Laboratory Information
| Name | ABR View on WormBase |
|---|---|
| Allele designation | sta |
| Head | Anne Brunet |
| Institution | Stanford University, Stanford, CA |
| Address | 300 PASTEUR DRIVE ALWAY BUILDING, ROOM M336 STANFORD 94305-2296 United States |
| Website | http://www.stanford.edu/group/brunet/index.html |
| Gene classes | aakg |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| ABR1 | pha-1(e2123) III; staEx1. | C. elegans | staEx1 [T20F7.6p + pha-1(+)]. Empty vector control strain. Maintain at 25 degrees. Superficially wild-type. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56. |
| ABR14 | shEx34. | C. elegans | shEx34 [myo-3p::mCherry]. Pick mCherry+ to maintain. This strain serves as a control strain to ABR16. Reference: Han S, et al. Nature 2017 doi: 10.1038/nature21686. |
| ABR156 | Cbr-she-1(v35) IV; mfIs42. | C. briggsae | mfIs42 [Cel-sid-2(+) + Cel-myo-2::dsRed]. Maintain at 15C. Feminization is partially-penetrant at 15C; most hermaphrodites are somewhat self-fertile and can lay small broods. Can be maintained by crossing with male siblings. Feminized C. briggsae strain made susceptible to RNAi knock-down by feeding dsRNA due to the transgenic expression of C. elegans SID-2. Generated by crossing parental strains JU1018 with RE665. Reference: Booth LN, eLife 2019 Jul 8;8:e46418. PMID: 31282863. |
| ABR16 | shEx1. | C. elegans | shEx1 [ges-1p::fat-7 + myo-3p::mCherry]. Pick mCherry+ to maintain. FAT-7 over-expressing strain. ABR14 serves as a control strain for this strain. Reference: Han S, et al. Nature 2017 doi: 10.1038/nature21686. |
| ABR161 | hjIs37; ldrIs1. | C. elegans | hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. mRFP targeted to peroxisomes in intestinal cells. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Derived by crossing parental strains VS10 and LIU1 and outcrossing six times to ABR lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715. |
| ABR212 | acd-1(sta6) delm-2(ok1822) I. | C. elegans | acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). |
| ABR225 | acd-1(sta6) delm-2(ok1822) I; delm-1(ok1266) IV. | C. elegans | acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). This triple mutant strain was made by crossing the acd-1(sta6) delm-2(ok1822) double mutant with delm-1(ok1226) parental strain RB1177. |
| ABR269 | staEx24. | C. elegans | staEx24 [ges-1p::(delta SP)F21A3.11::SL2::WormScarlet::unc-54 3'UTR]. Pick animals with red fluorescence in intestine to maintain. Overexpression of a non-secreted form of F21A3.11 in the intestine. |
| ABR273 | pha-1(cc1299) III; sybIs6766. | C. elegans | sybIs6766 [ges-1p::TurboID-ER::unc-54 3’UTR + myo-2p::mCherry::unc-54 3’UTR + pha-1(+)]. Integrated strain expressing TurboID in the intestine localized and retained in the ER. |
| ABR275 | staEx25. | C. elegans | staEx25 [ges-1p:: F21A3.11::SL2::WormScarlet::unc-54 3'UTR]. Pick animals with red fluorescence in intestine to maintain. Overexpression of F21A3.11 in the intestine |
| ABR287 | pha-1(cc1299) III; staEx11. | C. elegans | staEx11 [ges-1p::F21A3.11::2xLinker::WormScarlet::SL2WormGreenLantern::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for array. F21A3.11 tagged with WormScarlet to visualize secretion of the protein. |
| ABR291 | pha-1(cc1299) III; staEx19. | C. elegans | staEx19 [ges-1p::F53B6.4::2xLinker::WormScarlet::SL2::WormGreenLantern::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for array. F53B6.4 tagged with WormScarlet to visualize secretion of the protein. |
| ABR297 | pha-1(cc1299) III; staEx23. | C. elegans | staEx23 [ges-1p::(delta SP)F21A3.11::2xLinker::WormScarlet::SL2::WormGreenLantern::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for array. Non-secreted F21A3.11 tagged with WormScarlet to visualize the protein. |
| ABR327 | pha-1(cc1299) III; staEx13. | C. elegans | staEx13 [ges-1p::T05E12.3::2xLinker::WormScarlet::SL2::WormGreenLantern::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for array. T05E12.3 tagged with WormScarlet to visualize secretion of the protein. |
