Laboratory Information

NameDA View on WormBase
Allele designationad
HeadAvery, Leon
InstitutionVirginia Commonwealth University, Richmond, VA
Address Department of Physiology and Biophysics Virginia Commonwealth University P.O. Box 980551 1220 E. Broad Molecular Medicine Research Building, Rm 2044 Richmond, VA 23298-0551

Website http://elegans.som.vcu.edu/
Gene classes cch  eat  fic  gar  glc  har  phm  rib  ser  slm 

Strains contributed by this laboratory

Strain Genotype Species Description
CB4374 spg- (e2335) III; unc-31(e928) IV. C. elegans Spongy gut, intestine has foamy look, especially in L4; Temperature sensitive-almost normal at 15C; leaky Eat at 20C; Penetrant and sick Eat at 25C. Unc.
CB4391 unc-31(e928) unc-26(e2340) IV. C. elegans Unc. Eat.
CB4394 eat-1(e2343) unc-31(e928) IV. C. elegans Thin, starved, healthy adults. Retain few eggs. Slow irregular pumping at 16, 20, 25C. Unc.
CB4681 nDf17/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are Dpy and segregate Dpy, Sterile Dpys and dead eggs. [CGC received new stock in 1/1999 from Leon Avery.]
DA1006 egl-19(ad1006) IV. C. elegans Egl. Lon. Sluggish Unc. Eat.
DA1013 egl-19(ad1013) IV. C. elegans Weak Egl. Weak Eat.
DA1015 egl-19(ad1015) IV. C. elegans Egl. Weak sluggish Unc.
DA1025 vab- (ad1026); egl-19(ad1025)/bli-6(sc16) unc-24(e138) IV. C. elegans Impenetrant Vab - mostly tail; not mapped. Strain throws early larval lethals (ad1025 homozygotes) and Bli Uncs.
DA1031 egl-19(n582) IV; unc-2(e55) X. C. elegans Unc. Egl, Lon, Slow and Floppy.
DA1034 egl-19(n2368) IV; unc-2(e55) X. C. elegans Unc. Semidominant Egl-c, Sma.
DA1035 egl-19(ad695) IV; unc-2(e55) X. C. elegans Unc. Semi-dominant Eat (TB relaxation defective).
DA1042 egl-19(ad1008) unc-24(e138) IV/nT1 [unc-?(n754) let-?] (IV;V) C. elegans Heterozygotes are Unc and segregate Uncs and dead eggs. ad1008 homozygotes are Pat.
DA1046 hDf10 dpy-5(e61) unc-29(e403) I; sDp2 (I;f). C. elegans Animals carrying sDp2 are Unc and segregate Unc and dead eggs.
DA1051 avr-15(ad1051) V. C. elegans Starved. Lacks M3 spikes. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be used for any commercial purpose or for work on human subjects.
DA1055 unc-29(e1072) eat-18(ad820) I. C. elegans Unc. Semi-dominant Eat. pka eat-18.
DA1060 +/eT1 III; adDf1059/eT1 V. C. elegans Heterozygotes are WT and segregate WT, Unc-36 and dead eggs.
DA1075 tln-1(e259) dpy-5(e61) I. C. elegans Dpy. Unc.
DA1077 egl-30(ad810) dpy-5(e61)/szT1 [lon-2(e678)] I; +/szT1 X. C. elegans ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2 (a.k.a. eat-11). In DA1077, heterozygotes are Egl. Strain throws Lon Males.
DA1084 egl-30(ad806) I. C. elegans Egl. Semi-dominant suppressor of eat-11.
DA1096 egl-30(ad810)/szT1 [lon-2(e678)] I; +/szT1 X. C. elegans ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2 (a.k.a. eat-11). In DA1096, heterozygotes are Egl. Throws Lon males.
DA1110 eat-18(ad1110) I. C. elegans Eat. Slow pumping. pka eat-18.
DA1113 eat-2(ad1113) II. C. elegans Eat. Slow pumping.
DA1116 eat-2(ad1116) II. C. elegans Eat. Slow pumping. Long lived. Embryonic lethality observed in a significant fraction of animals is likely explained by a mutation in an essential gene linked to eat-2
DA1204 adEx1204. C. elegans adEx1204 [rol-6(d) + eat-4::lacZ]. Medium transmission.
