Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
GA184 C. elegans sod-2(gk257) I. Show Description
Slow growing. Reduced brood size. Hypersensitive to oxidative stress.
RB1072 C. elegans sod-2(ok1030) I. Show Description
F10D11.1 Homozygous. Outer Left Sequence: ACTGCTCGACAGACTCCGAT. Outer Right Sequence: GACGCATTCACCAACAAATG. Inner Left Sequence: TCGAGGCTGGAACTTCAACT. Inner Right Sequence: CCCCTAATAACTGCACCGAA. Inner Primer PCR Length: 2320. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC498 C. elegans sod-2(gk257) I. Show Description
F10D11.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
GA480 C. elegans sod-2(gk257) I; sod-3(tm760) X. Show Description
Slow growing. Reduced brood size. Hypersensitive to oxidative stress.
TM151 C. elegans sod-2(sj173) I; daf-2(e1370) III; sod-3(sj134) X. Show Description
Hypersensitive to Paraquat. Growth arrest under hyperoxia (90% oxygen) at any larval stage. Reference: Honda Y, Tanaka M, Honda S, (2008) Exp Gerontol 43:520-9.
MQ1766 C. elegans sod-2(ok1030) I; sod-5 (tm1146) sod-1(tm783) II; sod-4(gk101) III; sod-3(tm760) X. Show Description
Normal lifespan. Increased sensitivity to oxidative stress, osmotic stress, cold stress, and heat stress. Slow development, slow physiological rates (thrashing, defecation), and reduced fertility. van Raamsdonk J & Hekimi S. Proc Natl Acad Sci U S A. 2012 Apr 10;109(15):5785-90.
GA805 C. elegans wuIs156. Show Description
wuIs156 contains [sod-2(genomic) + rol-6(su1006)]. Rollers.
GLW65 C. elegans sod-2(utx53[mScarlet::3xMyc::sod-2]) I. Show Description
N-terminal tag of SOD-2 via CRISPR/Cas9 knock-in of mScarlet at sod-2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' attgaatattttaattatttgcagccgaaa 3'; Right flank: 5' ATGCTTCAAAACACGGTTCGCTGTGTCTCA 3’ (1 silent mutation); sgRNA: AAGCTTTGAGACACAGCGAA; Cas9/sgRNA plasmid: pGLOW98; mScarlet^SEC^3xMyc plasmid: pGLOW111; SEC insertion allele strain: GLW64.