Laboratory Information

NameJN View on WormBase
Allele designationpe
HeadYuichi Iino
InstitutionUniversity of Tokyo, Tokyo, Japan
Address Rm224, Science Building #3, 2-11-16 Yayoi
The University of Tokyo
Bunkyo-ku 113-0032
Japan
Website http://molecular-ethology.bs.s.u-tokyo.ac.jp/labHP/J/JTop.html
Gene classes asb  asg  casy  iff  kel  mbr  pitp  rrc  snet 

Strains contributed by this laboratory

Strain Genotype Species Description
JN1071 snet-1(pe1063) X. C. elegans Suppresses nep-2 olfactory plasticity defect. Reference: Science. 2010 Sep 24;329(5999):1647-50.
JN1209 pitp-1(pe1209) III. C. elegans Mos1 insertion. Salt chemotaxis learning defective. Reference: Proc Natl Acad Sci U S A. 2011 May 3;108(18):7589-94.
JN1239 daf-18(pe407) IV. C. elegans pe407 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490
JN1240 plc-1(pe1238) X. C. elegans Presumptive null allele of plc-1. Shows a preference for low salt concentrations. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.
JN1297 pitp-1(pe1297) III. C. elegans 1953 bp deletion. Salt chemotaxis learning defective. Reference: Proc Natl Acad Sci U S A. 2011 May 3;108(18):7589-94.
JN147 gap-2(tm748) X. C. elegans No apparent phenotype. tm748 is a UV/TMP-induced gap-2 deletion allele generated by National Bioresource Project (see http://shigen.lab.nig.ac.jp/c.elegans/index.jsp?lang=englis h for info).
JN1483 daf-18(pe407) IV. C. elegans pe407 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490
JN1484 daf-18(pe408) IV. C. elegans pe408 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490
JN1489 daf-2(pe1230) III. C. elegans Daf-c phenotype at 25C; normal development at 20C. Defects in salt-starve associative learning and olfactory learning. Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490
JN1601 lite-1(ce314) X; peIs1091. C. elegans peIs1091 [gcy5p::ChR2Y2 + unc-122p::mCherry]. ChR2 expression in the ASER neuron. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.
JN1695 lite-1(ce314) X; peIs1095. C. elegans peIs1095 [gcy-7p::ChR2Y2::Venus + unc-122::mCherry]. ChR2Y2 expression in ASEL. Reference: Wang L, et al. J Neurosci, 2017. 37(8): p. 2097-2111. PMID: 28126744
JN1709 peIs1709. C. elegans peIs1709 [gpc-1p::FLAG::pab-1::sl2::NLS::GFP + unc-122p::mCherry]. FLAG-tagged poly(A)-binding protein (PAB-1) can be used for mRNA tagging. Reference: Tomioka M, et al. Nat Commun. 2016 May 20;7:11645. PMID: 27198602
JN1710 peIs1710. C. elegans peIs1710 [glr-1p::FLAG::pab-1::sl2::NLS::GFP + unc-122p::mCherry]. FLAG-tagged poly(A)-binding protein (PAB-1) can be used for mRNA tagging. Reference: Tomioka M, et al. Nat Commun. 2016 May 20;7:11645. PMID: 27198602
JN1713 peIs1713. C. elegans peIs1713 [sra-6p::mCasp-1 + unc-122p::mCherry]. ASH neurons are eliminated. Abnormal odor chemotaxis. Reference: Yoshida K, et al. Nat Commun. 2012 Mar 13;3:739.
JN1715 peIs1715. C. elegans peIs1715 [str-1p::mCasp-1 + unc-122p::GFP]. AWB neurons are eliminated. Abnormal odor chemotaxis. Reference: Yoshida K, et al. Nat Commun. 2012 Mar 13;3:739.
JN2113 peIs2113. C. elegans peIs2113 [gcy-21p::mCaspase + tax-4p::NLS::YC2.60 + lin-44p::GFP]. Genetic ablation of ASG neurons by specific expression of caspase. tax-4p::YC2.60 facilitates calcium imaging. Reference: Jang MS, et al. Proc Natl Acad Sci U S A. 2019 Sep 10;116(37):18673-18683. PMID: 31455735
JN213 iff-1(tm483)/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT and segregate sterile iff-1 homozygotes and Dumpy sterile qC1 homozygotes. Maintain by picking non-Dpy fertile heterozygotes. tm483 is a UV/TMP-induced iff-1 deletion allele generated by K. Gengyo-Ando and S. Mitani.
JN214 iff-2(tm393)/mIn1 [dpy-10(e128) mIs14] II. C. elegans Heterozygotes are WT and GFP+ and segregate Dpy GFP+ and slow-growing, GFP- iff-2 homozygotes.
JN215 iff-1(tm483) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Segregates GFP+ glowing heterozygotes and non-glowing sterile iff-1 homozygotes. tm483 is a UV/TMP-induced iff-1 deletion allele generated by K. Gengyo-Ando and S. Mitani. hT2[qIs48] homozygotes inviable. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
JN218 asb-1(tm498)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. C. elegans qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. asb-1(tm498) is homozygous sterile.
JN219 asb-1(tm499)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. C. elegans qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. asb-1(tm499) is homozygous sterile.