DA1240 adIs1240 lin-15B&lin-15A(n765) X. C. elegans adIs1240 [eat-4::sGFP + lin-15(+)] X.
DA1241 eat-4(ky5) III; lin-15B&lin-15A(n765) X; adEx1241. C. elegans adEx1241 [eat-4(+) + lin-15(+)]. Animals with the array are WT. Animals which have lost the array are Muv and Eat. n765 is temperature-sensitive.
DA1242 eat-4(ky5) III; lin-15B&lin-15A(n765) X; adEx1242. C. elegans adEx1242 [eat-4(+) + lin-15(+)]. Animals with the array are WT. Animals which have lost the array are Muv and Eat. n765 is temperature sensitive.
DA1243 eat-4(ky5) III; adIs1240 lin-15B&lin-15A(n765) X. C. elegans adIs1240 [eat-4::sGFP + lin-15(+)] X.
DA1256 lin-15B&lin-15A(n765) X; adEx1256. C. elegans adEx1256 [egl-19::sGFP-NLS + lin-15(+)]. Animals with the array are WT. Animals which have lost the array are Muv. n765 is temperature-sensitive.
DA1262 lin-15B&lin-15A(n765) X; adEx1262. C. elegans adEx1262 [gcy-5::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
DA1266 lin-15B&lin-15A(n765) X; adEx1266. C. elegans adEx1266 [gcy-12::GFP + lin-15(+)]. Maintain by picking non-Muv. Very weak GFP signal. n765 is temperature-sensitive.
DA1267 lin-15B&lin-15A(n765) X; adEx1267. C. elegans adEx1267 [gcy-8::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
DA1269 lin-15B&lin-15A(n765) X; adEx1269. C. elegans adEx1269 [odr-1::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
DA1276 lin-15B&lin-15A(n765) X; adEx1276. C. elegans adEx1276 [gcy-?::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
DA1288 lin-15B&lin-15A(n765) X; adEx1288. C. elegans adEx1288 [gcy-7::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
DA1290 lin-15B&lin-15A(n765) X; adEx1290. C. elegans adEx1290 [gcy-33::GFP + lin-15(+)]. Maintain by picking non-Muv. gcy-33::GFP in BAG. n765 is temperature-sensitive.
DA1292 lin-15B&lin-15A(n765) X; adEx1292. C. elegans adEx1292 [R01E6.1_8k::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
DA1295 lin-15B&lin-15A(n765) X; adEx1295. C. elegans adEx1295 [gcy-32::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
DA1296 lin-15B&lin-15A(n765) X; adEx1296. C. elegans adEx1296 [gcy-32::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
DA1297 lin-15B&lin-15A(n765) X; adEx1297. C. elegans adEx1297 [gcy-6::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
DA1299 adEx1299. C. elegans adEx1299 [avr-15::GFP + rol-6(su1006)]. GFP expression in pharyngeal muscle and some extrapharyngeal neurons. Maintain by picking Rollers.
DA1350 adEx1350. C. elegans adEx1350 [kin-18::GFP + rol-6(su1006)]. Pick Rollers. Only about 10% transmission.
DA1370 avr-15(vu227) glc-1(pk54) V. C. elegans Lacks M3 spikes. glc-1(pk54::Tc1). This strain cannot be sent to commercial recipients without approval from UT Southwestern. Do not distribute this strain; other labs should request it from the CGC. Received new stock 5/21/08. [NOTE: The correct genotype of this strain is avr-15(vu227) glc-1(pk54) V. This strain was incorrectly annotated as avr-15(ad1051) glc-1(pk54) V. when submitted to the CGC.]
DA1384 avr-14(ad1302) I; glc-1(pk54) V. C. elegans glc-1(pk54::Tc1). High level of ivermectin resistance. This strain cannot be sent to commercial recipients without approval from UT Southwestern. Do not distribute this strain; other labs should request it from the CGC.
DA1402 eat-5(ad1402) I. C. elegans Small intragenic deletion. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations.
DA1426 exp-2(sa26ad1426) V. C. elegans Reversion of sa26. Severely reduced R spikes, long pumps, short hold-backs.
