| ufd-3(sy1796) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of ufd-3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. Left flanking sequence: CTCATCATTCACTGAATTCGTATTTCTGTGATCGTGA. Right flanking sequence: ACGTGGTCAGGAACTTGTCGGAAGATTAATTGC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTTCTGTGATCGTGAACG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|