insertion insertion
pk2504 Allele deletion
pk2505 Allele
pk1331 Allele deletion
pk1401 Allele substitution nonsense
pk386 Allele
pk484 Allele substitution
pk3300 Allele substitution nonsense
pk3304 Allele
pk3307 Allele substitution
pk15 Transposon insertion insertion
pk3321 Allele substitution
pk44 Transposon insertion insertion
pk1425 Allele
pk1657 Allele deletion
pk864 Allele
pk1585 Allele substitution nonsense
pk1654 Allele
pk1745 Allele
pk1673 Allele deletion
pk75 Transposon insertion insertion
pk301 Allele substitution
pk311 Allele substitution splice_site
pk322 Allele deletion
pk384 Allele substitution
pk1351 Allele deletion
pk55 Transposon insertion insertion
pk58 Transposon insertion insertion
pk61 Transposon insertion insertion
pk64 Transposon insertion insertion
pk65 Transposon insertion insertion
pk66 Transposon insertion insertion
pk68 Transposon insertion insertion
pk77 Transposon insertion insertion
pk79 Transposon insertion insertion
pk69 Transposon insertion insertion
pk71 Transposon insertion insertion
pk81 Transposon insertion insertion
pk97 Transposon insertion insertion
pk209 Transposon insertion insertion
pk233 Transposon insertion insertion
pk323 Transposon insertion insertion
pk349 Allele insertion
pk347 Allele deletion
pk381 Allele deletion
pk439 Allele
pk298 Allele deletion
pk438 Allele insertion
pk610 Allele deletion
pk479 Allele
pk477 Allele deletion
pk204 Transposon insertion substitution nonsense
pk1357 Allele deletion
pk62 Transposon insertion insertion
pk360 Allele
pk1596 Allele deletion
pk2082 Allele substitution nonsense
pk924 Allele deletion