Search Strains

More Fields
Strain Species Genotype Add
JEL446 C. briggsae Cbr-met-2(xoe1) III. Show Description
Derived from C. briggsae strain AF16. Reference: Larson BJ, et al. Genetics. 2016 Jun 8. pii: genetics.116.191130.
JEL1000 C. elegans hsr-9(xoe17) I. Show Description
Superfically wild-type. hsr-9(xoe17) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The hsr-9 repair template (gattttgcctcttaaataaaatttcagCAAAAAACCGAGGGGAGACTTGCAATAGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCTCTCGGATCATCTTGCAAACATGCTTATTGCTGgtaggtattgcaacc) and guide RNA (AGGGGAGACTTGCAATATCT) were injected into N2 and the resulting progeny were analyzed by PCR using TGAAATTAAGGTGGTCACTCGAAG and GTTGTTGTGGGGAGGCTGAA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.
JEL1016 C. elegans hsr-9(xoe17) I; brc-1(xoe4) III. Show Description
Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.
JEL1142 C. elegans hsr-9(xoe17) I; brc-1(xoe4) polq-1(xoe51) III. Show Description
Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.
JEL1162 C. elegans brd-1(xoe18) III. Show Description
Weak Emb and Him. N2 parental background. Reference: Li Q, et al. PLoS Genet. 2023 Jan 30;19(1):e1010457. doi: 10.1371/journal.pgen.1010457. PMID: 36716349.
JEL1319 C. elegans hsr-9(xoe17) I; brd-1(xoe18) III. Show Description
Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.