Laboratory Information

NameGR View on WormBase
Allele designationmg
HeadGary B Ruvkun
InstitutionMassachusetts General Hospital, Boston, MA
Address MGH - Dept. of Mol. Bio
CPZN-7250
185 Cambridge Street
Boston 02114
United States
Website http://genetics.mgh.harvard.edu/RuvkunWeb/
Gene classes aap  eak  eri  fbn  hmgr  hmgs  hpd  ist  kat  lim  lipl  lpd  noah  pdk 
pnk  rbr  rict  somi  tph  smut  ddi 

Strains contributed by this laboratory

Strain Genotype Species Description
GR1028 mnDp33 (X;IV)/+ IV; let-43(mg49) lon-2(e678) X. C. elegans Animals heterozygous for mnDp33 are Lon and segregate Lon and larval lethals. (Animals which have lost mnDp33 are larval lethal. Animals which are homozygous for mnDp33 are also larval lethal (L1-L2).)
GR1029 let-44(mg41) lon-2(e678) X; mnDp31 (X;f). C. elegans Animals with mnDp31 are WT and segregate WT and dead embryos. (Animals which have lost mnDp31 arrest as embryos.)
GR1032 age-1(mg44)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT and DpyUnc. age-1(mg44) homozygotes from heterozygous mothers are WT and segregate only dauers at all temperatures. mg44 pka daf-23(mg44).
GR1034 ceh-18(mg57) X. C. elegans Mutation resulted from the imprecise loss of pk37::Tc1. Incompletely penetrant sterile and lethal. Defects in oocyte cell cycle arrest, gonad migration, and hypodermal differentiation. See also WBPaper00002965.
GR1168 age-1(mg44)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans age-1(mg44) homozygotes throw all dauers at all temperatures (maternal effect dauer constitutive); can be rescued zygotically. age-1(mg44) homozygous animals that are maternally rescued for dauer formation are long-lived. mg44 is a Trp405 Amber mutation. Heterozygotes are WT and segregate WT (1/3 of which throw only dauers) and DpyUncs.
GR1307 daf-16(mgDf50) I. C. elegans Deficiency completely eliminates daf-16 coding region. Makes partial dauers on pheromone.
GR1308 daf-16(mg54) I; daf-2(e1370) III. C. elegans mg54 almost completely suppresses the daf-c phenotype of daf-2. 0.4% dauers.
GR1309 daf-16(mgDf47) I; daf-2(e1370) III. C. elegans mgDf47 completely suppresses daf-c phenotype of daf-2. mgDf47 deletes approximately 8kb of the daf-16 gene beginning after exon 4.
GR1310 akt-1(mg144) V. C. elegans No visible phenotype. Dominant suppressor of daf-c phenotype of age-1.
GR1311 daf-3(mgDf90) X. C. elegans mgDf90 completely eliminates the daf-3 coding region.
GR1318 pdk-1(mg142) X. C. elegans No visible phenotype. Dominant suppressor of daf-c phenotype of age-1. Ala303Val substitution.
GR1322 pdk-1(sa680) X; mgEx470. C. elegans mgEx470 [pdk-1(+) + ttx-3::GFP]. Pick GFP+ to maintain. 9.2-kb PCR product of genomic DNA from the pdk-1(+) genomic region containing 2.7 kb of 5' upstream regulatory sequence, 6.1 kb of coding sequencing containing introns and exons, and 0.4 kb of pdk-1 3' UTR. Reference: Paradis S, et al. Genes Dev. 1999 Jun 1;13(11):1438-52.
GR1336 daf-2(e1370) III; njEx32. C. elegans njEx32 [ges-1p::daf-2(+) + ges-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
GR1337 daf-2(e1370) III; njEx38. C. elegans njEx38 [unc-54p::daf-2(cDNA)::unc-54 3'UTR + unc-54p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
GR1339 daf-2(e1370) III; mgEx376. C. elegans mgEx376 [unc-14p::daf-2 + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
GR1340 daf-2(e1370) III; mgEx373. C. elegans mgEx373 [unc-119p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
GR1352 daf-16(mgDf47) I; xrIs87. C. elegans xrIs87 [daf-16(alpha)::GFP::daf-16B + rol-6(su1006)]. Rollers. GFP expressed in many tissues. Partially rescued for daf-16 (daf-d).
GR1366 mgIs42. C. elegans mgIs42 [tph-1::GFP + rol-6(su1006)]. Rollers.
