Laboratory Information

NameCY View on WormBase
Allele designationbv
HeadMark Wilson
InstitutionNIA
Address 251 Bayview Blvd.
Biomedical Research Center, suite 1000
Baltimore 21224
United States
Gene classes ucp 

Strains contributed by this laboratory

Strain Genotype Species Description
CY121 ucp-4(ok195) V. C. elegans Amplify with the following external primers: EL1(agtcctgaacggagctttga); ER1(tacaatggcagcagcaagtc). Then re-amplify with the nested primer set: IL1(tcgcacattggtttgttgtt); IR1(aacggcatgagttagccaat).
CY251 sqt-1(sc13) age-1(mg44) II; bvIs2. C. elegans bvIs2 contains [ric-19p::age-1(cDNA)::myc::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs2 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GCA CAG TTT TAC GAA AGG AAC-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.
CY262 sqt-1(sc13) age-1(mg44) II; bvIs1. C. elegans bvIs1 contains [ges-1p::age-1(cDNA)::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs1 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GTC ATT TTG GCA CCA TAG GAG-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.
CY397 daf-16(mg242) I; sqt-1(sc13) age-1(mg109) II. C. elegans Sqt phenotype. The daf-16(mg242) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg242 is a nonsense mutation Trp220Amb.
CY398 daf-16(mg255) I; sqt-1(sc13) age-1(mg109) II. C. elegans Sqt phenotype. The daf-16(mg255) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg255 is a nonsense mutation Try144Amb.
CY399 sqt-1(sc13) age-1(mg109) II; pdk-1(mg261) X. C. elegans Sqt phenotype. The pdk-1(mg261) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg261 is an activating missense mutation Ala447Val.
CY400 sqt-1(sc13) age-1(mg109) II; akt-1(mg247) V. C. elegans Sqt phenotype. The akt-1(mg247) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg247 is an activating missense mutation Ala149Thr.
CY401 sqt-1(sc13) age-1(mg109)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUncs and Sqt. age-1(mg109) homozygotes throw all dauers at all temperatures (maternal effect dauer constitutive). age-1(mg109) homozygous animals that are maternally rescued for dauer formation are long-lived.
CY573 bvIs5. C. elegans bvIs5 [cyp-35B1p::GFP + gcy-7p::GFP]. Little or no GFP expression in adults. GFP expressed in intestine of dauers. Reference: Iser WB, et al. PLoS One. 2011 Mar 9;6(3):e17369.
CY577 bvIs6. C. elegans bvIs6 [cat-4p::GFP + gcy-7p::GFP]. GFP localized to intestine, neurons and hypodermis in adults. GFP localized to neurons and seam cells in dauers. Reference: Iser WB, et al. PLoS One. 2011 Mar 9;6(3):e17369.
This laboratory hasn't submitted any alleles to the CGC.