Laboratory Information
| Name | JN View on WormBase |
|---|---|
| Allele designation | pe |
| Head | Yuichi Iino |
| Institution | University of Tokyo, Tokyo, Japan |
| Address | Rm224, Science Building #3, 2-11-16 Yayoi The University of Tokyo Bunkyo-ku 113-0032 Japan |
| Website | http://molecular-ethology.bs.s.u-tokyo.ac.jp/labHP/J/JTop.html |
| Gene classes | asb asg casy iff kel mbr pitp rrc snet |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| JN1071 | snet-1(pe1063) X. | C. elegans | Suppresses nep-2 olfactory plasticity defect. Reference: Science. 2010 Sep 24;329(5999):1647-50. |
| JN1209 | pitp-1(pe1209) III. | C. elegans | Mos1 insertion. Salt chemotaxis learning defective. Reference: Proc Natl Acad Sci U S A. 2011 May 3;108(18):7589-94. |
| JN1239 | daf-18(pe407) IV. | C. elegans | pe407 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490 |
| JN1240 | plc-1(pe1238) X. | C. elegans | Presumptive null allele of plc-1. Shows a preference for low salt concentrations. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210. |
| JN1297 | pitp-1(pe1297) III. | C. elegans | 1953 bp deletion. Salt chemotaxis learning defective. Reference: Proc Natl Acad Sci U S A. 2011 May 3;108(18):7589-94. |
| JN147 | gap-2(tm748) X. | C. elegans | No apparent phenotype. tm748 is a UV/TMP-induced gap-2 deletion allele generated by National Bioresource Project (see http://shigen.lab.nig.ac.jp/c.elegans/index.jsp?lang=englis h for info). |
| JN1483 | daf-18(pe407) IV. | C. elegans | pe407 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490 |
| JN1484 | daf-18(pe408) IV. | C. elegans | pe408 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490 |
| JN1489 | daf-2(pe1230) III. | C. elegans | Daf-c phenotype at 25C; normal development at 20C. Defects in salt-starve associative learning and olfactory learning. Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490 |
| JN1601 | lite-1(ce314) X; peIs1091. | C. elegans | peIs1091 [gcy5p::ChR2Y2 + unc-122p::mCherry]. ChR2 expression in the ASER neuron. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210. |
| JN1695 | lite-1(ce314) X; peIs1095. | C. elegans | peIs1095 [gcy-7p::ChR2Y2::Venus + unc-122::mCherry]. ChR2Y2 expression in ASEL. Reference: Wang L, et al. J Neurosci, 2017. 37(8): p. 2097-2111. PMID: 28126744 |
| JN1709 | peIs1709. | C. elegans | peIs1709 [gpc-1p::FLAG::pab-1::sl2::NLS::GFP + unc-122p::mCherry]. FLAG-tagged poly(A)-binding protein (PAB-1) can be used for mRNA tagging. Reference: Tomioka M, et al. Nat Commun. 2016 May 20;7:11645. PMID: 27198602 |
| JN1710 | peIs1710. | C. elegans | peIs1710 [glr-1p::FLAG::pab-1::sl2::NLS::GFP + unc-122p::mCherry]. FLAG-tagged poly(A)-binding protein (PAB-1) can be used for mRNA tagging. Reference: Tomioka M, et al. Nat Commun. 2016 May 20;7:11645. PMID: 27198602 |
| JN1713 | peIs1713. | C. elegans | peIs1713 [sra-6p::mCasp-1 + unc-122p::mCherry]. ASH neurons are eliminated. Abnormal odor chemotaxis. Reference: Yoshida K, et al. Nat Commun. 2012 Mar 13;3:739. |
| JN1715 | peIs1715. | C. elegans | peIs1715 [str-1p::mCasp-1 + unc-122p::GFP]. AWB neurons are eliminated. Abnormal odor chemotaxis. Reference: Yoshida K, et al. Nat Commun. 2012 Mar 13;3:739. |