GR1371 lars-2(mg312) unc-29(e1072) I; nDp4 (I;V)/+. C. elegans lars-2(mg312) unc-29(e1072) homozygotes are Unc, slow growing, sterile, and have extended life span. Balanced worms are slightly Egl, otherwise WT.
GR1373 eri-1(mg366) IV. C. elegans Temperature sensitive: sterile at 25C. Maintain at 15C. Him. Eri. Due to a direct repeat the exact site and sequence of the 23 bp eri-1(mg366) insertion is unclear, however, the insertion lies in exon 6 of T07A9 between nucleotide positions 35215 and 35204 of cosmid T07A9 and includes 23 or these 32 nucleotides tttatcgaaaaaaaaacaggcactttatcgaa. Primers to follow eri-1mg366: GATAAAACTTCGGAACATATGGGGC and ACTGATGGGTAAGGAATCGAAGACG. These primers will give a 170 bp product in N2 and a 193 bp product in eri-1(mg366).
GR1379 lin-35(n745) I; eri-1(mg366) IV. C. elegans Temperature sensitive sterile at 25C. Maintain at 15C.
GR1428 mgIs45 I. C. elegans mgIs45 [mir-84(+) + tub-1::GFP] I. mir-84 over-expressing line. Reference: Hayes GD, Riedel CG, Ruvkun G. Genes Dev. 2011 Oct 1;25(19):2079-92.
GR1431 mir-84(tm1304) X. C. elegans Enhances retarded differentiation of the hypodermis and exit from the molting cycle caused by mutations in let-7 or its paralogs. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41.
GR1432 let-7(mg279) X. C. elegans Weakly retarded differentiation of the hypodermis and exit from the molting cycle. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41.
GR1433 let-7(mg279) mir-84(tm1304) X. C. elegans Retarded differentiation of the hypodermis and supernumerary molt that results in adult lethality. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41.
GR1452 veIs13 V; let-7(mn112) unc-3(e151) X; mgEx725. C. elegans veIs13 [col-19::GFP + rol-6(su1006)] V. mgEx725 [lin-4::let-7 + ttx-3::RFP]. Pick RFP+ to maintain. mgEx725 rescues lethality of let-7(mn112). Precocious expression of col-19::GFP at the L4 stage. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92.
GR1583 somi-1(mg415) V. C. elegans Adults slightly Dpy. Suppresses defects caused by over-expression of mir-84. Enhances retarded heterchronic phenotypes caused by a weak allele of let-7 or loss of mir-84. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92.
GR1586 somi-1(tm562) V. C. elegans Adults slightly Dpy. Suppresses defects caused by over-expression of mir-84. Enhances retarded heterchronic phenotypes caused by a weak allele of let-7 or loss of mir-84. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92.
GR1589 mgIs45 I; somi-1(mg431) wIs54 V. C. elegans mgIs45 [mir-84(over-expressing) + tub-1::GFP] I. wIs54 [scm::GFP] V. Maintain by picking animals with good expression of tub-1::GFP in amphid neurons to maintain. somi-1 mutation suppresses precocious development of the vulva and hypodermal cells caused by over-expression of mir-84. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92.
GR1672 mgEx340. C. elegans mgEx340 [akt-1::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. AKT-1::GFP translational fusion containing 6.7 kb akt-1 genomic DNA including 3.2 kb of 5' upstream regulatory region and 3.5 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, Ruvkun G. Genes Dev. 1998 Aug 15;12(16):2488-98.
GR1673 mgEx341. C. elegans mgEx341 [akt-2::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. AKT-2::GFP translational fusion containing 5.2 kb akt-1 genomic DNA including 2.1 kb of 5' upstream regulatory region and 3.1 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, Ruvkun G. Genes Dev. 1998 Aug 15;12(16):2488-98.
GR1674 mgEx481. C. elegans mgEx481 [pdk-1::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. PDK-1::GFP translational fusion containing 9 kb akt-1 genomic DNA including 2.9 kb of 5' upstream regulatory region and 6.1 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, et al. Genes Dev. 1999 Jun 1;13(11):1438-52.
GR1719 unc-119(ed3) III; mgSi3 IV. C. elegans mgSi3 [(pCMP2)ubl-1p::GFP::ubl-1-3'UTR + Cbr-unc-119(+)] IV. Strong ubiquitous GFP expression. Can be used as a control for a strain containing an endogenous siRNA sensor (GR1720). Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616.
