| CB4374 |
spg- (e2335) III; unc-31(e928) IV. |
C. elegans |
Spongy gut, intestine has foamy look, especially in L4; Temperature sensitive-almost normal at 15C; leaky Eat at 20C; Penetrant and sick Eat at 25C. Unc. |
| CB4391 |
unc-31(e928) unc-26(e2340) IV. |
C. elegans |
Unc. Eat. |
| CB4394 |
eat-1(e2343) unc-31(e928) IV. |
C. elegans |
Thin, starved, healthy adults. Retain few eggs. Slow irregular pumping at 16, 20, 25C. Unc. |
| CB4681 |
nDf17/qC1 [dpy-19(e1259) glp-1(q339)] III. |
C. elegans |
Heterozygotes are Dpy and segregate Dpy, Sterile Dpys and dead eggs. [CGC received new stock in 1/1999 from Leon Avery.] |
| DA1006 |
egl-19(ad1006) IV. |
C. elegans |
Egl. Lon. Sluggish Unc. Eat. |
| DA1013 |
egl-19(ad1013) IV. |
C. elegans |
Weak Egl. Weak Eat. |
| DA1015 |
egl-19(ad1015) IV. |
C. elegans |
Egl. Weak sluggish Unc. |
| DA1025 |
vab- (ad1026); egl-19(ad1025)/bli-6(sc16) unc-24(e138) IV. |
C. elegans |
Impenetrant Vab - mostly tail; not mapped. Strain throws early larval lethals (ad1025 homozygotes) and Bli Uncs. |
| DA1031 |
egl-19(n582) IV; unc-2(e55) X. |
C. elegans |
Unc. Egl, Lon, Slow and Floppy. |
| DA1034 |
egl-19(n2368) IV; unc-2(e55) X. |
C. elegans |
Unc. Semidominant Egl-c, Sma. |
| DA1035 |
egl-19(ad695) IV; unc-2(e55) X. |
C. elegans |
Unc. Semi-dominant Eat (TB relaxation defective). |
| DA1042 |
egl-19(ad1008) unc-24(e138) IV/nT1 [unc-?(n754) let-?] (IV;V) |
C. elegans |
Heterozygotes are Unc and segregate Uncs and dead eggs. ad1008 homozygotes are Pat. |
| DA1046 |
hDf10 dpy-5(e61) unc-29(e403) I; sDp2 (I;f). |
C. elegans |
Animals carrying sDp2 are Unc and segregate Unc and dead eggs. |
| DA1051 |
avr-15(ad1051) V. |
C. elegans |
Starved. Lacks M3 spikes. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be used for any commercial purpose or for work on human subjects. |
| DA1055 |
unc-29(e1072) eat-18(ad820) I. |
C. elegans |
Unc. Semi-dominant Eat. pka eat-18. |
| DA1060 |
+/eT1 III; adDf1059/eT1 V. |
C. elegans |
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. |
| DA1075 |
tln-1(e259) dpy-5(e61) I. |
C. elegans |
Dpy. Unc. |
| DA1077 |
egl-30(ad810) dpy-5(e61)/szT1 [lon-2(e678)] I; +/szT1 X. |
C. elegans |
ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2 (a.k.a. eat-11). In DA1077, heterozygotes are Egl. Strain throws Lon Males. |
| DA1084 |
egl-30(ad806) I. |
C. elegans |
Egl. Semi-dominant suppressor of eat-11. |
| DA1096 |
egl-30(ad810)/szT1 [lon-2(e678)] I; +/szT1 X. |
C. elegans |
ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2 (a.k.a. eat-11). In DA1096, heterozygotes are Egl. Throws Lon males. |
| DA1110 |
eat-18(ad1110) I. |
C. elegans |
Eat. Slow pumping. pka eat-18. |
| DA1113 |
eat-2(ad1113) II. |
C. elegans |
Eat. Slow pumping. |
| DA1116 |
eat-2(ad1116) II. |
C. elegans |
Eat. Slow pumping. Long lived. Embryonic lethality observed in a significant fraction of animals is likely explained by a mutation in an essential gene linked to eat-2 |
| DA1204 |
adEx1204. |
C. elegans |