DA1674 acr-19(ad1674) I. C. elegans Deletion of bp 1108-3194 of C31H5.3
DA1750 adEx1750. C. elegans adEx1750 [pmk-3::GFP + rol-6(su1006)]. Pick Rollers to maintain. Nuclear GFP in anterior and posterior intestine. [NOTE: adEx1750 contains a F42G8.4::GFP reporter construct. This array had been previously described as carrying a pmk-1::GFP reporter; the description of the array was updated in CGC records ~2016. islo-1, pmk-3, pmk-2, and pmk-1 are in an operon. The order of genes was described in Berman et al. as [pmk-1(F42G8.4)->pmk-2(F42G8.3)->pmk-3(B0218.3)], but the official WormBase gene names were assigned in reverse order [pmk-1(B0218.3)->pmk-2(F42G8.3)->pmk-3(F42G8.4)]. See Berman K, et al. Mol Cell Biol Res Commun. 2001 Nov;4(6):337-44. PMID: 11703092 for additional information.]
DA1774 ser-3(ad1774) I. C. elegans Deletion of bp 433-1994 of K02F2.6.
DA1814 ser-1(ok345) X. C. elegans F59C12.2. Homozygous. Outer Left Sequence: AAGCATCTTTGAGCGCATTT. Outer Right Sequence: CATAGCGAGTGTTTGGAGCA. Inner Left Sequence: AATTTCAGGGGTGTGGACAT. Inner Right Sequence: AATCATTTTTGAAACCGACCC. Inner Primer PCR Length: 2926 bp. Deletion Size: 859 bp. Deletion left flank: TGTTTTGTAAGCTTTGTAAAATTATGTAGT. Deletion right flank: CCACTAGAAATAATTTCCCCCTTCTTTTTC. URL: http://www.celeganskoconsortium.omrf.org.
DA1877 Comamonas sp. Comamonas sp. Bacteria. Comamonas sp., a bacterium on which C. elegans grows particularly well. Str-R. DA1877 is derived from a bacterium isolated from soil in the Dallas area by Boris Shtonda in 2002. That strain was called H39 in Avery, L, Shtonda, BB (2003), "Food transport in the C elegans pharynx", J Exp Biol 206: 2441-2457. It was identified as genus Comamonas by 16S rDNA sequencing, as described in the paper. L. Avery isolated a spontaneous streptomycin-resistant variant by selecting for growth in LB broth + 200 ug/ml streptomycin sulfate. This strain, when spread on NGMSR plates, gave rise to faster-growing papillae; one of these was streaked out to get DA1877. Biosafety Level: BSL-1.
DA1880 Bacillus megaterium. Bacillus megaterium Bacteria. Str-R. L10 papilla 2; sporulation-defective mutant. This is a low-quality food that is difficult for the worms to eat, and is useful for studies of the effect of food on behavior, physiology, etc. [NOTE: This strain grows better on NGM than on LB media in CGC.] Described in J Exp Biol 206: 2441-2457. Biosafety Level: BSL-1.
DA1885 B. simplex Bacillus simplex Bacteria. Str-R. Streak and maintain on Str+ plates. NGMSR+. Faster growing papilla on NGMSR. [NOTE: This strain grows better on NGM than on LB media in CGC.] Biosafety Level: BSL-1.
DA1917 E. coli. Escherichia coli Bacteria. Contains eat-5 rescuing plasmid pRE5-7. Amp-R. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. Biosafety Level: BSL-1.
DA2100 ser-7(tm1325) X. C. elegans Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.
DA2109 ser-7(tm1325) ser-1(ok345) X. C. elegans F59C12.2. Homozygous. Outer Left Sequence: AAGCATCTTTGAGCGCATTT. Outer Right Sequence: CATAGCGAGTGTTTGGAGCA. Inner Left Sequence: AATTTCAGGGGTGTGGACAT. Inner Right Sequence: AATCATTTTTGAAACCGACCC. Inner Primer PCR Length: 2926 bp. Deletion Size: 859 bp. Deletion left flank: TGTTTTGTAAGCTTTGTAAAATTATGTAGT. Deletion right flank: CCACTAGAAATAATTTCCCCCTTCTTTTTC. URL: http://www.celeganskoconsortium.omrf.org.
DA2123 adIs2122. C. elegans adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers.
DA2124 E. coli. Escherichia coli Bacteria. E. coli strain carrying an avr-15::GFP fusion plasmid. Amp-R. Sac I Pst I fragment from K10B8 fused to transmembrane GFP from TM-1. Biosafety Level: BSL-1.
