Laboratory Information
| Name | LBV View on WormBase |
|---|---|
| Allele designation | ejd |
| Head | Vosshall, Leslie |
| Institution | HHMI, Rockefeller University, New York, NY |
| Address | 1230 York Avenue T SMITH 4th floor New York 10065 United States |
| Gene classes |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| LBV2 | nstp-3(ejd2) V. | C. elegans | DEET-resistant. ejd2 causes a F48V substitution in nstp-3. Reference: Dennis EJ, et al. Nature. 2018 Oct;562(7725):119-123. |
| LBV3 | str-217(ejd3) V. | C. elegans | DEET-resistant. ejd3 causes a P314S substitution in str-217. Reference: Dennis EJ, et al. Nature. 2018 Oct;562(7725):119-123. |
| LBV5 | str-217(ejd1) V. | C. elegans | DEET-resistant. ejd1 is a CRISPR/Cas9-induced mutation causing a predicted frame-shift in the first exon. WT (affected sequence between arrows): GCTTTTATTCCAAAAAACTCTCTCCCGCGTCG>CTGCTCCAA |
This laboratory hasn't submitted any alleles to the CGC.