| JN2113 | peIs2113. | C. elegans | peIs2113 [gcy-21p::mCaspase + tax-4p::NLS::YC2.60 + lin-44p::GFP]. Genetic ablation of ASG neurons by specific expression of caspase. tax-4p::YC2.60 facilitates calcium imaging. Reference: Jang MS, et al. Proc Natl Acad Sci U S A. 2019 Sep 10;116(37):18673-18683. PMID: 31455735 |
| JN213 | iff-1(tm483)/qC1 [dpy-19(e1259) glp-1(q339)] III. | C. elegans | Heterozygotes are WT and segregate sterile iff-1 homozygotes and Dumpy sterile qC1 homozygotes. Maintain by picking non-Dpy fertile heterozygotes. tm483 is a UV/TMP-induced iff-1 deletion allele generated by K. Gengyo-Ando and S. Mitani. |
| JN214 | iff-2(tm393)/mIn1 [dpy-10(e128) mIs14] II. | C. elegans | Heterozygotes are WT and GFP+ and segregate Dpy GFP+ and slow-growing, GFP- iff-2 homozygotes. |
| JN215 | iff-1(tm483) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C. elegans | Segregates GFP+ glowing heterozygotes and non-glowing sterile iff-1 homozygotes. tm483 is a UV/TMP-induced iff-1 deletion allele generated by K. Gengyo-Ando and S. Mitani. hT2[qIs48] homozygotes inviable. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. |
| JN218 | asb-1(tm498)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. | C. elegans | qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. asb-1(tm498) is homozygous sterile. |
| JN219 | asb-1(tm499)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. | C. elegans | qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. asb-1(tm499) is homozygous sterile. |
| JN2389 | lite-1(xu7) X; peIs1090. | C. elegans | peIs1090 [sra-6p::ChR2Y2]. ChR2 expression in ASH neuron. Reference: Yamada K, et al. 2012 Jul;2(7):741-51. PMID: 22870397 |
| JN2411 | sinh-1(pe420) II. | C. elegans | Chemotaxis abnormality, developmental delay, small brood size. pe420 is a 22 bp deletion in exon 1. |
| JN2512 | peIs422. | C. elegans | peIs422 [gcy-5p::Downward DAG2(worm) + gcy-5p::mCherry + unc-122p::mCherry]. Transgene allows imaging of changes in the amount of diacylglycerol (DAG) in ASER neuron. Reference: Ohno H, et al. Cell Rep. 2017 Sep 5;20(10):2294-2303. PMID: 28877465 |
| JN2513 | peEx2513. | C. elegans | peEx2513 [ceh36p::DownwardDAG2(worm) + unc-122p::mCherry]. The diacylglycerol reporter, DownwardDAG2, is expressed in AFD. |
| JN2514 | peEx2514. | C. elegans | peEx2514 [gcy-8p::DownwardDAG2(codon-optimized) + unc-122p::mCherry]. The diacylglycerol reporter, DownwardDAG2, is expressed in AFD. |
| JN2722 | daf-2(pe2722) III. | C. elegans | daf-2(pe2722) is a daf-2c-isoform specific mutation. pe2722 is a CRISPR/Cas9-engineered 41 bp deletion (ggttgatgacgatgatgagcccggcggcaggaggcagtgagcaaca) in daf-2 exon 11.5. Guide RNA sequence: gacgatgaagagcccggcgg. Reference: Nagashima T, et al. PLoS Genet. 2019 Jul 19;15(7):e1008297. PMID: 31323047 |