DA2143 egl-4(ks62) IV; adEx2143. C. elegans adEx2143 [tax-4p::pkg-1 + rol-6p::GFP]. Maintain by picking GFP+. pkg-1 is the new name of egl-4. Reference: You et al (2008) Cell Metab 7(3):249-57.
DA2149 egl-4(ks62) IV; adEx2149. C. elegans adEx2149 [odr-3p::pkg-1 + rol-6p::GFP]. Maintain by picking GFP+. Reference: You et al (2008) Cell Metab 7(3):249-57.
DA2154 phb-2(ad2154) II. C. elegans Hemiasterlin resistant.
DA2155 har-1(ad2155) III. C. elegans Hemiasterlin resistant. Maintain under normal conditions. Reference: Zubovych IO, et al. Mol Biol Cell. 2010 Mar 15;21(6):956-69.
DA2202 daf-7(e1372) III; adEx2202. C. elegans adEx2202 [gpa-4p::daf-7 + rol-6p::GFP]. Rescues Daf-c. Maintain by picking GFP+. Reference: You et al (2008) Cell Metab 7(3):249-57.
DA2211 E. coli. Escherichia coli Bacteria. E18 eat-4 promoter/GFP translational fusion, fused Klenowed ScaI/PstI fragments of pRE4-4-YK-Sac_Pst (~4.4kb) with TU#62(~2.2kb), checked loss of PstI site. PKA pRE4-GFP. Biosafety Level: BSL-1.
DA2249 spg-7(ad2249) I. C. elegans Hemiasterlin resistant. Maintain under normal conditions. Reference: Zubovych IO, et al. Mol Biol Cell. 2010 Mar 15;21(6):956-69.
DA2250 mgl-2(tm355) I; mgl-1(tm1811) X. C. elegans Superficially wild-type; multiple subtle phenotypes related to nutritional response. References: Kang C, You YJ, Avery L. Genes Dev. 2007 Sep 1;21(17):2161-71. Kang C, Avery L. Genes Dev. 2009 Jan 1;23(1):12-7.
DA2356 ced-1(e1735) I; ced-3(n717) IV; lin-15B&lin-15A(n765) X; adEx2342. C. elegans adEx2342 [efl-3::mCherry::FLAG + LIN-15(+)]. Maintain by picking non-Muv. Fluorescence is dim, but array is stable (>95% transmission).
DA438 bli-4(e937) I; rol-6(e187) II; daf-2(e1368) vab-7(e1562) III; unc-31(e928) IV; dpy-11(e224) V; lon-2(e678) X. C. elegans Linkage mapping strain. Maintain at 15C.
DA443 rol-3(e754) unc-42(e270) V. C. elegans Roller Unc. e754 is cold-sensitive: lethal at 15C.
DA449 eat-1(e2343) dpy-20(e1282) IV. C. elegans Thin, starved, healthy adults. Retain few eggs. Slow irregular pumping at 16, 20, 25C. Dpy.
DA453 eat-2(ad453) II. C. elegans Eat. Scrawny. Slow pumping.
DA464 eat-5(ad464) I. C. elegans Abnormal feeding. Corpus and terminal bulb contractions unsynchronized.
DA465 eat-2(ad465) II. C. elegans Abnormal feeding. Slow, regular pumping. See also WBPaper00002341.
DA467 eat-6(ad467) V. C. elegans Abnormal feeding. Strong relaxation defective. NOTE: This strain is reportedly homozygous for an unknown X-linked unc mutation (10/31/2017).
DA468 unc-31(e928) IV; act-2(ad468) act-3(ad767) V. C. elegans Patchy birefringence in pharyngeal muscles-semidominant.
DA469 dpy-20(e1282) unc-31(e928) IV. C. elegans Dpy (ts). Unc.
DA472 pha-2(ad472) X. C. elegans Misshapen pharynx; worms hatch with pharynx of correct gross shape, but disorganized, with nuclei misplaced. Most homozygotes arrest in L1, escapers grow up to become very starved adults with deformed pharynges with abnormally small terminal bulb, thick nucleated isthmus. Weakly cold sensitive. Makes dauers that don't recover; doesn't survive freezing well.
DA491 dpy-20(e1282) unc-30(e191) IV. C. elegans Unc. Temperature sensitive Dpy.
DA493 phm-3(ad493) III. C. elegans Weak pharyngeal birefringence.