adEx1204 [rol-6(d) + eat-4::lacZ]. Medium transmission. |
| DA1240 |
adIs1240 lin-15B&lin-15A(n765) X. |
C. elegans |
adIs1240 [eat-4::sGFP + lin-15(+)] X. |
| DA1241 |
eat-4(ky5) III; lin-15B&lin-15A(n765) X; adEx1241. |
C. elegans |
adEx1241 [eat-4(+) + lin-15(+)]. Animals with the array are WT. Animals which have lost the array are Muv and Eat. n765 is temperature-sensitive. |
| DA1242 |
eat-4(ky5) III; lin-15B&lin-15A(n765) X; adEx1242. |
C. elegans |
adEx1242 [eat-4(+) + lin-15(+)]. Animals with the array are WT. Animals which have lost the array are Muv and Eat. n765 is temperature sensitive. |
| DA1243 |
eat-4(ky5) III; adIs1240 lin-15B&lin-15A(n765) X. |
C. elegans |
adIs1240 [eat-4::sGFP + lin-15(+)] X. |
| DA1256 |
lin-15B&lin-15A(n765) X; adEx1256. |
C. elegans |
adEx1256 [egl-19::sGFP-NLS + lin-15(+)]. Animals with the array are WT. Animals which have lost the array are Muv. n765 is temperature-sensitive. |
| DA1262 |
lin-15B&lin-15A(n765) X; adEx1262. |
C. elegans |
adEx1262 [gcy-5::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive. |
| DA1266 |
lin-15B&lin-15A(n765) X; adEx1266. |
C. elegans |
adEx1266 [gcy-12::GFP + lin-15(+)]. Maintain by picking non-Muv. Very weak GFP signal. n765 is temperature-sensitive. |
| DA1267 |
lin-15B&lin-15A(n765) X; adEx1267. |
C. elegans |
adEx1267 [gcy-8::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive. |
| DA1269 |
lin-15B&lin-15A(n765) X; adEx1269. |
C. elegans |
adEx1269 [odr-1::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive. |
| DA1276 |
lin-15B&lin-15A(n765) X; adEx1276. |
C. elegans |
adEx1276 [gcy-?::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive. |
| DA1288 |
lin-15B&lin-15A(n765) X; adEx1288. |
C. elegans |
adEx1288 [gcy-7::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive. |
| DA1290 |
lin-15B&lin-15A(n765) X; adEx1290. |
C. elegans |
adEx1290 [gcy-33::GFP + lin-15(+)]. Maintain by picking non-Muv. gcy-33::GFP in BAG. n765 is temperature-sensitive. |
| DA1292 |
lin-15B&lin-15A(n765) X; adEx1292. |
C. elegans |
adEx1292 [R01E6.1_8k::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive. |
| DA1295 |
lin-15B&lin-15A(n765) X; adEx1295. |
C. elegans |
adEx1295 [gcy-32::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive. |
| DA1296 |
lin-15B&lin-15A(n765) X; adEx1296. |
C. elegans |
adEx1296 [gcy-32::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive. |
| DA1297 |
lin-15B&lin-15A(n765) X; adEx1297. |
C. elegans |
adEx1297 [gcy-6::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive. |
| DA1299 |
adEx1299. |
C. elegans |
adEx1299 [avr-15::GFP + rol-6(su1006)]. GFP expression in pharyngeal muscle and some extrapharyngeal neurons. Maintain by picking Rollers. |
| DA1350 |
adEx1350. |
C. elegans |
adEx1350 [kin-18::GFP + rol-6(su1006)]. Pick Rollers. Only about 10% transmission. |
| DA1370 |
avr-15(vu227) glc-1(pk54) V. |
C. elegans |
