Strain Information
| Name | BAN456 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | wah-1(bon89) III. |
| Description | wah-1(bon89) is a hypomorphic allele generated by a CRISPR/Cas9-engineered in-frame deletion. Genotyping primers: CCCACTCTCCGTTGATGGCT and TGCTTAGCCTCCTCACTGGC; wah-1(bon89)-specific product: 229 bp; WT: NO PRODUCT. Reference: Mondal M, et al. 2025 Dec 1;16(1):10817. doi: 10.1038/s41467-025-66900-8. PMID: 41326385. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x5 |
| Made by | Bano Lab |
| Laboratory | BAN |
| Reference | Mondal M. et al, doi: 10.1038/s41467-025-66900-8 |
Sign in
or
register an account if you want to order this strain.