DA496 sDf10 unc-31(e169)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul, Unc lethals (early larval) and dead eggs. Maintain by picking WT.
DA497 let-59(s49) unc-22(s7)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul and lethal twitchers. Lethal early larval. Pick twitchers in 1% nicotine.
DA501 unc-101(m1) unc-59(e261) I. C. elegans
DA502 unc-75(e950) unc-101(m1) I. C. elegans Unc. Eat.
DA508 npr-1(n1353) X. C. elegans Clumps. npr-1 pka bor-1.
DA509 unc-31(e928) IV. C. elegans Extensively backcrossed to N2. Background strain for most of the feeding-defective mutant screens.
DA521 egl-4(ad450) IV. C. elegans Abnormal feeding. Falls asleep. Does not feed while asleep. Semidominant. Previously called eat-7.
DA522 eat-13(ad522) X. C. elegans Eat mutant. Slippery pharynx. Slight relaxation defect.
DA531 eat-1(ad427) IV. C. elegans Abnormal feeding. Slow pumping.
DA538 adDf538 I. C. elegans Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. PKA phm-2(ad538).
DA541 gpb-2(ad541) I. C. elegans Abnormal feeding. Slippery Corpus. Long. Slight coiler Unc. gpb-2(ad541) previously called eat-11(ad541).
DA563 eat-9(e2337) I; him-8(e1489) IV. C. elegans Abnormal feeding. Irregular pumping. Throws males.
DA572 eat-4(ad572) III. C. elegans Starved appearance. Reverts spontaneously-Do not passage! Clone starved-looking progeny with abnormal fast pharyngeal pumping to maintain.
DA573 eat-14(ad573) X. C. elegans
DA589 unc-32(e189) emb-9(hc70) III. C. elegans Unc. Temperature sensitive. Maintain at 15C. hc70 is semi-dominant.
DA591 unc-10(ad591) X. C. elegans Mild Unc-tends to form abnormally deep bends, especially when backing. Mild Eat.
DA596 snt-1(ad596) II. C. elegans Eat mutant. Strong Unc Eat. Jerky backward Unc. Hypomorph.
DA597 phm-2(ad597) I. C. elegans
DA599 eat-8(ad599) III. C. elegans Abnormal feeding. Brief, rare pumps. Slight coiler Unc.
DA601 eat-6(ad601) V. C. elegans Eat. Long pumps; slippery isthmus and corpus.
DA602 eat-15(ad602) I. C. elegans Eat mutant. Slippery isthmus, corpus and grinder.
DA606 eat-10(ad606) IV. C. elegans Abnormal feeding. Slippery isthmus and corpus.
DA607 pha-3(ad607) IV. C. elegans Deformed pharynx.
DA609 npr-1(ad609) X. C. elegans Causes worms to aggregate (Bor). Social.
DA612 bli-4(e937) adDf538 I. C. elegans Blistered. Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. adDf538 previously called phm-2(ad538).
DA620 eat-2(ad465) lin-7(e1413) unc-52(e444) II. C. elegans Abnormal feeding: slow, regular pumping. Vulvaless (incomplete penetrance). Unc.
DA631 eat-3(ad426) II; him-8(e1489) IV. C. elegans Abnormal feeding. Slow, irregular feeding. eat-3 exhibits strong maternal effect; dauers seldom recover; Him.
DA650 C. elegans wild isolate. C. elegans Clumps. Found in strain RC301. See 1987 Worm Meeting Abstract Book page 162. npr-1 pka bor-1.
DA658 lon-2(e678) npr-1(n1353) X. C. elegans Long. Clumps. npr-1 pka bor-1.
DA664 egl-4(ad450) lin-1(e1777) IV. C. elegans Muv. ad450 worms, when undisturbed, fall asleep. While asleep they do not move or pump. Disturbing them wakes them up, and while awake they act fairly normal. ad450 previously called eat-7.
DA675 unc-45(r450) dpy-1(e1) phm-3(ad493) III. C. elegans Dpy. Unc (ts). Phm. Weak pharyngeal birefringence.
DA678 unc-57(ad592) dpy-5(e61) I. C. elegans DpyUnc. ad592 is Eat. Dpy is semi-dominant.
DA686 nDf16/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. dpy-19(e1259) is temperature sensitive. Maintain by picking WT. [Checked 11/94 with sma-3 and nDf16 is present.]
