Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
GJ7 C. elegans gpa-2(pk16) gpa-3(pk35) gpa-13(pk1270) V; gpa-5(pk376) gpa-6(pk480) X. Show Description
Lans H, et al. Genetics. 2004 Aug;167(4):1677-87.
NL334 C. elegans gpa-2(pk16) V. Show Description
Reduced response to exogenously added dauer pheromone and thus defective in the regulation of dauer formation.
NL348 C. elegans gpa-2(pk16) gpa-3(pk35) V. Show Description
Reduced response to exogenously added dauer pheromone and thus defective in the regulation of dauer formation.
NL3531 C. elegans rde-2(pk1657) I. Show Description
Mutator. Flanking sequence: cctatgatcatattattgacgactttagtc aatggcaaagaaagagtttttaaatgtcat. AKA mut-8.Mutator. Flanking sequence: cctatgatcatattattgacgactttagtc aatggcaaagaaagagtttttaaatgtcat.Mutator.
NL4266 C. elegans nucb-1(pk1654) Show Description
NL5117 C. elegans ppw-2(pk1673) I. Show Description