Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-13. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: aaaaaatgatgacgctttgatttcagACACCCTTC right flanking sequence: GCAAGAACAGGACAATTCTACGAAAATCGCTCGAT inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATTGTCCTGTTCTTGCGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616