| PS1258 |
C. elegans |
sli-1(sy129) X. Show Description
Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS8394 |
C. elegans |
oac-52(sy1290) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-52;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: CTTCAAGGTATTCGAGGTCTTGCTATTACAGTTGT
Right flanking sequence: ACTAGGTTTTCATTTCTATCCAGAAGCTTTTCCC
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTTGCTATTACAGTTGTACT
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8396 |
C. elegans |
frpr-1(sy1292) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-1. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAAACAAGGCAGGTTGTCAAGGAATACGAACAGTTCA right flanking sequence: ATCTGgtgagttaaaacttcaatttagtgctatg Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAATACGAACAGTTCAATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8398 |
C. elegans |
frpr-9(sy1294) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-9. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCCATCAGTATTCAATGATATTCAGGCAACCATTC right flanking sequence: GATTATTCGGAGgtattataaaattctgtttattt inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATACCTCCGAATAATCGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8400 |
C. elegans |
frpr-7(sy1296) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-7. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCTCGCCGTCGACCACCTTCATTGCCTTCATCTTT right flanking sequence: GACTGGGCCCTATACTTCATCCAAATGTTGTCGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCATTGCCTTCATCTTTGAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8426 |
C. elegans |
frpr-13(sy1298) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-13. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: aaaaaatgatgacgctttgatttcagACACCCTTC right flanking sequence: GCAAGAACAGGACAATTCTACGAAAATCGCTCGAT inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATTGTCCTGTTCTTGCGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
