Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
JK6673 C. elegans fzr-1(q1290[3xV5::fzr-1]) II. Show Description
Endogenous fzr-1 locus tagged with 3xV5 close to the N-terminus. Insertion site is a few amino acids downstream of start site (...PAN-3xV5-SPA…). Primer sequences to validate the strain: slc316 GCTTTTGCGTGTTCTCCTCA, slc317 TGAATCCTGAGTCATCATCCGAGT, WT product 347 bp, q1290[3xV5::fzr-1] product 485 bp.