Caenorhabditis Genetics Center (CGC)

Search Strains

More Fields
Strain Species Genotype Add
MLC1946 C. elegans tbx-11(luc144) III. Show Description
Wild-type morphology. CRISPR/Cas9 engineered 1.3 kb deletion of the tbx-11 locus. Flanking sequence: aaaaataacaaaataacaaggaatgagaagggaaaacaggaaaaatacac / ttgccacgtgttgggcgggaaaacgcgtagtcatccggcaggtgtaacct Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
OP368 C. elegans unc-119(tm4063) III; wgIs368. Show Description
wgIs368 [tbx-11::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
RW10249 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10218. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10218 [tbx-11::H1-wCherry + unc-119(+)].