Strain Information
| Name | MTG737 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | fum-1(mod501[(S149I) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III)]). |
| Description | Human variant model. Homozygous inviable. Homozygous lethal mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP fum-1 homozygotes (larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. fum-1(mod[S149I]) is a CRISPR/Cas9-engineered missense allele mimicking a human clinical variant in an N2 background. sgRNA: TCAATGAGGTTATCTCGAAT. ssODN:ACTGGTTCAGGAACTCAGTCCAACATGAATGTCAATGAGGTTATCATCAATCGGTAAAAA CTAAAAAAAATTGTTTAAAGATTTTATTGAATTCATTGCAGTGC. Reference: Ferris S, et al. Genet Med Open. 2025 Nov 1:3:103469. doi: 10.1016/j.gimo.2025.103469. PMID: 41438304. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Suzanne Ferris |
| Laboratory | MTG |
| Reference | Ferris S, et al. Genet Med Open. 2025 Nov 1:3:103469. doi: 10.1016/j.gimo.2025.103469. PMID: 41438304. |
Sign in
or
register an account if you want to order this strain.