Caenorhabditis Genetics Center (CGC)

Search Strains

More Fields
Strain Species Genotype Add
BC1977 C. briggsae Cbr-unc(s1275). Show Description
C. briggsae strain. Unc-tends to coil.
CHS1275 C. elegans mgl-1(yum2769) mgl-2(yum2770) mgl-3(yum2771) c30a5.10(yum2772) f35h10.10(yum2773) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
NL2336 C. elegans dpy-20(e1282) IV; pkIs1275. Show Description
pkIs1275 [gpc-2::GFP + dpy-20(+)]. Reporter construct includes 2.3 kbp of upstream sequence and most of the gpc-2 open reading frame. 2.5 kbp PCR fragment generated with primers gpc2-1 (TCTGCAGCACGACGATAATC, extended with a SphI site) and gpc2-2 (GTCGATTGGGTTCACAAGTG, extended with a BamHI site) into vector pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94.