Laboratory Information
| Name | GR View on WormBase |
|---|---|
| Allele designation | mg |
| Head | Gary B Ruvkun |
| Institution | Massachusetts General Hospital, Boston, MA |
| Address | MGH - Dept. of Mol. Bio CPZN-7250 185 Cambridge Street Boston 02114 United States |
| Website | http://genetics.mgh.harvard.edu/RuvkunWeb/ |
| Gene classes | aap eak eri fbn hmgr hmgs hpd ist kat lim lipl lpd noah pdk pnk rbr rict somi tph smut ddi |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| GR1028 | mnDp33 (X;IV)/+ IV; let-43(mg49) lon-2(e678) X. | C. elegans | Animals heterozygous for mnDp33 are Lon and segregate Lon and larval lethals. (Animals which have lost mnDp33 are larval lethal. Animals which are homozygous for mnDp33 are also larval lethal (L1-L2).) |
| GR1029 | let-44(mg41) lon-2(e678) X; mnDp31 (X;f). | C. elegans | Animals with mnDp31 are WT and segregate WT and dead embryos. (Animals which have lost mnDp31 arrest as embryos.) |
| GR1032 | age-1(mg44)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT and DpyUnc. age-1(mg44) homozygotes from heterozygous mothers are WT and segregate only dauers at all temperatures. mg44 pka daf-23(mg44). |
| GR1034 | ceh-18(mg57) X. | C. elegans | Mutation resulted from the imprecise loss of pk37::Tc1. Incompletely penetrant sterile and lethal. Defects in oocyte cell cycle arrest, gonad migration, and hypodermal differentiation. See also WBPaper00002965. |
| GR1168 | age-1(mg44)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | age-1(mg44) homozygotes throw all dauers at all temperatures (maternal effect dauer constitutive); can be rescued zygotically. age-1(mg44) homozygous animals that are maternally rescued for dauer formation are long-lived. mg44 is a Trp405 Amber mutation. Heterozygotes are WT and segregate WT (1/3 of which throw only dauers) and DpyUncs. |
| GR1307 | daf-16(mgDf50) I. | C. elegans | Deficiency completely eliminates daf-16 coding region. Makes partial dauers on pheromone. |
| GR1308 | daf-16(mg54) I; daf-2(e1370) III. | C. elegans | mg54 almost completely suppresses the daf-c phenotype of daf-2. 0.4% dauers. |
| GR1309 | daf-16(mgDf47) I; daf-2(e1370) III. | C. elegans | mgDf47 completely suppresses daf-c phenotype of daf-2. mgDf47 deletes approximately 8kb of the daf-16 gene beginning after exon 4. |
| GR1310 | akt-1(mg144) V. | C. elegans | No visible phenotype. Dominant suppressor of daf-c phenotype of age-1. |
| GR1311 | daf-3(mgDf90) X. | C. elegans | mgDf90 completely eliminates the daf-3 coding region. |
| GR1318 | pdk-1(mg142) X. | C. elegans | No visible phenotype. Dominant suppressor of daf-c phenotype of age-1. Ala303Val substitution. |
| GR1322 | pdk-1(sa680) X; mgEx470. | C. elegans | mgEx470 [pdk-1(+) + ttx-3::GFP]. Pick GFP+ to maintain. 9.2-kb PCR product of genomic DNA from the pdk-1(+) genomic region containing 2.7 kb of 5' upstream regulatory sequence, 6.1 kb of coding sequencing containing introns and exons, and 0.4 kb of pdk-1 3' UTR. Reference: Paradis S, et al. Genes Dev. 1999 Jun 1;13(11):1438-52. |
| GR1336 | daf-2(e1370) III; njEx32. | C. elegans | njEx32 [ges-1p::daf-2(+) + ges-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50. |
| GR1337 | daf-2(e1370) III; njEx38. | C. elegans | njEx38 [unc-54p::daf-2(cDNA)::unc-54 3'UTR + unc-54p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50. |
| GR1339 | daf-2(e1370) III; mgEx376. | C. elegans | mgEx376 [unc-14p::daf-2 + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50. |
| GR1340 | daf-2(e1370) III; mgEx373. | C. elegans | mgEx373 [unc-119p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50. |
| GR1352 | daf-16(mgDf47) I; xrIs87. | C. elegans | xrIs87 [daf-16(alpha)::GFP::daf-16B + rol-6(su1006)]. Rollers. GFP expressed in many tissues. Partially rescued for daf-16 (daf-d). |
| GR1366 | mgIs42. | C. elegans | mgIs42 [tph-1::GFP + rol-6(su1006)]. Rollers. |
