Laboratory Information
| Name | BR View on WormBase |
|---|---|
| Allele designation | by |
| Head | Ralf H Baumeister |
| Institution | Albert-Ludwigs-University of Freiburg, Freiburg, Germany |
| Address | Bio3 Bioinformatics and Molecular Genetics Schaenzlestr. 1 Freiburg im Breisgau D-79104 Germany |
| Website | http://www.celegans.de |
| Gene classes | chs djr nep pdr phip pifk pink sgk endu |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| BR2742 | pept-1(lg601) X. | C. elegans | Slow postembryonic development. Reduced brood size. Previously known as pep-2. [NOTE: the genotype of this strain was previously incorrectly annotated as lg1601. The correct allele name is lg601.] Reference: Meissner B, et al. J Biol Chem. 2004 Aug 27;279(35):36739-45. |
| BR2815 | nep-1(by159) II. | C. elegans | 1450 bp deletion. Deletion removes 245 bp of promoter, 1st exon and 2nd exon. |
| BR2823 | chn-1(by155) I. | C. elegans | 989bp deletion. Primers used: RB1537 (external left): CAAGCTTAATTTGCACACAATGCGTCAG; RB1540 (external right): AGAAGAGGCAAGAATGGAACTTGTGCG; RB1538 (internal left): AACAATTTCCGCTTATTTTCAGCGTTTG; RB1539 (internal right): CTGAACCATTGAAAGCTTTTCAGATC. Deletion breakpoints (T09B4 coordinates): 32756/33746 through 32757/33747. |
| BR3417 | spr-5(by134) I. | C. elegans | Suppressor of Egl of sel-12. |
| BR4006 | pink-1(tm1779) II; byEx655. | C. elegans | byEx655 [pink-1p::pink-1::GFP + myo-2p::mCherry + herring sperm DNA]. Pick mCherry+ animals to maintain. pink-1 translational GFP (C-terminal GFP) fusion generated by cloning the complete pink-1 genomic fragment (3191 bp) with a 6-kb upstream promoter region and into pPD117.01. Reference: Sämann J, et al. J Biol Chem. 2009 Jun 12;284(24):16482-91. |
| BR5082 | shc-1(ok198) I; zIs356 IV. | C.elegans | zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)] IV. Tumorous germline with degeneration of surrounding extracellular matrix & disrupted gonadal basement membrane. Reference: Qi W, et al. PLoS Genet. 2012;8(8):e1002836. doi: 10.1371/journal.pgen.1002836. |
| BR5270 | byIs161. | C. elegans | byIs161 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted (line A). Integration site not mapped. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603. |
| BR5271 | byIs162. | C. elegans | byIs162 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted and two isoleucines to proline substitutions in the hexapeptide motifs of the repeat region (line A). These mutations abrogate the aggregation, making this strain an anti-aggregation control for BR5270. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603. |
| BR5486 | byIs162; bkIs10. | C. elegans | byIs162 [rab-3p::F3(delta)K280(I277P)(I308P) + myo-2p::mCherry]. bkIs10 [aex-3p::h4R1NtauV337M + myo-2p::GFP]. Strain co-expressing the F3(delta)K280 anti-aggregation Tau fragment (with two I to P substitutions) and full-length Tau in all neurons. Red and green fluorescence in the pharynx due to the co-injection markers. The F3/2P fragment is not able to nucleate aggregation of full length Tau. bkIs10 contains an integrated transgene encoding the 1N4R isoforms of human tau with the 337M FTDP-17 mutation. Expression is driven by the pan-neuronal promoter aex-3. Over-expression of this transgene results in a pronounced Unc phenotype. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603. |
| BR5514 | tax-2(p671) I; tax-4(p678) III. | C. elegans | Reference: Liu S, Schulze E, Baumeister R. PLoS One. 2012;7(3):e32360. |
| BR5602 | tax-4(p678) III; byEx836. | C. elegans | byEx836 [odr-4p::tax-4::GFP + myo-2p::mCherry]. Pick mCherry+ animals to maintain. Rescues tax-4 null mutant. Expresses tax-4(+) in AWA, AWB, AWC, ADF, ASG, ASH, ASI, ASJ, ASK, ADL, PHA, and PHB sensory neurons, but not AFD sensory neurons. Reference: Liu S, Schulze E, Baumeister R. PLoS One. 2012;7(3):e32360. |
| BR5706 | byIs193; bkIs10. | C. elegans | byIs193 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. bkIs10 [aex-3p::hTau V337M + myo-2p::GFP]. Worms have severe locomotion defect and slow growth. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603. |
| BR5944 | byIs193. | C. elegans | byIs193 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. F3 pro aggregation fragment is expressed at low levels (line B); hard to detect by western blot. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603. |
| BR6427 | byIs194; bkIs10. | C. elegans | byIs194 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. bkIs10 [aex-3p::hTau V337M + myo-2p::GFP]. Tau anti-aggregation double transgenic line generated by crossing byIs194 x bkIs10. Normal locomotion. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603. |
| BR6516 | byIs194. | C. elegans | byIs194 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted and two isoleucines to proline substitutions in the hexapeptide motifs of the repeat region (line B). These mutations abrogate the aggregation, making this strain an anti-aggregation control for BR5270. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603. |
| BR6563 | byIs161; bkIs10. | C. elegans | byIs161 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. bkIs10 [aex-3p::h4R1NtauV337M + myo-2p::GFP]. Strain co-expressing the F3(delta)K280 pro-aggregation Tau fragment and full-length Tau in all neurons. Worms have severe locomotion defect and slow growth. Red and green fluorescence in the pharynx due to the co-injection markers. bkIs10 contains an integrated transgene encoding the 1N4R isoforms of human tau with the 337M FTDP-17 mutation. Expression is driven by the pan-neuronal promoter aex-3. Over-expression of this transgene results in a pronounced Unc phenotype. Derived by additional outcrossing of BR5485. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603. |
| BR7205 | endu-2(by190[endu-2::eGFP]) X. | C.elegans | eGFP tag inserted into the endogenous endu-2 locus. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications. |
| BR7295 | endu-2(tm4977) X; byEx1375. | C.elegans | byEx1375 [endu-2p::endu-2::eGFP + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. Transgene rescues mortal germline (Mrt) phenotype of endu-2(tm4977). Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications. |
| BR7827 | endu-2(tm4977) X; byEx1551. | C.elegans | byEx1551 [vha-6p::endu-2::eGFP::3xFLAG + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. Transgene provides intestinal rescue of endu-2(tm4977) that also rescues mortal germline (Mrt) phenotype. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications. |
| BR8551 | endu-2(tm4977) X; byEx1795. | C.elegans | byEx1795 [unc-119p::endu-2::eGFP::3xFlag + rol-6(su1006)]. Pick Rollers to maintain. Transgene provides neuronal rescue of endu-2(tm4977) that also rescues mortal germline (Mrt) phenotype. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications. |
| PP198 | ufd-2(tm1380) II. | C. elegans |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| by159 | Allele | deletion | |
| by155 | Allele | deletion | |
| by134 | Allele | substitution | nonsense |
| by108 | Allele | ||
| by105 | Allele | substitution | nonsense |