GR1720 unc-119(ed3) III; mgSi4 IV. C. elegans mgSi4 [(pCMP2)ubl-1p::GFP::siR-1-sensor-ubl-1-3'UTR + Cbr-unc-119(+)] IV. Very weak ubiquitous GFP expression. The 22G siR-1 sensor transgene is more sensitive to gene inactivations that affect 22G siR-1 levels when grown at 25C compared to 20C. Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616.
GR1747 mut-15(tm1358) V. C. elegans Him. Mutator. RNAi-defective. Temperature-sensitive sterile at 25C. Reference: Phillips CM, et al. Genes Dev. 2012 Jul 1;26(13):1433-44.
GR1748 unc-119(ed3) III; mgSi2 IV. C. elegans mgSi2 [mut-16p::mut-16::GFP::mut-16 3'UTR + unc-119(+)] IV. MosSCI integrant of mut-16::GFP rescues pk710. Reference: Phillips CM, et al. Genes Dev. 2012 Jul 1;26(13):1433-44.
GR1808 rde-10(mg458) I. C. elegans RNAi-defective. Reference: Zhang C, et al. Curr Biol. 2012 May 22;22(10):881-90.
GR1814 eri-6(mg379) I. C. elegans Reference: Fischer SE, et al. Nature. 2008 Sep 25;455(7212):491-6.
GR1823 mut-16(mg461) I. C. elegans RNAi-deficient in soma. Reference: Zhang C, et al. Proc Natl Acad Sci U S A. 2011 Jan 25;108(4):1201-8.
GR1895 daf-2(e1370) III; mgIs67. C. elegans mgIs67 [daf-16p::daf-16::GFP + rol-6(su1006)]. Temperature-sensitive. Daf-c. Maintain at 15C. Dauer formation at 25C. Slow growing. Dauer-like at 20C. DAF-16::GFP is fully nuclear at 20C. Reference: Riedel CG, et al. Nat Cell Biol. 2013 May;15(5):491-501.
GR2062 eri-7(mg369) I. C. elegans Loss-of-function allele; stronger than eri-7(mg411). Reference: Fischer SE, et al. Nature. 2008 Sep 25;455(7212):491-6.
GR2107 daf-2(e1370) III; mgEx371. C. elegans mgEx371 [dpy-30p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
GR2116 mgEx579. C. elegans mgEx579 [ins-18p::GFP + rol-6(su1006)]. Pick Rollers to maintain. ins-18::GFP promoter fusion containing 4.9 kb upstream regulatory sequence and 2.1 kb of coding region (including exons and introns) driving GFP expression with 0.8 kb downstream sequence. Reference: Pierce SB, et al. Genes Dev. 2001 Mar 15;15(6):672-86.
GR2117 daf-2(e1365) III; mgIs35. C. elegans mgIs35 [ins-1(genomic) + mec-7p::GFP]. Temperature-sensitive. Maintain at 15C. Daf-c. High penetrance of dauer formation at 20C. Integration of mgEx557. Reference: Pierce SB, et al. Genes Dev. 2001 Mar 15;15(6):672-86.
GR2118 daf-9(e1406) dpy-7(sc27) X; mgEx663. C. elegans mgEx663 [dpy-7p::daf-9B(cDNA)::GFP + mec-7::GFP]. Pick GFP+ to maintain. GFP fusion containing 0.4 kb dpy-7 promoter and daf-9 isoform B cDNA. Reference: Mak HY, Ruvkun G. Development. 2004 Apr;131(8):1777-86.
GR2183 mgIs72 II. C. elegans mgIs72 [rpt-3p::GFP + dpy-5(+)] II. Reporter of proteasome subunit expression can be used to assay skn-1a-dependent regulation of proteasome subunit genes. mgIs72 [rpt-3::gfp] integrated transgene was generated from sEx15003.
GR2198 mgTi1 I; unc-119(ed3) III. C. elegans mgTi1 [rpl-28p::skn-1a::GFP::tbb-2 3'UTR + unc-119(+)] I. Expresses SKN-1A with C-terminal GFP tag. Reference: Lehrbach NL & Ruvkun G. Elife. 2016 Aug 16;5. pii: e17721
GR2202 ddi-1(mg571) IV. C. elegans Superficially wild-type.
GR2203 ddi-1(mg572) IV. C. elegans Superficially wild-type.  Mutation in active site of ddi-1 protease.
GR2214 sel-1(mg547) V. C. elegans Superficially wild-type.