| ABR333 | pha-1(cc1299) III; staEx17. | C. elegans | staEx17 [ges-1p::F56F10.1::2xLinker::WormScarlet::SL2::WormGreenLantern::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for array. F56F10.1 tagged with WormScarlet to visualize secretion of the protein. |
| ABR337 | pha-1(cc1299) III; staEx15. | C. elegans | staEx15 [ges-1p::C02A12.4::2xLinker::WormScarlet::SL2::WormGreenLantern::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for array. C02A12.4 tagged with WormScarlet to visualize secretion of the protein. |
| ABR339 | lpin-1(wbm76[lpin-1::GFP]) V. | C. elegans | GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.] |
| ABR388 | pha-1(cc1299) III; sybIs7982. | C. elegans | sybIs7982 [ges-1p::TurboID::unc-54 3’UTR + myo-2p::mCherry::unc-54 3’UTR + pha-1(+)]. Integrated strain expressing TurboID in the intestine cytoplasm. |
| ABR4 | pha-1(e2123) III; staEx4. | C. elegans | staEx4 [T20F7.6p(R81Q)::T20F7.6 + pha-1(+)]. Constitutively active T20f7.6 promoter construct (CA3). Maintain at 25 degrees. Superficially wild-type with increased lifespan and stress resistance. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56. |
| ABR417 | pha-1(cc1299) III; staEx27. | C. elegans | staEx27 [ges-1p::F21A3.11::3xHA::tag::SL2WormScarlet::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for array. Overexpression of F21A3.11 with a 3xHA tag. |
| ABR429 | pha-1(cc1299) III; staEx28. | C. elegans | staEx28 [ges-1p::F21A3.11(7A)::3xHA::tag::SL2WormScarlet::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for array. Overexpression of phosphatase-dead form of F21A3.11 carrying seven point mutations and a 3xHA tag. |
| ABR461 | sybIs8667. | C. elegans | sybIs8667 [ges-1p::F21A3.11::SL2::WormScarlet::unc-54 3'UTR]. Integrated reporter strain expressing F21A3.11 in the intestine. |
| ABR489 | F53B6.4(sta15) I. | C. elegans | sta15 is a CRISPR-engineered 31bp deletion in exon 2 of F53B6.4 that causes in early stop codons and a predicted full knockout. Made with a co-conversion of dpy-10 in parental N2 strain; presumably chased away during out-crossing. Left flanking Sequence of the deletion: AATCATCAAAGTCTTCGAAATCGAAGAAAG ; Right flanking sequence of the deletion: TTCAACTGTTTCCGCTGCTACTGGTGTTTC . sgRNA #1: GTCAAGACTGCTACCACCTC |
| ABR5 | unc-119(ed3) III; staIs1. | C. elegans | staIs1 [pie-1p::GFP + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: This strain was used as the empty vector control in Greer EL et al Nature 2010 doi: 10.1038/nature09195. |
| ABR7 | unc-119(ed3) III; staIs2. | C. elegans | staIs2 [pie-1p::rbr-2::GFP + unc-119(+)]. Extended longevity. Maintain under normal conditions. Reference: This strain was used as LC Ppie-1::rbr-2::GFP (#3) in Greer EL et al Nature 2010 doi: 10.1038/nature09195. |
| ABR9 | set-2(ok952) III; rbr-2(tm1231) IV. | C. elegans | Reduced lifespan. Maintain under normal conditions. The parental rbr-2 strain was outcrossed 6x and the parental set-2 strain was outcrossed 2x. Reference: Greer EL et al Nature (2010) doi: 10.1038/nature09195. |
| PHX9731 | F53B6.4(syb9731[F53B6.4::3xHA]) I. | C. elegans | 3xHA tag inserted into the C-terminus of the endogenous F53B6.4 locus. Insert: TACCCATACGACGTCCCAGACTACGCCTACCCATATGATGTCCCGGATTACGCTTACCCATACGATGTTCCAGATTACGCT. Wild type sequence with 30bp flanks: GAGATGATGGTTGTCCCATTGGTGGCTGCC*TAAacaatcgattcgacatcaatcttgaag. Knock-in with 30 bp flanks: GAGATGATGGTTGTCCCACTTGTGGCTGCCTACCCATACGACGTCCCAGACTACGCCTACCCATATGATGTCCCGGATTACGCTTACCCATACGATGTTCCAGATTACGCTTAAacaatcgattcgacatcaatcttgaag |
| WBM1177 | wbmIs81. | C. elegans | wbmIs81 [eft-3p::3XFLAG::GFP::SKL::unc-54 3'UTR *wbmIs65] (V:8645000). Ubiquitous expression of peroxisome-targeted GFP. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. Derived from parental strain WBM1140 by CRISPR-mediated insertion of peroxisome-targeted GFP downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome (wbmIs65). Outcrossed six times to WBM lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715. |
This laboratory hasn't submitted any alleles to the CGC.