Laboratory Information

NameABR View on WormBase
Allele designationsta
HeadAnne Brunet
InstitutionSTANFORD UNIVERSITY
Address 300 PASTEUR DRIVE
ALWAY BUILDING, ROOM M336
STANFORD, CA 94305 94305-2296
United States
Website http://www.stanford.edu/group/brunet/index.html
Gene classes aakg 

Strains contributed by this laboratory

Strain Genotype Species Description
ABR1 pha-1(e2123) III; staEx1. C. elegans staEx1 [T20F7.6p + pha-1(+)]. Empty vector control strain. Maintain at 25 degrees. Superficially wild-type. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56.
ABR14 shEx34. C. elegans shEx34 [myo-3p::mCherry]. Pick mCherry+ to maintain. This strain serves as a control strain to ABR16. Reference: Han S, et al. Nature 2017 doi: 10.1038/nature21686.
ABR156 Cbr-she-1(v35) IV; mfIs42. C. briggsae mfIs42 [Cel-sid-2(+) + Cel-myo-2::dsRed]. Maintain at 15C. Feminization is partially-penetrant at 15C; most hermaphrodites are somewhat self-fertile and can lay small broods. Can be maintained by crossing with male siblings. Feminized C. briggsae strain made susceptible to RNAi knock-down by feeding dsRNA due to the transgenic expression of C. elegans SID-2. Generated by crossing parental strains JU1018 with RE665. Reference: Booth LN, eLife 2019 Jul 8;8:e46418. PMID: 31282863.
ABR16 shEx1. C. elegans shEx1 [ges-1p::fat-7 + myo-3p::mCherry]. Pick mCherry+ to maintain. FAT-7 over-expressing strain. ABR14 serves as a control strain for this strain. Reference: Han S, et al. Nature 2017 doi: 10.1038/nature21686.
ABR161 hjIs37; ldrIs1. C. elegans hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. mRFP targeted to peroxisomes in intestinal cells. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Derived by crossing parental strains VS10 and LIU1 and outcrossing six times to ABR lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.
ABR212 acd-1(sta6) delm-2(ok1822) I. C. elegans acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4).
ABR225 acd-1(sta6) delm-2(ok1822) I; delm-1(ok1266) IV. C. elegans acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). This triple mutant strain was made by crossing the acd-1(sta6) delm-2(ok1822) double mutant with delm-1(ok1226) parental strain RB1177.
ABR339 lpin-1(wbm76[lpin-1::GFP]) V. C. elegans GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.]
ABR4 pha-1(e2123) III; staEx4. C. elegans staEx4 [T20F7.6p(R81Q)::T20F7.6 + pha-1(+)]. Constitutively active T20f7.6 promoter construct (CA3). Maintain at 25 degrees. Superficially wild-type with increased lifespan and stress resistance. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56.
ABR5 unc-119(ed3) III; staIs1. C. elegans staIs1 [pie-1p::GFP + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: This strain was used as the empty vector control in Greer EL et al Nature 2010 doi: 10.1038/nature09195.
ABR7 unc-119(ed3) III; staIs2. C. elegans staIs2 [pie-1p::rbr-2::GFP + unc-119(+)]. Extended longevity. Maintain under normal conditions. Reference: This strain was used as LC Ppie-1::rbr-2::GFP (#3) in Greer EL et al Nature 2010 doi: 10.1038/nature09195.
ABR9 set-2(ok952) III; rbr-2(tm1231) IV. C. elegans Reduced lifespan. Maintain under normal conditions. The parental rbr-2 strain was outcrossed 6x and the parental set-2 strain was outcrossed 2x. Reference: Greer EL et al Nature (2010) doi: 10.1038/nature09195.
WBM1177 wbmIs81. C. elegans wbmIs81 [eft-3p::3XFLAG::GFP::SKL::unc-54 3'UTR *wbmIs65] (V:8645000). Ubiquitous expression of peroxisome-targeted GFP. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. Derived from parental strain WBM1140 by CRISPR-mediated insertion of peroxisome-targeted GFP downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome (wbmIs65). Outcrossed six times to WBM lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.
This laboratory hasn't submitted any alleles to the CGC.