Strain Information

Name BAN456   View On Wormbase
Species C. elegans
Genotypewah-1(bon89) III.
Descriptionwah-1(bon89) is a hypomorphic allele generated by a CRISPR/Cas9-engineered in-frame deletion. Genotyping primers: CCCACTCTCCGTTGATGGCT and TGCTTAGCCTCCTCACTGGC; wah-1(bon89)-specific product: 229 bp; WT: NO PRODUCT. Reference: Mondal M, et al. 2025 Dec 1;16(1):10817. doi: 10.1038/s41467-025-66900-8. PMID: 41326385.
MutagenCrispr/Cas9
Outcrossedx5
Made byBano Lab
Laboratory BAN
Reference Mondal M. et al, doi: 10.1038/s41467-025-66900-8
Sign in or register an account if you want to order this strain.