Laboratory Information
| Name | EJ View on WormBase |
|---|---|
| Allele designation | dx |
| Head | Eric J Lambie |
| Institution | University College London |
| Address | UCL Biosciences Stores Anatomy Building, Gower Street, University College London, Dept Cell and Devel Biology London WC1E 6BT United Kingdom |
| Website | https://www.ucl.ac.uk/biosciences/people/dr-eric-lambie |
| Gene classes | gem gum neg pex |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| EJ1158 | gon-2(q388) I. | C. elegans | NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] Reference: Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89. |
| EJ1167 | gem-1(bc364) X. | C. elegans | bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91. |
| EJ1171 | gon-2(q388) I; gem-1(bc364) X. | C. elegans | NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. The stock will propagate on non-supplemented media at 20 degrees, but this will potentially select for intragenic revertants of gon-2(q388). Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is very high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91. Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89. |
| EJ238 | mek-2(q425) unc-11(e47) I; sDp2 (I;f). | C. elegans | Animals with the duplication are WT. Animals which have lost the duplication are Unc, Sterile and Vul at all temperatures. |
| EJ255 | mek-2(q484) I; sDp2 (I;f). | C. elegans | Animals with the duplication are WT. Animals which have lost the duplication are Sterile and Vul. At 15C rare animals will have a protruding vulva. At 20C and 25C animals with protruding vulva are more common, about 10%. |
| EJ26 | gon-2(q362) I. | C. elegans | Starvation sensitive gonadogenesis defect. |
| EJ275 | unc-29(e1072)/dxDf1 I. | C. elegans | Heterozygotes are WT and segregate WT, Uncs and dead eggs. |
| EJ374 | gon-2(dx22) fer-1(hc1) unc-29(e1072) I. | C. elegans | Unc. Temperature senstive for both gon-2 and fer-1. Maintain at 15C. Will also grow at 20C. Received new stock 10/12/00 from EJ. |
| EJ420 | gon-2(dx23) fer-1(hc1) I. | C. elegans | Temperature sensitive for both gon-2 and fer-1. Maintain at 15C. Will also grow at 20C. |
| EJ808 | gem-4(dx77) IV. | C. elegans | No apparent phenotype. Suppressor of gon-2(q388). |
| EJ810 | F25H2.5(ok314)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III; him-8(e1489) IV. | C. elegans | Him. Heterozygotes are WT and segregate WT, Sterile Evul and Dpys. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| dx84 | Allele | deletion | |
| dx25 | Allele | ||
| dx31 | Allele | ||
| dx22 | Allele | substitution | |
| dx23 | Allele | ||
| dx19 | Allele | substitution | nonsense |
| dx77 | Allele | insertion | splice_site |
| dx40 | Allele | ||
| dx2 | Allele | substitution | nonsense |
| dx27 | Allele | deletion |