Laboratory Information

NameLBV View on WormBase
Allele designationejd
HeadVosshall, Leslie
InstitutionHHMI, Rockefeller University, New York, NY
Address 1230 York Avenue
T SMITH 4th floor
New York 10065
United States
Gene classes

Strains contributed by this laboratory

Strain Genotype Species Description
LBV1 N2 C. elegans DEET-resistant
LBV2 nstp-3(ejd2) V. C. elegans DEET-resistant. ejd2 causes a F48V substitution in nstp-3. Reference: Dennis EJ, et al. Nature. 2018 Oct;562(7725):119-123.
LBV3 str-217(ejd3) V. C. elegans DEET-resistant. ejd3 causes a P314S substitution in str-217. Reference: Dennis EJ, et al. Nature. 2018 Oct;562(7725):119-123.
LBV5 str-217(ejd1) V. C. elegans DEET-resistant. ejd1 is a CRISPR/Cas9-induced mutation causing a predicted frame-shift in the first exon. WT (affected sequence between arrows): GCTTTTATTCCAAAAAACTCTCTCCCGCGTCG>CTGCTCCAAAAAAAAAA
This laboratory hasn't submitted any alleles to the CGC.