Lacks M3 spikes. glc-1(pk54::Tc1). This strain cannot be sent to commercial recipients without approval from UT Southwestern. Do not distribute this strain; other labs should request it from the CGC. Received new stock 5/21/08. [NOTE: The correct genotype of this strain is avr-15(vu227) glc-1(pk54) V. This strain was incorrectly annotated as avr-15(ad1051) glc-1(pk54) V. when submitted to the CGC.] |
| DA1384 |
avr-14(ad1302) I; glc-1(pk54) V. |
C. elegans |
glc-1(pk54::Tc1). High level of ivermectin resistance. This strain cannot be sent to commercial recipients without approval from UT Southwestern. Do not distribute this strain; other labs should request it from the CGC. |
| DA1402 |
eat-5(ad1402) I. |
C. elegans |
Small intragenic deletion. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. |
| DA1426 |
exp-2(sa26ad1426) V. |
C. elegans |
Reversion of sa26. Severely reduced R spikes, long pumps, short hold-backs. |
| DA1674 |
acr-19(ad1674) I. |
C. elegans |
Deletion of bp 1108-3194 of C31H5.3 |
| DA1750 |
adEx1750. |
C. elegans |
adEx1750 [pmk-3::GFP + rol-6(su1006)]. Pick Rollers to maintain. Nuclear GFP in anterior and posterior intestine. [NOTE: adEx1750 contains a F42G8.4::GFP reporter construct. This array had been previously described as carrying a pmk-1::GFP reporter; the description of the array was updated in CGC records ~2016. islo-1, pmk-3, pmk-2, and pmk-1 are in an operon. The order of genes was described in Berman et al. as [pmk-1(F42G8.4)->pmk-2(F42G8.3)->pmk-3(B0218.3)], but the official WormBase gene names were assigned in reverse order [pmk-1(B0218.3)->pmk-2(F42G8.3)->pmk-3(F42G8.4)]. See Berman K, et al. Mol Cell Biol Res Commun. 2001 Nov;4(6):337-44. PMID: 11703092 for additional information.] |
| DA1774 |
ser-3(ad1774) I. |
C. elegans |
Deletion of bp 433-1994 of K02F2.6. |
| DA1814 |
ser-1(ok345) X. |
C. elegans |
F59C12.2. Homozygous. Outer Left Sequence: AAGCATCTTTGAGCGCATTT. Outer Right Sequence: CATAGCGAGTGTTTGGAGCA. Inner Left Sequence: AATTTCAGGGGTGTGGACAT. Inner Right Sequence: AATCATTTTTGAAACCGACCC. Inner Primer PCR Length: 2926 bp. Deletion Size: 859 bp. Deletion left flank: TGTTTTGTAAGCTTTGTAAAATTATGTAGT. Deletion right flank: CCACTAGAAATAATTTCCCCCTTCTTTTTC. URL: http://www.celeganskoconsortium.omrf.org. |
| DA1877 |
Comamonas sp. |
Comamonas sp. |
Bacteria. Comamonas sp., a bacterium on which C. elegans grows particularly well. Str-R. DA1877 is derived from a bacterium isolated from soil in the Dallas area by Boris Shtonda in 2002. That strain was called H39 in Avery, L, Shtonda, BB (2003), "Food transport in the C elegans pharynx", J Exp Biol 206: 2441-2457. It was identified as genus Comamonas by 16S rDNA sequencing, as described in the paper. L. Avery isolated a spontaneous streptomycin-resistant variant by selecting for growth in LB broth + 200 ug/ml streptomycin sulfate. This strain, when spread on NGMSR plates, gave rise to faster-growing papillae; one of these was streaked out to get DA1877. Biosafety Level: BSL-1. |
| DA1880 |
Bacillus megaterium. |
Bacillus megaterium |