DA695 egl-19(ad695) IV. C. elegans Abnormal feeding. Relaxation defective. Smallish. Males don't mate. Semidominant. Previously called eat-12. See also WBPaper00002912.
DA698 unc-36(ad698) III. C. elegans Unc. Eat - slippery pharynx, slow pumping.
DA702 eat-16(ad702) I. C. elegans Note: ad702 was isolated in an RC301 background. DA702 was not tested for the presence of npr-1(g320) following three rounds of outcrossing to N2 Bristol. DA702 does not display clumping behavior, so it's likely that DA702 has the Bristol npr-1. New stock rec'd 10/13/99.
DA707 eat-17(ad707) X. C. elegans Eat mutant. Stuffs corpus and isthmus. Abnormality in m6 and m7 contraction timing. Displays clumping behavior; isolated in an RC301 background, so it's likely to have the RC301 bor-1 mutation.
DA709 +/nT1 IV; sqt-3(sc63) eat-6(ad467) unc-76(e911)/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul and Sqt Unc larvae that grow very slowly.
DA711 unc-10(e102) dpy-6(e14) X. C. elegans DpyUnc.
DA726 unc-10(e102) eat-13(ad522) X. C. elegans Unc. Eat mutant. Slippery pharynx-Slight relaxation defect.
DA729 unc-101(m1) eat-9(e2337) I. C. elegans Unc. Abnormal feeding. Irregular pumping.
DA734 adDf538 unc-101(m1) I. C. elegans Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. Unc. adDf538 previously called phm-2(ad538).
DA735 E. coli. Escherichia coli Bacteria. 15kb lin-15 Xba fragment in Bluescript. Rescues @ 25 ng/ml and 50 ng/ml, better at 25. Biosafety Level: BSL-1.
DA740 bli-6(sc16) unc-24(e138) IV. C. elegans Blistered Unc.
DA742 lon-2(e678) unc-6(e78) egl-15(n484) X. C. elegans Long. Uncoordinated. Egl.
DA768 bli-6(sc16) egl-19(ad695) unc-24(e138)/nDf41 IV. C. elegans Heterozygotes are Blistered and Eat (terminal bulb relaxation defective). Heterozygotes segregate BliEat, BliEatUnc and dead eggs. ad695 previously called eat-12.
DA778 dpy-10(e128) snt-1(ad596) II. C. elegans
DA792 eat-6(ad792) V. C. elegans Eat. Relaxation defective. Lib. Cold sensitive.
DA810 egl-30(ad810) gpb-2(ad541)/gpb-2(ad541) I. C. elegans ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2. gpb-2 phenotype is rather subtle: they are slightly starved, slightly longer than normal, and tend to be loopy in their movements (they make abnormally deep bends). Hets should be Egl and non-Eat. On most E. coli strains gpb-2 grows rather poorly, especially if the plates are older so that there is a thick and tough lawn. On such plates there will be a lot of gpb-2 larval arrest, and those that don't arrest will grow slowly. The hets should easily outgrow the gpb-2 homozygotes. [gpb-2 is also hypersensitive to the drug arecoline: they won't grow on 5 mM. The hets will grow even better than WT on 5 mM arecoline.] gpb-2(ad541) previously called eat-11(ad541).
DA819 eat-4(ad819) III. C. elegans Abnormal feeding.
DA820 eat-18(ad820) I. C. elegans Semidominant Eat. pka eat-18.
DA823 egl-30(ad805) I. C. elegans Suppressor of gpb-2 (a.k.a. eat-11) arecoline hypersensitivity. Unc. Egl.
DA837 E. coli. Escherichia coli Bacteria. E. coli. Str-R. Uracil auxotroph. DA837 is derived from OP50. DA837 is harder for worms to eat than most E. coli strains. Some mild Eat mutant worms are easier to distinguish from WT when grown on DA837 than when grown on other E. coli strains. Biosafety Level: BSL-1.
DA869 sqt-3(sc8) lin-25(n545) him-5(e1467) unc-76(e911) V. C. elegans Roller. Unc. Vulvaless. Throws males. sc8 previously called rol-4(sc8).
DA929 egl-19(n582) unc-24(e138) IV. C. elegans Unc: amber suppressible. Egl: Lon, slow and floppy.
DA939 unc-36(e251) III; egl-19(n2368) IV. C. elegans Unc. Semidominant Egl-c, Sma.