| GR1371 | lars-2(mg312) unc-29(e1072) I; nDp4 (I;V)/+. | C. elegans | lars-2(mg312) unc-29(e1072) homozygotes are Unc, slow growing, sterile, and have extended life span. Balanced worms are slightly Egl, otherwise WT. |
| GR1373 | eri-1(mg366) IV. | C. elegans | Temperature sensitive: sterile at 25C. Maintain at 15C. Him. Eri. Due to a direct repeat the exact site and sequence of the 23 bp eri-1(mg366) insertion is unclear, however, the insertion lies in exon 6 of T07A9 between nucleotide positions 35215 and 35204 of cosmid T07A9 and includes 23 or these 32 nucleotides tttatcgaaaaaaaaacaggcactttatcgaa. Primers to follow eri-1mg366: GATAAAACTTCGGAACATATGGGGC and ACTGATGGGTAAGGAATCGAAGACG. These primers will give a 170 bp product in N2 and a 193 bp product in eri-1(mg366). |
| GR1379 | lin-35(n745) I; eri-1(mg366) IV. | C. elegans | Temperature sensitive sterile at 25C. Maintain at 15C. |
| GR1428 | mgIs45 I. | C. elegans | mgIs45 [mir-84(+) + tub-1::GFP] I. mir-84 over-expressing line. Reference: Hayes GD, Riedel CG, Ruvkun G. Genes Dev. 2011 Oct 1;25(19):2079-92. |
| GR1431 | mir-84(tm1304) X. | C. elegans | Enhances retarded differentiation of the hypodermis and exit from the molting cycle caused by mutations in let-7 or its paralogs. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41. |
| GR1432 | let-7(mg279) X. | C. elegans | Weakly retarded differentiation of the hypodermis and exit from the molting cycle. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41. |
| GR1433 | let-7(mg279) mir-84(tm1304) X. | C. elegans | Retarded differentiation of the hypodermis and supernumerary molt that results in adult lethality. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41. |
| GR1452 | veIs13 V; let-7(mn112) unc-3(e151) X; mgEx725. | C. elegans | veIs13 [col-19::GFP + rol-6(su1006)] V. mgEx725 [lin-4::let-7 + ttx-3::RFP]. Pick RFP+ to maintain. mgEx725 rescues lethality of let-7(mn112). Precocious expression of col-19::GFP at the L4 stage. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92. |
| GR1583 | somi-1(mg415) V. | C. elegans | Adults slightly Dpy. Suppresses defects caused by over-expression of mir-84. Enhances retarded heterchronic phenotypes caused by a weak allele of let-7 or loss of mir-84. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92. |
| GR1586 | somi-1(tm562) V. | C. elegans | Adults slightly Dpy. Suppresses defects caused by over-expression of mir-84. Enhances retarded heterchronic phenotypes caused by a weak allele of let-7 or loss of mir-84. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92. |
| GR1589 | mgIs45 I; somi-1(mg431) wIs54 V. | C. elegans | mgIs45 [mir-84(over-expressing) + tub-1::GFP] I. wIs54 [scm::GFP] V. Maintain by picking animals with good expression of tub-1::GFP in amphid neurons to maintain. somi-1 mutation suppresses precocious development of the vulva and hypodermal cells caused by over-expression of mir-84. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92. |
| GR1672 | mgEx340. | C. elegans | mgEx340 [akt-1::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. AKT-1::GFP translational fusion containing 6.7 kb akt-1 genomic DNA including 3.2 kb of 5' upstream regulatory region and 3.5 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, Ruvkun G. Genes Dev. 1998 Aug 15;12(16):2488-98. |
| GR1673 | mgEx341. | C. elegans | mgEx341 [akt-2::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. AKT-2::GFP translational fusion containing 5.2 kb akt-1 genomic DNA including 2.1 kb of 5' upstream regulatory region and 3.1 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, Ruvkun G. Genes Dev. 1998 Aug 15;12(16):2488-98. |
| GR1674 | mgEx481. | C. elegans | mgEx481 [pdk-1::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. PDK-1::GFP translational fusion containing 9 kb akt-1 genomic DNA including 2.9 kb of 5' upstream regulatory region and 6.1 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, et al. Genes Dev. 1999 Jun 1;13(11):1438-52. |