Bacteria. Str-R. L10 papilla 2; sporulation-defective mutant. This is a low-quality food that is difficult for the worms to eat, and is useful for studies of the effect of food on behavior, physiology, etc. [NOTE: This strain grows better on NGM than on LB media in CGC.] Described in J Exp Biol 206: 2441-2457. Biosafety Level: BSL-1. |
| DA1885 |
B. simplex |
Bacillus simplex |
Bacteria. Str-R. Streak and maintain on Str+ plates. NGMSR+. Faster growing papilla on NGMSR. [NOTE: This strain grows better on NGM than on LB media in CGC.] Biosafety Level: BSL-1. |
| DA1917 |
E. coli. |
Escherichia coli |
Bacteria. Contains eat-5 rescuing plasmid pRE5-7. Amp-R. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. Biosafety Level: BSL-1. |
| DA2100 |
ser-7(tm1325) X. |
C. elegans |
Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion. |
| DA2109 |
ser-7(tm1325) ser-1(ok345) X. |
C. elegans |
F59C12.2. Homozygous. Outer Left Sequence: AAGCATCTTTGAGCGCATTT. Outer Right Sequence: CATAGCGAGTGTTTGGAGCA. Inner Left Sequence: AATTTCAGGGGTGTGGACAT. Inner Right Sequence: AATCATTTTTGAAACCGACCC. Inner Primer PCR Length: 2926 bp. Deletion Size: 859 bp. Deletion left flank: TGTTTTGTAAGCTTTGTAAAATTATGTAGT. Deletion right flank: CCACTAGAAATAATTTCCCCCTTCTTTTTC. URL: http://www.celeganskoconsortium.omrf.org. |
| DA2123 |
adIs2122. |
C. elegans |
adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. |
| DA2124 |
E. coli. |
Escherichia coli |
Bacteria. E. coli strain carrying an avr-15::GFP fusion plasmid. Amp-R. Sac I Pst I fragment from K10B8 fused to transmembrane GFP from TM-1. Biosafety Level: BSL-1. |
| DA2143 |
egl-4(ks62) IV; adEx2143. |
C. elegans |
adEx2143 [tax-4p::pkg-1 + rol-6p::GFP]. Maintain by picking GFP+. pkg-1 is the new name of egl-4. Reference: You et al (2008) Cell Metab 7(3):249-57. |
| DA2149 |
egl-4(ks62) IV; adEx2149. |
C. elegans |
adEx2149 [odr-3p::pkg-1 + rol-6p::GFP]. Maintain by picking GFP+. Reference: You et al (2008) Cell Metab 7(3):249-57. |
| DA2154 |
phb-2(ad2154) II. |
C. elegans |
Hemiasterlin resistant. |
| DA2155 |
har-1(ad2155) III. |
C. elegans |
Hemiasterlin resistant. Maintain under normal conditions. Reference: Zubovych IO, et al. Mol Biol Cell. 2010 Mar 15;21(6):956-69. |
| DA2202 |
daf-7(e1372) III; adEx2202. |
C. elegans |
adEx2202 [gpa-4p::daf-7 + rol-6p::GFP]. Rescues Daf-c. Maintain by picking GFP+. Reference: You et al (2008) Cell Metab 7(3):249-57. |
| DA2211 |
E. coli. |
Escherichia coli |
Bacteria. E18 eat-4 promoter/GFP translational fusion, fused Klenowed ScaI/PstI fragments of pRE4-4-YK-Sac_Pst (~4.4kb) with TU#62(~2.2kb), checked loss of PstI site. PKA pRE4-GFP. Biosafety Level: BSL-1. |
| DA2249 |
spg-7(ad2249) I. |
C. elegans |
Hemiasterlin resistant. Maintain under normal conditions. Reference: Zubovych IO, et al. Mol Biol Cell. 2010 Mar 15;21(6):956-69. |
| DA2250 |
mgl-2(tm355) I; mgl-1(tm1811) X. |
C. elegans |
Superficially wild-type; multiple subtle phenotypes related to nutritional response. References: Kang C, You YJ, Avery L. Genes Dev. 2007 Sep 1;21(17):2161-71. Kang C, Avery L. Genes Dev. 2009 Jan 1;23(1):12-7. |
