Search Strains

More Fields
Strain Species Genotype Add
EG199 C. elegans nas-37(ox199) X. Show Description
At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA.
EG3283 C. elegans nas-37(tm410) X. Show Description
At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Deletion. Flanking sequences: ttcttgtccagtagggtctagtcgtggttg tgaacttgcctgtcgatgtcttctggctga.
VC2608 C. elegans nas-37(ok3384) X. Show Description
C17G1.6. External left primer: GGCAGTTTGTCTTTTCACCC. External right primer: CAGAAGACATCGACAGGCAA. Internal left primer: TCTTGTGCTTGATGAGAGGAA. Internal right primer: CGTTCCGAAGGAGATGATGT. Internal WT amplicon: 1326 bp. Deletion size: 484 bp. Deletion left flank: GAATCTTTCTGTTGGTGGATGAACTTCCAA. Deletion right flank: GCTGTATCTGGAGCAACTGTCGTCGTCGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
JDW436 C. elegans nas-37(wrd106[nas-37:::mNG::3xFLAG]) X. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous nas-37 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW708 C. elegans nas-37(wrd106 wrd251[nas-37::mScarlet::2xOLLAS]) X. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous nas-37 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd106.