| GR1719 | unc-119(ed3) III; mgSi3 IV. | C. elegans | mgSi3 [(pCMP2)ubl-1p::GFP::ubl-1-3'UTR + Cbr-unc-119(+)] IV. Strong ubiquitous GFP expression. Can be used as a control for a strain containing an endogenous siRNA sensor (GR1720). Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616. |
| GR1720 | unc-119(ed3) III; mgSi4 IV. | C. elegans | mgSi4 [(pCMP2)ubl-1p::GFP::siR-1-sensor-ubl-1-3'UTR + Cbr-unc-119(+)] IV. Very weak ubiquitous GFP expression. The 22G siR-1 sensor transgene is more sensitive to gene inactivations that affect 22G siR-1 levels when grown at 25C compared to 20C. Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616. |
| GR1747 | mut-15(tm1358) V. | C. elegans | Him. Mutator. RNAi-defective. Temperature-sensitive sterile at 25C. Reference: Phillips CM, et al. Genes Dev. 2012 Jul 1;26(13):1433-44. |
| GR1748 | unc-119(ed3) III; mgSi2 IV. | C. elegans | mgSi2 [mut-16p::mut-16::GFP::mut-16 3'UTR + unc-119(+)] IV. MosSCI integrant of mut-16::GFP rescues pk710. Reference: Phillips CM, et al. Genes Dev. 2012 Jul 1;26(13):1433-44. |
| GR1808 | rde-10(mg458) I. | C. elegans | RNAi-defective. Reference: Zhang C, et al. Curr Biol. 2012 May 22;22(10):881-90. |
| GR1814 | eri-6(mg379) I. | C. elegans | Reference: Fischer SE, et al. Nature. 2008 Sep 25;455(7212):491-6. |
| GR1823 | mut-16(mg461) I. | C. elegans | RNAi-deficient in soma. Reference: Zhang C, et al. Proc Natl Acad Sci U S A. 2011 Jan 25;108(4):1201-8. |
| GR1895 | daf-2(e1370) III; mgIs67. | C. elegans | mgIs67 [daf-16p::daf-16::GFP + rol-6(su1006)]. Temperature-sensitive. Daf-c. Maintain at 15C. Dauer formation at 25C. Slow growing. Dauer-like at 20C. DAF-16::GFP is fully nuclear at 20C. Reference: Riedel CG, et al. Nat Cell Biol. 2013 May;15(5):491-501. |
| GR2062 | eri-7(mg369) I. | C. elegans | Loss-of-function allele; stronger than eri-7(mg411). Reference: Fischer SE, et al. Nature. 2008 Sep 25;455(7212):491-6. |
| GR2107 | daf-2(e1370) III; mgEx371. | C. elegans | mgEx371 [dpy-30p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50. |
| GR2116 | mgEx579. | C. elegans | mgEx579 [ins-18p::GFP + rol-6(su1006)]. Pick Rollers to maintain. ins-18::GFP promoter fusion containing 4.9 kb upstream regulatory sequence and 2.1 kb of coding region (including exons and introns) driving GFP expression with 0.8 kb downstream sequence. Reference: Pierce SB, et al. Genes Dev. 2001 Mar 15;15(6):672-86. |
| GR2117 | daf-2(e1365) III; mgIs35. | C. elegans | mgIs35 [ins-1(genomic) + mec-7p::GFP]. Temperature-sensitive. Maintain at 15C. Daf-c. High penetrance of dauer formation at 20C. Integration of mgEx557. Reference: Pierce SB, et al. Genes Dev. 2001 Mar 15;15(6):672-86. |
| GR2118 | daf-9(e1406) dpy-7(sc27) X; mgEx663. | C. elegans | mgEx663 [dpy-7p::daf-9B(cDNA)::GFP + mec-7::GFP]. Pick GFP+ to maintain. GFP fusion containing 0.4 kb dpy-7 promoter and daf-9 isoform B cDNA. Reference: Mak HY, Ruvkun G. Development. 2004 Apr;131(8):1777-86. |
| GR2183 | mgIs72 II. | C. elegans | mgIs72 [rpt-3p::GFP + dpy-5(+)] II. Reporter of proteasome subunit expression can be used to assay skn-1a-dependent regulation of proteasome subunit genes. mgIs72 [rpt-3::gfp] integrated transgene was generated from sEx15003. |
| GR2198 | mgTi1 I; unc-119(ed3) III. | C. elegans | mgTi1 [rpl-28p::skn-1a::GFP::tbb-2 3'UTR + unc-119(+)] I. Expresses SKN-1A with C-terminal GFP tag. Reference: Lehrbach NL & Ruvkun G. Elife. 2016 Aug 16;5. pii: e17721 |
| GR2202 | ddi-1(mg571) IV. | C. elegans | Superficially wild-type. |
| GR2203 | ddi-1(mg572) IV. | C. elegans | Superficially wild-type. Mutation in active site of ddi-1 protease. |
| GR2214 | sel-1(mg547) V. | C. elegans | Superficially wild-type. |
| GR2232 | sel-9(mg550) V. | C. elegans | Superficially wild-type. |
| GR2245 | skn-1(mg570) IV. | C. elegans | Superficially wild-type |