| DA2356 |
ced-1(e1735) I; ced-3(n717) IV; lin-15B&lin-15A(n765) X; adEx2342. |
C. elegans |
adEx2342 [efl-3::mCherry::FLAG + LIN-15(+)]. Maintain by picking non-Muv. Fluorescence is dim, but array is stable (>95% transmission). |
| DA438 |
bli-4(e937) I; rol-6(e187) II; daf-2(e1368) vab-7(e1562) III; unc-31(e928) IV; dpy-11(e224) V; lon-2(e678) X. |
C. elegans |
Linkage mapping strain. Maintain at 15C. |
| DA443 |
rol-3(e754) unc-42(e270) V. |
C. elegans |
Roller Unc. e754 is cold-sensitive: lethal at 15C. |
| DA449 |
eat-1(e2343) dpy-20(e1282) IV. |
C. elegans |
Thin, starved, healthy adults. Retain few eggs. Slow irregular pumping at 16, 20, 25C. Dpy. |
| DA453 |
eat-2(ad453) II. |
C. elegans |
Eat. Scrawny. Slow pumping. |
| DA464 |
eat-5(ad464) I. |
C. elegans |
Abnormal feeding. Corpus and terminal bulb contractions unsynchronized. |
| DA465 |
eat-2(ad465) II. |
C. elegans |
Abnormal feeding. Slow, regular pumping. See also WBPaper00002341. |
| DA467 |
eat-6(ad467) V. |
C. elegans |
Abnormal feeding. Strong relaxation defective. NOTE: This strain is reportedly homozygous for an unknown X-linked unc mutation (10/31/2017). |
| DA468 |
unc-31(e928) IV; act-2(ad468) act-3(ad767) V. |
C. elegans |
Patchy birefringence in pharyngeal muscles-semidominant. |
| DA469 |
dpy-20(e1282) unc-31(e928) IV. |
C. elegans |
Dpy (ts). Unc. |
| DA472 |
pha-2(ad472) X. |
C. elegans |
Misshapen pharynx; worms hatch with pharynx of correct gross shape, but disorganized, with nuclei misplaced. Most homozygotes arrest in L1, escapers grow up to become very starved adults with deformed pharynges with abnormally small terminal bulb, thick nucleated isthmus. Weakly cold sensitive. Makes dauers that don't recover; doesn't survive freezing well. |
| DA491 |
dpy-20(e1282) unc-30(e191) IV. |
C. elegans |
Unc. Temperature sensitive Dpy. |
| DA493 |
phm-3(ad493) III. |
C. elegans |
Weak pharyngeal birefringence. |
| DA496 |
sDf10 unc-31(e169)/nT1 IV; +/nT1 V. |
C. elegans |
Heterozygotes are WT and segregate WT, Vul, Unc lethals (early larval) and dead eggs. Maintain by picking WT. |
| DA497 |
let-59(s49) unc-22(s7)/nT1 IV; +/nT1 V. |
C. elegans |
Heterozygotes are WT and segregate WT, Vul and lethal twitchers. Lethal early larval. Pick twitchers in 1% nicotine. |
| DA501 |
unc-101(m1) unc-59(e261) I. |
C. elegans |
|
| DA502 |
unc-75(e950) unc-101(m1) I. |
C. elegans |
Unc. Eat. |
| DA508 |
npr-1(n1353) X. |
C. elegans |
Clumps. npr-1 pka bor-1. |
| DA509 |
unc-31(e928) IV. |
C. elegans |
Extensively backcrossed to N2. Background strain for most of the feeding-defective mutant screens. |
| DA521 |
egl-4(ad450) IV. |
C. elegans |
Abnormal feeding. Falls asleep. Does not feed while asleep. Semidominant. Previously called eat-7. |
| DA522 |
eat-13(ad522) X. |
C. elegans |
Eat mutant. Slippery pharynx. Slight relaxation defect. |
| DA531 |
eat-1(ad427) IV. |
C. elegans |
Abnormal feeding. Slow pumping. |
| DA538 |
adDf538 I. |
