Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CHS1265 C. elegans str-3(yum1042) str-4(yum2669) str-5(yum2670) str-1(yum2671) str-6(yum2672) str-7(yum2673) str-9(yum2674) c04c3.7(yum2675) str-8(yum2676) t23d5.8(yum2677) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1078 C. elegans str-71(yum1486) str-73(yum1487) V; str-74(yum1488) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1166 C. elegans str-78(yum1987) IV; str-79(yum1988) X; str-81(yum1989) str-82(yum1990) str-83(yum1991) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1278 C. elegans str-63(yum2801) str-64(yum2802) str-66(yum2803) str-61(yum2804) str-67(yum2805) str-68(yum2806) str-69(yum2807) c41g6.12(yum2808) str-52(yum2810) str-60(yum2811) str-71(yum2812) str-73(yum2813) str-74(yum2814) str-77(yum2815) f22f7.12(yum2816) str-76(yum2817) str-265(yum2818) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
PS9504 C. elegans him-5(e1490) V; str-74(sy1802) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of str-74 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGGAATATTGTTTTCGGGAATAGAAATCCTTGC right flanking sequence: CAGACCATTCGCTCATAATTATAACAACAGTTTGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATGAGCGAATGGTCTGGCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616