| GR2247 | mdt-15(mg584) III. | C. elegans | Gain of function allele of mdt-15. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1. |
| GR2250 | mgIs73 V. | C. elegans | mgIs73 [cyp-14A4p::gfp::cyp-14A4 3’UTR + myo-2p::mCherry] V. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1. |
| GR2255 | moc-2(mg595) V. | C. elegans | Can be maintained on OP50. Requires dietary Moco for viability. Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y. |
| GR2256 | F49E2.1(mg589) X. | C. elegans | F49E2.1. Can be maintained on OP50. Requires dietary Moco for viability. Reference: (F49E2.1 referred to as moc-5) Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y. |
| GR2257 | cth-2(mg599) II. | C. elegans | Can be maintained on OP50. Suppresses Moco-deficient larval lethality. Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y. |
| GR2260 | cdo-1(mg622) X. | C. elegans | Can be maintained on OP50. Suppresses Moco-deficient larval lethality. Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y. |
| GR2263 | nhr-45(mg641) X. | C. elegans | Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1. |
| GR2272 | rnp-2(mg582) IV. | C. elegans | CRISPR/Cas9 used to engineer a 6bp in-frame deletion in 5' coding region removing 2 amino acid residues that are conserved from yeast to human that might be critical for U1A binding to U1 snRNA Reference: Newman MA, et al. Genes Dev. 2018 May 1;32(9-10):670-681. PMID: 29739806 |
| GR3055 | suox-1(mg663)/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X | C. elegans | Larval lethal mutation balanced by tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)]. Balancer marked with myo-2p::Venus. Maintain by picking non-Unc GFP+ animals. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP mg663 homozygotes (lethal), and Unc GFP+ (homozygous tmC24). Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y. |
| GR3090 | mgIs77 V. | C elegans | mgIs77 [rpl-28p::ub(G76V)::GFP + unc-119(+) + myo-2p::mCherry] V. Reference: Lehrbach NJ, et al. Cell. 2019 Apr 18;177(3):737-750.e15. |
| GR3149 | mgIs72 II; mgIs78 IV. | C elegans | mgIs72 [rpt-3p::GFP + dpy-5(+)] II. mgIs78 [myo-3p::H2B::mCherry::SL2::pbs-5(T65A)] IV. Muscle-specific proteasome dysfunction. Reference: Lehrbach NJ & Ruvkun G. Elife. 2019 Apr 11;8. pii: e44425. doi: 10.7554/eLife.44425. |
| MGH171 | sid-1(qt9) V; alxIs9. | C. elegans | alxIs9 [vha-6p::sid-1::SL2::GFP]. Gut-sensitive RNAi line. Stable line with strong GFP signal. |
| QK52 | rde-1(ne219) V; xkIs99. | C. elegans | xkIs99 [wrt-2p::rde-1::unc-54 3'UTR]. NOTE: This strain was originally published as JM43 in Melo JA, Ruvkun G. Reference: Melo JA, Ruvkun G. Cell. 2012 Apr 13;149(2):452-66. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| mgDf47 | Allele | deletion | |
| mg306 | Allele | substitution | nonsense |
| mg344 | Allele | substitution | |
| mg348 | Allele | substitution | |
| mg337 | Allele | substitution | splice_site |
| mg329 | Allele | substitution | nonsense |
| mg338 | Allele | substitution | |
| mg285 | Allele | deletion | |
| mg44 | Allele | substitution | nonsense |
| mg242 | Allele | substitution | nonsense |
| mg109 | Allele | ||
| mg255 | Allele | substitution | nonsense |
| mg261 | Allele | substitution | |
| mg247 | Allele | substitution | |
| mg57 | Allele | ||
| mg36 | Allele | ||
| mgDf50 | insertion | ||
| mg49 | Allele | ||
| mg41 | Allele | ||
| mg54 | Allele | ||
| mg144 | Allele | substitution | |
| mg142 | Allele | substitution | |
| mg280 | Allele | deletion | |
| mg312 | Allele | substitution | nonsense |
| mg366 | Allele | insertion | frameshift |
| mg279 | Allele | deletion | |
| mg415 | Allele | ||
| mg431 | Allele | ||
| mg458 | |||
| mg379 | Allele | ||
| mg461 | Allele | deletion | |
| mg369 | Allele | ||
| mg433 | Allele | substitution | nonsense |
| mg360 | Allele | substitution | |
| mg158 | Allele | substitution | |
| mg60 | Allele | ||
| mg375 | Allele | substitution | |
| mg373 | Allele | substitution |