C. elegans |
Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. PKA phm-2(ad538). |
| DA541 |
gpb-2(ad541) I. |
C. elegans |
Abnormal feeding. Slippery Corpus. Long. Slight coiler Unc. gpb-2(ad541) previously called eat-11(ad541). |
| DA563 |
eat-9(e2337) I; him-8(e1489) IV. |
C. elegans |
Abnormal feeding. Irregular pumping. Throws males. |
| DA572 |
eat-4(ad572) III. |
C. elegans |
Starved appearance. Reverts spontaneously-Do not passage! Clone starved-looking progeny with abnormal fast pharyngeal pumping to maintain. |
| DA573 |
eat-14(ad573) X. |
C. elegans |
|
| DA589 |
unc-32(e189) emb-9(hc70) III. |
C. elegans |
Unc. Temperature sensitive. Maintain at 15C. hc70 is semi-dominant. |
| DA591 |
unc-10(ad591) X. |
C. elegans |
Mild Unc-tends to form abnormally deep bends, especially when backing. Mild Eat. |
| DA596 |
snt-1(ad596) II. |
C. elegans |
Eat mutant. Strong Unc Eat. Jerky backward Unc. Hypomorph. |
| DA597 |
phm-2(ad597) I. |
C. elegans |
|
| DA599 |
eat-8(ad599) III. |
C. elegans |
Abnormal feeding. Brief, rare pumps. Slight coiler Unc. |
| DA601 |
eat-6(ad601) V. |
C. elegans |
Eat. Long pumps; slippery isthmus and corpus. |
| DA602 |
eat-15(ad602) I. |
C. elegans |
Eat mutant. Slippery isthmus, corpus and grinder. |
| DA606 |
eat-10(ad606) IV. |
C. elegans |
Abnormal feeding. Slippery isthmus and corpus. |
| DA607 |
pha-3(ad607) IV. |
C. elegans |
Deformed pharynx. |
| DA609 |
npr-1(ad609) X. |
C. elegans |
Causes worms to aggregate (Bor). Social. |
| DA612 |
bli-4(e937) adDf538 I. |
C. elegans |
Blistered. Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. adDf538 previously called phm-2(ad538). |
| DA620 |
eat-2(ad465) lin-7(e1413) unc-52(e444) II. |
C. elegans |
Abnormal feeding: slow, regular pumping. Vulvaless (incomplete penetrance). Unc. |
| DA631 |
eat-3(ad426) II; him-8(e1489) IV. |
C. elegans |
Abnormal feeding. Slow, irregular feeding. eat-3 exhibits strong maternal effect; dauers seldom recover; Him. |
| DA650 |
C. elegans wild isolate. |
C. elegans |
Clumps. Found in strain RC301. See 1987 Worm Meeting Abstract Book page 162. npr-1 pka bor-1. |
| DA658 |
lon-2(e678) npr-1(n1353) X. |
C. elegans |
Long. Clumps. npr-1 pka bor-1. |
| DA664 |
egl-4(ad450) lin-1(e1777) IV. |
C. elegans |
Muv. ad450 worms, when undisturbed, fall asleep. While asleep they do not move or pump. Disturbing them wakes them up, and while awake they act fairly normal. ad450 previously called eat-7. |
| DA675 |
unc-45(r450) dpy-1(e1) phm-3(ad493) III. |
C. elegans |
Dpy. Unc (ts). Phm. Weak pharyngeal birefringence. |
| DA678 |
unc-57(ad592) dpy-5(e61) I. |
C. elegans |
DpyUnc. ad592 is Eat. Dpy is semi-dominant. |
| DA686 |
nDf16/qC1 [dpy-19(e1259) glp-1(q339)] III. |
C. elegans |
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. dpy-19(e1259) is temperature sensitive. Maintain by picking WT. [Checked 11/94 with sma-3 and nDf16 is present.] |
| DA695 |
egl-19(ad695) IV. |
C. elegans |
