Laboratory Information

NameGOU View on WormBase
Allele designationcas
HeadGuangshuo Ou
InstitutionTsinghua University, Beijing, China
Address Medical Science Building, Rm. D217, Tsinghua University
Beijing 100084
China
Website http://www.cls.edu.cn/english/PrincipalInvestigator/pi/index2187.shtml
Gene classes soem 

Strains contributed by this laboratory

Strain Genotype Species Description
GOU1861 wsp-1a(cas723[gfp::wsp-1a] IV; arx-2(cas725[arx-2::TagRFP]) V. C. elegans Constructed by crossing individual fluorescence knock-in worms. TagRFP inserted into the endogenous arx-2 gene at its C-terminus and GFP inserted into the endogenous wsp-1a gene at its N-terminus by Cas9-triggered homologous recombination.
GOU2042 eff-1(cas618 [eff-1::gfp]) II. C. elegans GFP inserted into the endogenous eff-1 gene at its C-terminus by Cas9-triggered homologous recombination. Green fluorescence enriched in V.a cell 20min before cell-cell fusion in larvae. Very weak fluorescence in hyp7 cell. Reference: Yang Y, et al. Dev Cell. 2017 Apr 10;41(1):107-120.
GOU2043 vab-10a(cas602[vab-10a::gfp]) I. C. elegans GFP inserted into the endogenous vab-10a gene at its C-terminus by Cas9-triggered homologous recombination.
GOU2044 vab-10a(cas627[vab-10a::TagBFP]) I. C. elegans vab-10a(cas627 [vab-10a::TagBFP]) I.
GOU2162 che-3(cas443[gfp::che-3]) I; xbx-1(cas502[xbx-1::tagRFP]) V. C. elegans Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous che-3 locus at the N-terminus and tagRFP::3xFlag inserted into the endogenous xbx-1 locus at the C-terminus by Cas9-triggered homologous recombination. Fluorescence enriched in most if not all sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.
GOU2171 ift-43(cas530) II; mnIs17 V. C. elegans mnIs17 [osm-6::GFP + unc-36(+)]. cas530 is a 641 bp deletion introduced by Cas9-triggered germ line knockout. Deletion left flank: ATGAAGCAAACGAG; deletion right flank: TAAAAAGGAAAGGATAGATGC. Lipophilic dye filling and morphology and IFT of amphid and phasmid cilia are superficially wild type.
GOU2187 klp-20(cas447[klp-20::gfp]) III; xbx-1(cas502[xbx-1::tagRFP]) V; ift-81(cas498[ift-81::tagBFP]) X. C. elegans Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous klp-20 gene at its C-terminus, tagRFP::3xFlag inserted into the endogenous xbx-1 gene at its C-terminus and tagBFP inserted into the endogenous ift-81 gene at its C-terminus by Cas9-triggered homologous recombination. GFP enriched at the proximal region (middle segment) of amphid or phasmid sensory cilia while red and blue fluorescence enriched along the whole cilia. Very weak fluorescence in the cell bodies of ciliated neurons.
GOU2190 ift-43(cas531) II; ift-139(gk508) III; mnIs17 V. C. elegans mnIs17 [osm-6::GFP + unc-36(+)]. Lipophilic dye filling is 100% defective and the amphid and phasmid sensory cilia are severely shortened with strong IFT particle accumulation. cas531 is a 612 bp deletion introduced by Cas9-triggered germ line knockout. Deletion left flank: ATGAAGCAAACGAGCCAG; deletion right flank: TCTTCAATTCTCTCGAGT.
GOU2356 che-3(cas443[gfp::che-3]) I. C. elegans GFP inserted into the endogenous che-3 locus at the N-terminus by Cas9-triggered homologous recombination. Green fluorescence enriched in most, if not all, sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.
GOU2360 che-11(cas497[che-11::gfp]) V. C. elegans GFP inserted into the endogenous che-11 locus at the C-terminus by Cas9-triggered homologous recombination. Green fluorescence enriched in most, if not all, sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.
GOU2361 ift-81(cas498[ift-81::tagBFP]) X. C. elegans TagBFP inserted into the endogenous ift-81 locus at the C-terminus by Cas9-triggered homologous recombination. Green fluorescence enriched in most, if not all, sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.