JN2389 lite-1(xu7) X; peIs1090. C. elegans peIs1090 [sra-6p::ChR2Y2]. ChR2 expression in ASH neuron. Reference: Yamada K, et al. 2012 Jul;2(7):741-51. PMID: 22870397
JN2411 sinh-1(pe420) II. C. elegans Chemotaxis abnormality, developmental delay, small brood size.  pe420 is a 22 bp deletion in exon 1.
JN2512 peIs422. C. elegans peIs422 [gcy-5p::Downward DAG2(worm) + gcy-5p::mCherry + unc-122p::mCherry]. Transgene allows imaging of changes in the amount of diacylglycerol (DAG) in ASER neuron. Reference: Ohno H, et al. Cell Rep. 2017 Sep 5;20(10):2294-2303. PMID: 28877465
JN2513 peEx2513. C. elegans peEx2513 [ceh36p::DownwardDAG2(worm) + unc-122p::mCherry]. The diacylglycerol reporter, DownwardDAG2, is expressed in AFD.
JN2514 peEx2514. C. elegans peEx2514 [gcy-8p::DownwardDAG2(codon-optimized) + unc-122p::mCherry]. The diacylglycerol reporter, DownwardDAG2, is expressed in AFD.
JN2722 daf-2(pe2722) III. C. elegans daf-2(pe2722) is a daf-2c-isoform specific mutation. pe2722 is a CRISPR/Cas9-engineered 41 bp deletion (ggttgatgacgatgatgagcccggcggcaggaggcagtgagcaaca) in daf-2 exon 11.5. Guide RNA sequence: gacgatgaagagcccggcgg. Reference: Nagashima T, et al. PLoS Genet. 2019 Jul 19;15(7):e1008297. PMID: 31323047
JN3038 qjIs11; peIs3042; peIs2100; qjIs14. C. elegans qjIs11 [glr-1p::SVNLS2::TagBFPsyn + ser-2(prom2)::SVNLS2::TagBFPsyn]. peIs3042 [eat-4p::svnls2::TagRFP675syn + lin-44p::GFP]. peIs2100 [H-20p::NLS4::mCherry]. qjIs14 [H20p::NLS::YC2.60]. Suitable for whole-brain calcium imaging. mCherry and YC2.60 expression in almost all head neurons. BFP and RFP are also expressed to annotate neurons. H20p is a pan-neuronal promoter expressed in almost all neurons, GLR glial cells, XXX hypodermal cells, pharyngeal gland cells and HMC cells. Reference: Toyoshima Y et al. BMC Biol. 2020 Mar 19;18(1):30. PMID: 32188430; Shioi G, et al. Genetics. 2001 Apr;157(4):1611-22. PMID: 11290717.
JN356 nep-2(pe356) II. C. elegans Olfactory plasticity defect. Reference: Science. 2010 Sep 24;329(5999):1647-50.
JN372 gpc-1(pe372) X. C. elegans
JN379 nep-2(pe379) II. C. elegans Olfactory plasticity defect. Reference: Science. 2010 Sep 24;329(5999):1647-50.
JN414 casy-1(pe401) II. C. elegans
JN554 dyf-11(pe554) X. C. elegans Deletion flanking sequence (X: 764793) AGTCAACTACTAAAAAACGT-TTTTTTT-TTTTTTCAAATTCTAGAATAAGTT (X:765504). 667 BP DELETION. 7 T insertion.
JN572 clh-1(pe572) II. C. elegans pe572 mutants exhibit defects in salt chemotaxis after low salt concentration with food conditioning. Reference: Park C, et al. Elife. 2021 Jan 25;10:e55701. doi: 10.7554/eLife.55701. PMID: 33492228
JN577 clh-1(pe577) II. C. elegans pe577 mutants exhibit defects in salt chemotaxis after low salt concentration with food conditioning. Reference: Park C, et al. Elife. 2021 Jan 25;10:e55701. doi: 10.7554/eLife.55701. PMID: 33492228
JN578 peIs578. C. elegans peIs578 [npr-9p::casp1 + npr-9p::Venus + unc-122p::mCherry]. AIB neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.
JN579 peIs579. C. elegans peIs579 [ttx-3p::casp1 + ttx-3p::Venus + lin-44p::GFP]. AIY neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.
JN580 peIs580. C. elegans peIs580 [ins-1p(short)::casp1 + ins-1p(short)::Venus + unc-122p::GFP]. AIA neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.
JN773 goa-1(pe773) I. C. elegans This strain shows a preference for high salt concentration when conditioned with food. Reference: Ohno H, et al. Cell Rep. 2017 Sep 5;20(10):2294-2303. PMID: 28877465
JN785 peIs785. C. elegans peIs785 [casy-1p::daf-2 E11-E11.5(+c)-E12::EGFP + casy-1p::daf-2 E11-E11.5(+c)-E12(-c)::mRFP]. peIs785 caries a daf-2 splicing reporter expressed in many neurons. Reference: Tomioka M, et al. Nat Commun. 2016 May 20;7:11645. PMID: 27198602
JN930 egl-30(pe914) I. C. elegans Presumptive gain-of-function mutant shows defects in salt-food associative learning and olfactory learning. Reference: Tomioka M, et al. 2006 Sep 7;51(5):613-25. PMID: 16950159
SA29 kel-1(pe201)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUnc and L2 larva. kel-1(pe201) homozygotes arrest development at early L2. pe201 deletes a 3.6 kb region including most of the kel-1 ORFs.
temp_name46 gap-2(pe103) X. Y Iino said no mutation (del) present removed 5/1/02

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
pe1102 Allele insertion
pe1209 Transposon insertion insertion
pe1297 Allele insertion
pe372 Allele deletion
pe401 Allele
pe554 Allele insertion
pe201 Allele