Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
HBR1971 C. elegans nlp-42(syb235) V. Show Description
Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type. Primers for crossing: Fwd: cgagacttttaaccccgtcg InFwd: aaagcccatgacttgctgaa Rev: gctcaggtggttagagggtt Wild-type bands: 580bp, 2652bp. Mutation band: 335bp.