| BX115 |
C. elegans |
lin-15B&lin-15A(n765) X; waEx16. Show Description
waEx16 [fat-6::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+.
|
|
| CT15 |
C. elegans |
zaEx16. Show Description
zaEx16 [mir-84::GFP + rol-6(su1006)]. Pick GFP+ to maintain. The GFP+ animals may not always express the Roller phenotype.
|
|
| DM5115 |
C. elegans |
unc-112(st581) V; raEx16. Show Description
raEx16 [unc-112::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. raEx16 produces a fully functional GFP-tagged unc-112 protein that localizes to the dense bodies and M-line in muscle cells, and rescues the lethal phenotype of unc-112(st581) homozygous animals. Reference: Rogalski TM, et al. J Cell Biol. 2000 Jul 10;150(1):253-64.
|
|
| DM7016 |
C. elegans |
raEx16. Show Description
raEx16 [unc-112::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. raEx16 produces a fully functional GFP-tagged unc-112 protein that localizes to the dense bodies and M-line in muscle cells, and will rescue the lethal phenotype of unc-112(st581) homozygous animals. Reference: Rogalski TM, et al. J Cell Biol. 2000 Jul 10;150(1):253-64.
|
|
| DM8008 |
C. elegans |
raIs8. Show Description
raIs8 [unc-112::GFP + rol-6(su1006)]. Rollers. raIs8 produces a fully functional GFP-tagged UNC-112 protein that localizes to the dense bodies and M-line in muscle cells. Derived by integrating raEx16 in DM7016.
|
|
| EU1618 |
C. elegans |
unc-119(ed3) III; orEx16. Show Description
orEx16 [rfl-1p::tdTomato::rfl-1(genomic) + unc-119(+)]. Pick non-Unc to maintain. N-terminal tdTomato fusion to RFL-1 driven by rfl-1 promoter. Reference: Dorfman M, et al. Genetics. 2009 Aug;182(4):1035-49.
|
|
| JH2932 |
C. elegans |
unc-24(e1172) mbk-2(pk1427) IV/nT1[let-?(m435)] (IV;V); ddEx16. Show Description
ddEx16 [pgl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Maintain at 25C to retain transgene expression. Heterozygotes are Unc and segregate Uncs, dead eggs and WT. Reference: Wang JT, et al. eLife 2014;3:e04591.
|
|
| KR2365 |
C. elegans |
unc-11(e47) I; hEx16. Show Description
hEx16 [C32E7 + rol-6(su1006)]. Segregates 65% Unc Rollers. Semi-sterile: high sterility rate and low brood size. Maintain by picking Unc Rollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
| TH206 |
C. elegans |
unc-119(ed3) III; ddEx16. Show Description
ddEx16 [pgl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Pick wild-type to maintain array. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
|
|
| VM57 |
C. elegans |
lin-15B&lin-15A(n765) X; akEx16. Show Description
akEx16 [glr-3::GFP + lin-15(+)]. Maintain by picking non-Muv. Worms with the array are non-Muv at 20C.
|
|
| XE1065 |
C. elegans |
sup-17(n316) I; oxIs12 X ; wpEx16. Show Description
oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. wpEx16 [unc-47p::sup-17 + myo-2p::GFP]. Pick animals with GFP+ pharynx to maintain array. GABAergic expression of SUP-17 from wpEx16 rescues sup-17(n316). Reference: El Bejjani R, Hammarlund M. Neuron. 2012; 73(2):268-78.
|
|
| ZZ16 |
C. elegans |
lev-9(x16) X. Show Description
Pseudo wild type levamisole resistance. WT phenotype.
|
|
| AX7884 |
C. elegans |
pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X. Show Description
Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC)
encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases.
Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017.
