Laboratory Information
Name | CY View on WormBase |
---|---|
Allele designation | bv |
Head | Mark Wilson |
Institution | NIA |
Address | 251 Bayview Blvd. Biomedical Research Center, suite 1000 Baltimore 21224 United States |
Gene classes | ucp |
Strains contributed by this laboratory
Strain | Genotype | Species | Description |
---|---|---|---|
CY121 | ucp-4(ok195) V. | C. elegans | Amplify with the following external primers: EL1(agtcctgaacggagctttga); ER1(tacaatggcagcagcaagtc). Then re-amplify with the nested primer set: IL1(tcgcacattggtttgttgtt); IR1(aacggcatgagttagccaat). |
CY251 | sqt-1(sc13) age-1(mg44) II; bvIs2. | C. elegans | bvIs2 contains [ric-19p::age-1(cDNA)::myc::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs2 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GCA CAG TTT TAC GAA AGG AAC-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47. |
CY262 | sqt-1(sc13) age-1(mg44) II; bvIs1. | C. elegans | bvIs1 contains [ges-1p::age-1(cDNA)::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs1 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GTC ATT TTG GCA CCA TAG GAG-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47. |
CY397 | daf-16(mg242) I; sqt-1(sc13) age-1(mg109) II. | C. elegans | Sqt phenotype. The daf-16(mg242) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg242 is a nonsense mutation Trp220Amb. |
CY398 | daf-16(mg255) I; sqt-1(sc13) age-1(mg109) II. | C. elegans | Sqt phenotype. The daf-16(mg255) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg255 is a nonsense mutation Try144Amb. |
CY399 | sqt-1(sc13) age-1(mg109) II; pdk-1(mg261) X. | C. elegans | Sqt phenotype. The pdk-1(mg261) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg261 is an activating missense mutation Ala447Val. |
CY400 | sqt-1(sc13) age-1(mg109) II; akt-1(mg247) V. | C. elegans | Sqt phenotype. The akt-1(mg247) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg247 is an activating missense mutation Ala149Thr. |
CY401 | sqt-1(sc13) age-1(mg109)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT, DpyUncs and Sqt. age-1(mg109) homozygotes throw all dauers at all temperatures (maternal effect dauer constitutive). age-1(mg109) homozygous animals that are maternally rescued for dauer formation are long-lived. |
CY573 | bvIs5. | C. elegans | bvIs5 [cyp-35B1p::GFP + gcy-7p::GFP]. Little or no GFP expression in adults. GFP expressed in intestine of dauers. Reference: Iser WB, et al. PLoS One. 2011 Mar 9;6(3):e17369. |
CY577 | bvIs6. | C. elegans | bvIs6 [cat-4p::GFP + gcy-7p::GFP]. GFP localized to intestine, neurons and hypodermis in adults. GFP localized to neurons and seam cells in dauers. Reference: Iser WB, et al. PLoS One. 2011 Mar 9;6(3):e17369. |
This laboratory hasn't submitted any alleles to the CGC.