Laboratory Information

NameDET View on WormBase
Allele designationmwu
HeadEllen K Tarr
InstitutionRock Valley College, Rockford, IL
Address Rock Valley College
Division of Math and Sciences
Rockford 61108
United States
Gene classes

Strains contributed by this laboratory

Strain Genotype Species Description
DET13 abf-5 (ok3208) X C. elegans No observed phenotype; can confirm genotype using a three-primer reaction Ceabf5genL: CTGCCACTATTGTCACAAAATC Ceabf5WT: CGAATCCTGCACCAAACATC Ceabf5MUT: GTGACATGGGAAACATTTGAC WT band: ~300 bp MUT band: ~400 bp
DET17 abf-3 (ok3366) V C. elegans Possible decrease in brood size at 20C; can confirm genotype using a three-primer reaction Ceabf3genR: CACAGAGTACGCTTGCAAAA Ceabf3genL: AGTTTCCAGAAGTCATGCCC Ceabf3WT: CTTAATGGTAATAAAATGTTGAGGC WT band: ~200 bp MUT band: ~300 bp
DET18 abf-3 (ok3366) V; abf-5 (ok3208) X C. elegans No observed phenotype; can confirm genotypes using six-primer reaction abf-3 Ceabf3genR: CACAGAGTACGCTTGCAAAA Ceabf3genL: AGTTTCCAGAAGTCATGCCC Ceabf3WT: CTTAATGGTAATAAAATGTTGAGGC WT band: ~200 bp MUT band: ~300 bp abf-5 Ceabf5genL: CTGCCACTATTGTCACAAAATC Ceabf5WT: CGAATCCTGCACCAAACATC Ceabf5MUT: GTGACATGGGAAACATTTGAC WT band: ~300 bp MUT band: ~400 bp
DET21 unc63 (ok1075) I C. elegans Hyper-sensitive to isoflurane
DET27 acr-16 (ok789) V C. elegans Resistant to isoflurane
DET29 shk-1/ZK1231.2 (ok1581) II C. elegans No observed phenotype
DET33 delm-2/C24G7.2 (ok1822) I C. elegans No observed phenotype
DET42 cnc-2 (ok3226) V C. elegans No observed phenotype; can confirm genotype using a three-primer reaction Cecnc2innerright: CATATCAGTTGTGAGTATCAATGGAA Cecnc2WT: CCATATGGACGCATTCCG Cecnc2MUT: CATGGTAGAGGTCGGAAC WT band: ~400 bp MUT band: ~600 bp
DET43 abf-3 (ok3366) cnc-2 (ok3226) V; abf-5 (ok3208) X C. elegans No observed phenotype; can confirm genotypes using nine-primer reaction abf-3 Ceabf3genR: CACAGAGTACGCTTGCAAAA Ceabf3genL: AGTTTCCAGAAGTCATGCCC Ceabf3WT: CTTAATGGTAATAAAATGTTGAGGC WT band: ~200 bp MUT band: ~300 bp abf-5 Ceabf5genL: CTGCCACTATTGTCACAAAATC Ceabf5WT: CGAATCCTGCACCAAACATC Ceabf5MUT: GTGACATGGGAAACATTTGAC WT band: ~300 bp MUT band: ~400 bp cnc-2 Cecnc2innerright: CATATCAGTTGTGAGTATCAATGGAA Cecnc2WT: CCATATGGACGCATTCCG Cecnc2MUT: CATGGTAGAGGTCGGAAC WT band: ~400 bp MUT band: ~600 bp
This laboratory hasn't submitted any alleles to the CGC.