Search Strains

More Fields
Strain Species Genotype Add
RB2522 C. elegans Y39B6A.2(ok3498) V. Show Description
Y39B6A.2 Homozygous. Outer Left Sequence: accggaaattgtcccaaaat. Outer Right Sequence: tttatcttccagccgtggac. Inner Left Sequence: aacagatgacattgtggcga. Inner Right Sequence: attgcggcttcaaacttctg. Inner Primer PCR Length: 1129. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
UDN100161 C. elegans pph-5(udn91) V. Show Description
pph-5 [A48T] #2 variant edit from Fielder, et al. (2022). Includes addition of silent AvaII restriction site and silent PAM ablation. Homozygous viable and superficially wild-type. Genotype using primers Forward: accggaaattgtcccaaaat, Reverse: tttccgactttctggaggtg. Digest with AvaII restriction enzyme for resulting sizes of 401bp +403bp. Wild-type product will not be digested.
UDN100163 C. elegans pph-5(udn93) V. Show Description
pph-5 [A48A] #1 control edit for strain UDN100160 from Fielder, et al. (2022). Wild-type sequence except for addition of silent AvaII restriction site and silent PAM ablation. Homozygous viable and wild-type appearance. Genotype using primers Forward: accggaaattgtcccaaaat, Reverse: tttccgactttctggaggtg. Digest with AvaII restriction enzyme for resulting sizes of 401bp +403bp. Wild-type product will not be digested.