GOU2362 ift-74(cas499[ift-74::gfp]) II. C. elegans GFP inserted into the endogenous ift-74 locus at the C-terminus by Cas9-triggered homologous recombination. Green fluorescence enriched in most, if not, all sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.
GOU2363 che-3(cas496[gfp::che-3(R295C)]) I. C. elegans GFP inserted into the endogenous che-3 locus at its N-terminus and R295C mutation introduced by Cas9-triggered homologous recombination. Weaker lipophilic dye filling than wild-type, and the amphid and phasmid sensory cilia are shortened without evident IFT particle accumulation.
GOU2364 che-3(cas528[gfp::che-3(R1384C)]) I. C. elegans GFP inserted into the endogenous che-3 gene at its N-terminus and R1384C mutation introduced by Cas9-triggered homologous recombination. Lipophilic dye filling is superficially wild-type and the amphid and phasmid sensory cilia are mildly shortened without evident IFT particle accumulation.
GOU2365 che-3(cas512[gfp::che-3(R1693C)]) I. C. elegans GFP inserted into the endogenous che-3 gene at its N-terminus and R1693C mutation introduced by Cas9-triggered homologous recombination. Lipophilic dye filling is 100% defective and the amphid and phasmid sensory cilia are severely shortened without evident IFT particle accumulation.
GOU2366 che-3(cas511[gfp::che-3(K2935Q)]) I. C. elegans GFP inserted into the endogenous che-3 locus at its N-terminus and K2935Q mutation introduced by Cas9-triggered homologous recombination. Lipophilic dye filling is 100% defective and the amphid and phasmid sensory cilia are severely shortened with strong IFT particle accumulation.
GOU2382 che-3(cas527[gfp::che-3(delta_V828-L984)]) I. C. elegans GFP inserted into the endogenous che-3 locuse at its N-terminus and 659 bp in-frame deletion introduced by Cas9-triggered genome editing. Deletion left flank: TTGGTTAGTGATATCTCAAG; deletion right flank: ATGGGCATCAATCAATGAT. Weak green fluorescence in the cell bodies of ciliated neurons but not in the amphid or phasmid cilia. Lipophilic dye filling is 100% defective.
GOU2936 spc-1(cas815[spc-1::GFP]) X. C. elegans Endogenous spc-1 locus tagged with GFP at C-terminus. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.
GOU3103 unc-70(cas962[GFP::unc-70]) V. C. elegans GFP inserted at the N-terminus of the endogenous unc-70 locus. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.
GOU3237 unc-70(cas983) V. C. elegans unc-70(cas983) removes nine amino acids (H590-L598) in the SCA5-associated deletion in β-spectrin by Cas9-triggered homologous recombination. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.
GOU3238 spc-1(cas971[spc-1(L268P)]) X. C. elegans L268P mutation introduced in α-spectrin by Cas9-triggered homologous recombination. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.
GOU3519 spc-1(cas1047[spc-1::7×GFP11]) X. C. elegans 7×GFP11 tag inserted into the C-terminus of the endogenous spc-1 locus by Cas9-triggered homologous recombination. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.
GOU3599 spc-1(cas1049[spc-1(L268P)::GFP]) X. C. elegans L268P mutation introduced in GFP-tagged α-spectrin by Cas9-triggered homologous recombination. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.
GOU3601 unc-70(cas1050[unc-70(delta H590-L598)::GFP]) V. C. elegans unc-70(cas1050) removes nine amino acids (H590-L598) in the SCA5-associated deletion in β-spectrin and inserts GFP at N-terminus of the endogenous unc-70 locus. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.
RDV55 rdvIs1 III. C. elegans rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.
RDV83 rdvIs1 III; zuIs45 V. C. elegans rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.
RDV84 rdvIs1 III; ddIs6 V. C. elegans rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. ddIs6 [pie-1p::GFP::tbg-1 + unc-119(+)] V. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.
This laboratory hasn't submitted any alleles to the CGC.