| JN3038 | qjIs11; peIs3042; peIs2100; qjIs14. | C. elegans | qjIs11 [glr-1p::SVNLS2::TagBFPsyn + ser-2(prom2)::SVNLS2::TagBFPsyn]. peIs3042 [eat-4p::svnls2::TagRFP675syn + lin-44p::GFP]. peIs2100 [H-20p::NLS4::mCherry]. qjIs14 [H20p::NLS::YC2.60]. Suitable for whole-brain calcium imaging. mCherry and YC2.60 expression in almost all head neurons. BFP and RFP are also expressed to annotate neurons. H20p is a pan-neuronal promoter expressed in almost all neurons, GLR glial cells, XXX hypodermal cells, pharyngeal gland cells and HMC cells. Reference: Toyoshima Y et al. BMC Biol. 2020 Mar 19;18(1):30. PMID: 32188430; Shioi G, et al. Genetics. 2001 Apr;157(4):1611-22. PMID: 11290717. |
| JN356 | nep-2(pe356) II. | C. elegans | Olfactory plasticity defect. Reference: Science. 2010 Sep 24;329(5999):1647-50. |
| JN372 | gpc-1(pe372) X. | C. elegans | |
| JN379 | nep-2(pe379) II. | C. elegans | Olfactory plasticity defect. Reference: Science. 2010 Sep 24;329(5999):1647-50. |
| JN414 | casy-1(pe401) II. | C. elegans | |
| JN554 | dyf-11(pe554) X. | C. elegans | Deletion flanking sequence (X: 764793) AGTCAACTACTAAAAAACGT-TTTTTTT-TTTTTTCAAATTCTAGAATAAGTT (X:765504). 667 BP DELETION. 7 T insertion. |
| JN572 | clh-1(pe572) II. | C. elegans | pe572 mutants exhibit defects in salt chemotaxis after low salt concentration with food conditioning. Reference: Park C, et al. Elife. 2021 Jan 25;10:e55701. doi: 10.7554/eLife.55701. PMID: 33492228 |
| JN577 | clh-1(pe577) II. | C. elegans | pe577 mutants exhibit defects in salt chemotaxis after low salt concentration with food conditioning. Reference: Park C, et al. Elife. 2021 Jan 25;10:e55701. doi: 10.7554/eLife.55701. PMID: 33492228 |
| JN578 | peIs578. | C. elegans | peIs578 [npr-9p::casp1 + npr-9p::Venus + unc-122p::mCherry]. AIB neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210. |
| JN579 | peIs579. | C. elegans | peIs579 [ttx-3p::casp1 + ttx-3p::Venus + lin-44p::GFP]. AIY neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210. |
| JN580 | peIs580. | C. elegans | peIs580 [ins-1p(short)::casp1 + ins-1p(short)::Venus + unc-122p::GFP]. AIA neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210. |
| JN773 | goa-1(pe773) I. | C. elegans | This strain shows a preference for high salt concentration when conditioned with food. Reference: Ohno H, et al. Cell Rep. 2017 Sep 5;20(10):2294-2303. PMID: 28877465 |
| JN785 | peIs785. | C. elegans | peIs785 [casy-1p::daf-2 E11-E11.5(+c)-E12::EGFP + casy-1p::daf-2 E11-E11.5(+c)-E12(-c)::mRFP]. peIs785 caries a daf-2 splicing reporter expressed in many neurons. Reference: Tomioka M, et al. Nat Commun. 2016 May 20;7:11645. PMID: 27198602 |
| JN930 | egl-30(pe914) I. | C. elegans | Presumptive gain-of-function mutant shows defects in salt-food associative learning and olfactory learning. Reference: Tomioka M, et al. 2006 Sep 7;51(5):613-25. PMID: 16950159 |
| SA29 | kel-1(pe201)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT, DpyUnc and L2 larva. kel-1(pe201) homozygotes arrest development at early L2. pe201 deletes a 3.6 kb region including most of the kel-1 ORFs. |
| temp_name46 | gap-2(pe103) X. | Y Iino said no mutation (del) present removed 5/1/02 |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| pe1102 | Allele | insertion | |
| pe1209 | Transposon insertion | insertion | |
| pe1297 | Allele | insertion | |
| pe372 | Allele | deletion | |
| pe401 | Allele | ||
| pe554 | Allele | insertion | |
| pe201 | Allele |