Strain Information

Name MTG737   View On Wormbase
Species C. elegans
Genotypefum-1(mod501[(S149I) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III)]).
DescriptionHuman variant model. Homozygous inviable. Homozygous lethal mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP fum-1 homozygotes (larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. fum-1(mod[S149I]) is a CRISPR/Cas9-engineered missense allele mimicking a human clinical variant in an N2 background. sgRNA: TCAATGAGGTTATCTCGAAT. ssODN:ACTGGTTCAGGAACTCAGTCCAACATGAATGTCAATGAGGTTATCATCAATCGGTAAAAA
CTAAAAAAAATTGTTTAAAGATTTTATTGAATTCATTGCAGTGC.
Reference: Ferris S, et al. Genet Med Open. 2025 Nov 1:3:103469. doi: 10.1016/j.gimo.2025.103469. PMID: 41438304.
MutagenCrispr/Cas9
Outcrossedx0
Made bySuzanne Ferris
Laboratory MTG
Reference Ferris S, et al. Genet Med Open. 2025 Nov 1:3:103469. doi: 10.1016/j.gimo.2025.103469. PMID: 41438304.
Sign in or register an account if you want to order this strain.