Abnormal feeding. Relaxation defective. Smallish. Males don't mate. Semidominant. Previously called eat-12. See also WBPaper00002912. |
| DA698 |
unc-36(ad698) III. |
C. elegans |
Unc. Eat - slippery pharynx, slow pumping. |
| DA702 |
eat-16(ad702) I. |
C. elegans |
Note: ad702 was isolated in an RC301 background. DA702 was not tested for the presence of npr-1(g320) following three rounds of outcrossing to N2 Bristol. DA702 does not display clumping behavior, so it's likely that DA702 has the Bristol npr-1. New stock rec'd 10/13/99. |
| DA707 |
eat-17(ad707) X. |
C. elegans |
Eat mutant. Stuffs corpus and isthmus. Abnormality in m6 and m7 contraction timing. Displays clumping behavior; isolated in an RC301 background, so it's likely to have the RC301 bor-1 mutation. |
| DA709 |
+/nT1 IV; sqt-3(sc63) eat-6(ad467) unc-76(e911)/nT1 V. |
C. elegans |
Heterozygotes are WT and segregate WT, Vul and Sqt Unc larvae that grow very slowly. |
| DA711 |
unc-10(e102) dpy-6(e14) X. |
C. elegans |
DpyUnc. |
| DA726 |
unc-10(e102) eat-13(ad522) X. |
C. elegans |
Unc. Eat mutant. Slippery pharynx-Slight relaxation defect. |
| DA729 |
unc-101(m1) eat-9(e2337) I. |
C. elegans |
Unc. Abnormal feeding. Irregular pumping. |
| DA734 |
adDf538 unc-101(m1) I. |
C. elegans |
Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. Unc. adDf538 previously called phm-2(ad538). |
| DA735 |
E. coli. |
Escherichia coli |
Bacteria. 15kb lin-15 Xba fragment in Bluescript. Rescues @ 25 ng/ml and 50 ng/ml, better at 25. Biosafety Level: BSL-1. |
| DA740 |
bli-6(sc16) unc-24(e138) IV. |
C. elegans |
Blistered Unc. |
| DA742 |
lon-2(e678) unc-6(e78) egl-15(n484) X. |
C. elegans |
Long. Uncoordinated. Egl. |
| DA768 |
bli-6(sc16) egl-19(ad695) unc-24(e138)/nDf41 IV. |
C. elegans |
Heterozygotes are Blistered and Eat (terminal bulb relaxation defective). Heterozygotes segregate BliEat, BliEatUnc and dead eggs. ad695 previously called eat-12. |
| DA778 |
dpy-10(e128) snt-1(ad596) II. |
C. elegans |
|
| DA792 |
eat-6(ad792) V. |
C. elegans |
Eat. Relaxation defective. Lib. Cold sensitive. |
| DA810 |
egl-30(ad810) gpb-2(ad541)/gpb-2(ad541) I. |
C. elegans |
ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2. gpb-2 phenotype is rather subtle: they are slightly starved, slightly longer than normal, and tend to be loopy in their movements (they make abnormally deep bends). Hets should be Egl and non-Eat. On most E. coli strains gpb-2 grows rather poorly, especially if the plates are older so that there is a thick and tough lawn. On such plates there will be a lot of gpb-2 larval arrest, and those that don't arrest will grow slowly. The hets should easily outgrow the gpb-2 homozygotes. [gpb-2 is also hypersensitive to the drug arecoline: they won't grow on 5 mM. The hets will grow even better than WT on 5 mM arecoline.] gpb-2(ad541) previously called eat-11(ad541). |
| DA819 |
eat-4(ad819) III. |
C. elegans |
Abnormal feeding. |
| DA820 |
eat-18(ad820) I. |
C. elegans |
Semidominant Eat. pka eat-18. |
| DA823 |
egl-30(ad805) I. |
C. elegans |