GR2232 sel-9(mg550) V. C. elegans Superficially wild-type.
GR2245 skn-1(mg570) IV. C. elegans Superficially wild-type
GR2247 mdt-15(mg584) III. C. elegans Gain of function allele of mdt-15. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1.
GR2249 hsp-6(mg585) V. C. elegans Slow growth. Low brood size. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1.
GR2250 mgIs73 V. C. elegans mgIs73 [cyp-14A4p::gfp::cyp-14A4 3’UTR + myo-2p::mCherry] V. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1.
GR2255 moc-2(mg595) V. C. elegans Can be maintained on OP50. Requires dietary Moco for viability. Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
GR2256 F49E2.1(mg589) X. C. elegans F49E2.1. Can be maintained on OP50. Requires dietary Moco for viability. Reference: (F49E2.1 referred to as moc-5) Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
GR2257 cth-2(mg599) II. C. elegans Can be maintained on OP50. Suppresses Moco-deficient larval lethality. Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
GR2260 cdo-1(mg622) X. C. elegans Can be maintained on OP50. Suppresses Moco-deficient larval lethality. Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
GR2263 nhr-45(mg641) X. C. elegans Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1.
GR2272 rnp-2(mg582) IV. C. elegans CRISPR/Cas9 used to engineer a 6bp in-frame deletion in 5' coding region removing 2 amino acid residues that are conserved from yeast to human that might be critical for U1A binding to U1 snRNA Reference: Newman MA, et al. Genes Dev. 2018 May 1;32(9-10):670-681. PMID: 29739806
GR3055 suox-1(mg663)/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X C. elegans Larval lethal mutation balanced by tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)]. Balancer marked with myo-2p::Venus. Maintain by picking non-Unc GFP+ animals. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP mg663 homozygotes (lethal), and Unc GFP+ (homozygous tmC24). Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
GR3066 atp-1(mg665);[sur-5::GFP] C. elegans Him, some $ embryonic lethal, slightly eri, abnormal shapes of gut nuclei
GR3068 dog-1(mg667); [sur-5::GFP] C. elegans Abnormal shapes of gut nuclei, superficially wild-type
GR3090 mgIs77 V. C elegans mgIs77 [rpl-28p::ub(G76V)::GFP + unc-119(+) + myo-2p::mCherry] V. Reference: Lehrbach NJ, et al. Cell. 2019 Apr 18;177(3):737-750.e15.
GR3149 mgIs72 II; mgIs78 IV. C elegans mgIs72 [rpt-3p::GFP + dpy-5(+)] II. mgIs78 [myo-3p::H2B::mCherry::SL2::pbs-5(T65A)] IV. Muscle-specific proteasome dysfunction. Reference: Lehrbach NJ & Ruvkun G. Elife. 2019 Apr 11;8. pii: e44425. doi: 10.7554/eLife.44425.
MGH171 sid-1(qt9) V; alxIs9. C. elegans alxIs9 [vha-6p::sid-1::SL2::GFP]. Gut-sensitive RNAi line. Stable line with strong GFP signal.
QK52 rde-1(ne219) V; xkIs99. C. elegans xkIs99 [wrt-2p::rde-1::unc-54 3'UTR]. NOTE: This strain was originally published as JM43 in Melo JA, Ruvkun G. Reference: Melo JA, Ruvkun G. Cell. 2012 Apr 13;149(2):452-66.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
mgDf47 Allele deletion
mg306 Allele substitution nonsense
mg344 Allele substitution
mg348 Allele substitution
mg337 Allele substitution splice_site
mg329 Allele substitution nonsense
mg338 Allele substitution
mg285 Allele deletion
mg44 Allele substitution nonsense
mg242 Allele substitution nonsense
mg109 Allele
mg255 Allele substitution nonsense
mg261 Allele substitution
mg247 Allele substitution
mg57 Allele
mg36 Allele
mgDf50 insertion
mg49 Allele
mg41 Allele
mg54 Allele
mg144 Allele substitution
mg142 Allele substitution
mg280 Allele deletion
mg312 Allele substitution nonsense
mg366 Allele insertion frameshift
mg279 Allele deletion
mg415 Allele
mg431 Allele
mg458
mg379 Allele
mg461 Allele deletion
mg369 Allele
mg433 Allele substitution nonsense
mg360 Allele substitution
mg158 Allele substitution
mg60 Allele
mg375 Allele substitution
mg373 Allele substitution