DA944 unc-36(e251) III; egl-19(ad695) IV. C. elegans Unc. Semidominant Eat (TB relaxation defective).
DA945 unc-36(e251) III; egl-19(n582) IV. C. elegans Unc. Semidominant Egl, Lon, Slow and Floppy
DA949 bli-6(sc16) egl-19(n582) unc-24(e138) IV. C. elegans Blistered cuticle. Egl-Lon, slow and floppy. Unc.
DA952 egl-19(n582ad952) IV. C. elegans n582 is Egl, Lon, slow & floppy. Suppressed by ad952, which is semidominant. Strain is slightly Dpy and the pharyngeal bulb occasionally shows delayed relaxation and repolarization.
DA995 egl-19(ad995) IV. C. elegans Lon. Sluggish Unc. Egl. Eat. Rubberband.
DA997 eat-6(ad997) V. C. elegans Eat.
DL160 lin-59(n3192) unc-29(e1072) I. C. elegans
DL220 dpy-20(e1282) mig-32(tm1684) IV. C. elegans
DL308 ced-3(n717) IV; mxIs28 X. C. elegans mxIs28 [ceh-20p::ceh-20::YFP + lin-15(+)] X. Reference: Potts MB, Wang DP, & Cameron S. Dev Biol. 2009 May 15;329(2):374-85.
DL315 lin-15B&lin-15A(n765) X; mxIs30. C. elegans mxIs30 [unc-62p::unc-62::CFP + lin-15(+)]. Reference: Potts MB, Wang DP, Cameron S. Dev Biol. 2009 May 15;329(2):374-85.
DL7 wdIs4 II; unc-3(n3435) X. C. elegans wdIs4 [unc-4p::GFP + dpy-20(+)] II.
DL74 mig-32(n4275) IV. C. elegans
HB101 E. coli [supE44 hsdS20(rB-mB-) recA13 ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1]. Escherichia coli Bacteria. This strain of E. coli is easier for worms to eat than other E. coli strains. [supE44 hsdS20(rB-mB-) recA13 ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1]. Contains a mutation (rpsL20) in a ribosomal subunit gene that confers streptomycin resistance. Biosafety Level: BSL-1.
JD217 gar-3(vu78) V. C. elegans
JK987 tra-2(q276)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUnc and males. The males will mate. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT10362 unc-3(n3366) X. C. elegans
MT10480 unc-3(n3413) X. C. elegans
MT6129 egl-19(n2368) IV. C. elegans Small. Slightly jerky movement. Terminal bulb relaxation defective. Egl-c. Cold-sensitive Pat.
MT6308 eat-4(ky5) III. C. elegans Foraging defective. Abnormal chemotaxis.
temp_name237 mig-32(tm1684) IV; rtEx238. No fluorescence
temp_name34 eat-4(ky5) III; adEx1056[eat-4(+) rol-6(dom)]. never recovered from plate sent

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
ad609 Allele substitution
ad1302 Allele substitution
ad1774 Allele deletion
ad1006 Allele
ad1013 Allele
ad1015 Allele
ad1025 Allele
ad695 Allele substitution
ad1008 Allele
ad1051 Allele substitution nonsense
ad820 Allele substitution
ad810 Allele substitution nonsense
ad806 Allele substitution
ad1110 Allele substitution nonsense
ad427 Allele
ad1113 Allele substitution
ad1116 Allele substitution splice_site
ad1305 Allele substitution nonsense
ad1402 Allele
ad1426 Allele
ad1674 Allele deletion
ad2154 Allele substitution
ad2155 Allele
ad453 Allele substitution
ad464 Allele substitution
ad465 Allele substitution nonsense
ad467 Allele substitution
ad468 Allele
ad767 Allele
ad472 Allele
ad493 Allele
ad450 Allele substitution
ad522 Allele
ad541 Allele substitution
ad572 Allele
ad573 Allele
ad591 Allele
ad596 Allele insertion
ad597 Allele
ad599 Allele
ad601 Allele substitution
ad602 Allele
ad606 Allele
ad607 Allele
ad426 Allele
ad592 Allele
ad698 Allele
ad702 Allele
ad707 Allele
ad792 Allele
ad819 Allele
ad805 Allele substitution splice_site
ad952 Allele substitution
ad995 Allele
ad997 Allele substitution
ad1650 Allele deletion
ad446 Allele insertion