|
|
| AY160 |
C. elegans |
gtl-2(n2618) IV; acEx160. Show Description
acEx160 [sulp-4p::gtl-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed in the excretory cell). gtl-2 expression driven by sulp-4 promoter. Transgene rescues gtl-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935
|
|
| AY162 |
C. elegans |
mul-1(syb1027) IV; acEx162. Show Description
acEx162 [mul-1p::mul-1::SL2::GFP + myo-2p::mCherry]. Pick mCherry+ to maintain. GFP expression in the intestine. acEx162 transgene rescues mul-1(lf). mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9 ∼1,650-bp deletion mutant of isoforms A and B (565 bp and 952 bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446
|
|
| BC16004 |
C. elegans |
dpy-5(e907) I; sEx16004. Show Description
sEx16004 [rCes F56D5.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16010 |
C. elegans |
dpy-5(e907) I; sEx16010. Show Description
sEx16010 [rCes F54B8.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16016 |
C. elegans |
dpy-5(e907) I; sEx16016. Show Description
sEx16016 [rCesF19B2.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16019 |
C. elegans |
dpy-5(e907) I; sEx16019. Show Description
sEx16019 [rCes K03D3.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16021 |
C. elegans |
dpy-5(e907) I; sEx16021. Show Description
sEx16021 [rCes F10A3.15::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16028 |
C. elegans |
dpy-5(e907) I; sEx16028. Show Description
sEx16028 [rCes Y9C9A.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16030 |
C. elegans |
dpy-5(e907) I; sEx16030. Show Description
sEx16030 [rCesY9C9A.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16049 |
C. elegans |
dpy-5(e907) I; sEx16049. Show Description
sEx16049 [rCes C46E10.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16051 |
C. elegans |
dpy-5(e907) I; sEx16051. Show Description
sEx16051 [rCes F07F6.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16057 |
C. elegans |
dpy-5(e907) I; sEx16057. Show Description
sEx16057 [rCesF09C12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16064 |
C. elegans |
dpy-5(e907) I; sEx16064. Show Description
sEx16064 [rCesC50B6.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16070 |
C. elegans |
dpy-5(e907) I; sEx16070. Show Description
sEx16070 [rCes C41G6.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16071 |
C. elegans |
dpy-5(e907) I; sEx16071. Show Description
sEx16071 [rCes C41G6.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16072 |
C. elegans |
dpy-5(e907) I; sEx16072. Show Description
sEx16072 [rCes ZK697.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16074 |
C. elegans |
dpy-5(e907) I; sEx16074. Show Description
sEx16074 [rCes B0454.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16083 |
C. elegans |
dpy-5(e907) I; sEx16083. Show Description
sEx16083[rCesZK652.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16086 |
C. elegans |
dpy-5(e907) I; sEx16086. Show Description
sEx16086 [rCes F08F8.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16092 |
C. elegans |
dpy-5(e907) I; sEx16092. Show Description
sEx16092[rCesK07E12.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16094 |
C. elegans |
dpy-5(e907) I; sEx16094. Show Description
sEx16094 [rCes F52C9.8a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16095 |
C. elegans |
dpy-5(e907) I; sEx16095. Show Description
sEx16095 [rCesF25F2.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16096 |
C. elegans |
dpy-5(e907) I; sEx16096. Show Description
sEx16096 [rCes F37C12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16099 |
C. elegans |
dpy-5(e907) I; sEx16099. Show Description
sEx16099 [rCes T08A11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16107 |
C. elegans |
dpy-5(e907) I; sEx16107. Show Description
sEx16107 [rCes C44C3.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16112 |
C. elegans |
dpy-5(e907) I; sEx16112. Show Description
sEx16112[rCesY55F3AM.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16116 |
C. elegans |
dpy-5(e907) I; sEx16116. Show Description
sEx16116 [rCes F49H6.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16118 |
C. elegans |
dpy-5(e907) I; sEx16118. Show Description
sEx16118 [rCes F10A3.13::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16124 |
C. elegans |
dpy-5(e907) I; sEx16124. Show Description
sEx16124 [rCesF35G12.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16125 |
C. elegans |
dpy-5(e907) I; sEx16125. Show Description
sEx16125 [rCes F54D8.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16132 |
C. elegans |
dpy-5(e907) I; sEx16132. Show Description
sEx16132[rCesZK688.6a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16140 |
C. elegans |
dpy-5(e907) I; sEx16140. Show Description
sEx16140 [rCesC51E3.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16142 |
C. elegans |
dpy-5(e907) I; sEx16142. Show Description
sEx16142 [rCes B0454.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16151 |
C. elegans |
dpy-5(e907) I; sEx16151. Show Description
sEx16151[rCesF02E8.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16156 |
C. elegans |
dpy-5(e907) I; sEx16156. Show Description
sEx16156 [rCesC05D11.7b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16158 |
C. elegans |
dpy-5(e907) I; sEx16158. Show Description
sEx16158 [rCesT04C9.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16159 |
C. elegans |
dpy-5(e907) I; sEx16159. Show Description
sEx16159 [rCes B0393.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|