Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
EG199 C. elegans nas-37(ox199) X. Show Description
At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA.