University of Minnesota Driven to Discover logo

Caenorhabditis Genetics Center (CGC)

    • Sign In

    Strain Information

    Name DET13   View On Wormbase
    Species C. elegans
    Genotypeabf-5 (ok3208) X
    DescriptionNo observed phenotype; can confirm genotype using a three-primer reaction Ceabf5genL: CTGCCACTATTGTCACAAAATC Ceabf5WT: CGAATCCTGCACCAAACATC Ceabf5MUT: GTGACATGGGAAACATTTGAC WT band: ~300 bp MUT band: ~400 bp
    Mutagen
    Outcrossedx16
    Made byD. Ellen K. Tarr
    Laboratory DET
    Reference Not yet published
    Sign in or register an account if you want to order this strain.
    • Job Opportunities within the CGC
    • CGC Home
    • Search Strains
    • Register
      (existing labs)
    • Request a Lab Code
      (new labs)
    • Strain List
      • Recently Added Strains
      • Endogenously-tagged Loci
      • Protein depletion strains NEW!
      • Wild Isolates
        (Caenorhabditis sp.)
      • Wild Isolates
        (non-Caenorhabditis sp.)
      • Strain List (text file)
    • Strain Donation
      (Users must be signed in)
    • Request Knockout
      (of Alzheimer's related genes)
    • Lab List
    • Acknowledging the CGC
    • Contact
    • Frequently Asked Questions (FAQs)
    • Conditions Of Use

    • What Is C. elegans?
    • Nomenclature

    • CaeNDR - the Caenorhabditis Natural Diversity Resource
    • WormAtlas
    • WormBase
    • National Bioresource Project for the Experimental Animal
      C. elegans
    • WormBuilder
    • WormBook
    • WormBook in Genetics