Suppressor of gpb-2 (a.k.a. eat-11) arecoline hypersensitivity. Unc. Egl. |
| DA837 |
E. coli. |
Escherichia coli |
Bacteria. E. coli. Str-R. Uracil auxotroph. DA837 is derived from OP50. DA837 is harder for worms to eat than most E. coli strains. Some mild Eat mutant worms are easier to distinguish from WT when grown on DA837 than when grown on other E. coli strains. Biosafety Level: BSL-1. |
| DA869 |
sqt-3(sc8) lin-25(n545) him-5(e1467) unc-76(e911) V. |
C. elegans |
Roller. Unc. Vulvaless. Throws males. sc8 previously called rol-4(sc8). |
| DA929 |
egl-19(n582) unc-24(e138) IV. |
C. elegans |
Unc: amber suppressible. Egl: Lon, slow and floppy. |
| DA939 |
unc-36(e251) III; egl-19(n2368) IV. |
C. elegans |
Unc. Semidominant Egl-c, Sma. |
| DA944 |
unc-36(e251) III; egl-19(ad695) IV. |
C. elegans |
Unc. Semidominant Eat (TB relaxation defective). |
| DA945 |
unc-36(e251) III; egl-19(n582) IV. |
C. elegans |
Unc. Semidominant Egl, Lon, Slow and Floppy |
| DA949 |
bli-6(sc16) egl-19(n582) unc-24(e138) IV. |
C. elegans |
Blistered cuticle. Egl-Lon, slow and floppy. Unc. |
| DA952 |
egl-19(n582ad952) IV. |
C. elegans |
n582 is Egl, Lon, slow & floppy. Suppressed by ad952, which is semidominant. Strain is slightly Dpy and the pharyngeal bulb occasionally shows delayed relaxation and repolarization. |
| DA995 |
egl-19(ad995) IV. |
C. elegans |
Lon. Sluggish Unc. Egl. Eat. Rubberband. |
| DA997 |
eat-6(ad997) V. |
C. elegans |
Eat. |
| DL160 |
lin-59(n3192) unc-29(e1072) I. |
C. elegans |
|
| DL220 |
dpy-20(e1282) mig-32(tm1684) IV. |
C. elegans |
|
| DL308 |
ced-3(n717) IV; mxIs28 X. |
C. elegans |
mxIs28 [ceh-20p::ceh-20::YFP + lin-15(+)] X. Reference: Potts MB, Wang DP, & Cameron S. Dev Biol. 2009 May 15;329(2):374-85. |
| DL315 |
lin-15B&lin-15A(n765) X; mxIs30. |
C. elegans |
mxIs30 [unc-62p::unc-62::CFP + lin-15(+)]. Reference: Potts MB, Wang DP, Cameron S. Dev Biol. 2009 May 15;329(2):374-85. |
| DL7 |
wdIs4 II; unc-3(n3435) X. |
C. elegans |
wdIs4 [unc-4p::GFP + dpy-20(+)] II. |
| DL74 |
mig-32(n4275) IV. |
C. elegans |
|
| HB101 |
E. coli [supE44 hsdS20(rB-mB-) recA13 ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1]. |
Escherichia coli |
Bacteria. This strain of E. coli is easier for worms to eat than other E. coli strains. [supE44 hsdS20(rB-mB-) recA13 ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1]. Contains a mutation (rpsL20) in a ribosomal subunit gene that confers streptomycin resistance. Biosafety Level: BSL-1. |
| JD217 |
gar-3(vu78) V. |
C. elegans |
|
| JK987 |
tra-2(q276)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, DpyUnc and males. The males will mate. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| MT10362 |
unc-3(n3366) X. |
C. elegans |
|
| MT10480 |
unc-3(n3413) X. |
C. elegans |
|
| MT6129 |
egl-19(n2368) IV. |
C. elegans |
Small. Slightly jerky movement. Terminal bulb relaxation defective. Egl-c. Cold-sensitive Pat. |
| MT6308 |
eat-4(ky5) III. |
C. elegans |
Foraging defective. Abnormal chemotaxis. |