Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
BN498 C. elegans bqSi294 II; bqSi487 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi487 [mec-7p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in mechanosensory neurons and red nuclei elsewhere.
DG1856 C. elegans goa-1(sa734) I. Show Description
Recessive, early stop mutation within the coding sequence (C to T substitution in aa52) makes sa734 a likely null allele. May grow slightly better at 15C. Hyperactive, lays early stage eggs, increased amplitude of locomotory wave-form. Suppresses the lethargy and egg-laying defects of unc-43(n498). Reverses direction of locomotion more frequently than WT.
JT603 C. elegans gpb-2(sa603) I. Show Description
Recessive, loss of function, early stop mutation within the coding sequence makes sa603 a likely null allele. Variable locomotion ranging from lethargic to hyperactive. Eat (pale, scrawny). Loopy movement - increased amplitude of locomotory wave-form (variable). Suppresses the enteric muscle contraction (EMC) defect, the lethargy and egg-laying defects of unc-43(n498).
JT609 C. elegans eat-16(sa609) I. Show Description
Recessive. Loss of function. Hyperactive, lays early stage eggs. Suppresses the enteric muscle contraction (EMC) defect, the lethargy and the egg-laying defects of unc-43(n498).
JT734 C. elegans goa-1(sa734) I. Show Description
Recessive, early stop mutation within the coding sequence (C to T substitution in aa52) makes sa734 a likely null allele. May grow slightly better at 15C. Hyperactive, lays early stage eggs, increased amplitude of locomotort wave-form. Suppresses the lethargy and egg-laying defects of unc-43(n498). Reverses direction of locomotion more frequently than WT.
JT748 C. elegans dgk-1(sa748) X. Show Description
Recessive. Loss of function. Hyperactive, lays early stage eggs. Suppresses both the lethargy and egg-laying defect of unc-43(n498).
MT1092 C. elegans unc-43(n498) IV. Show Description
Gain of function allele. Small, almost paralyized. Egl. Semi-dominant. daf-C at 27C.
PJ1182 C. elegans unc-43(n498) IV; ccIs55 V; njEx38. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. unc-43 gain-of-function. Progressive paralysis.
XM1007 C. elegans fog-3(q443) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); unc-43(n498) IV. Show Description
Heterozygotes are Unc with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous unc-43(n498); fog-3(q443) animals are females.
MT16848 C. elegans mir-249(n4983) X. Show Description
Deletion breakpoints are:TGCCAACTGGATTGAACAAAACAACT / TGCACACAAGAGAGAGGTCCACCTAGCAA...AGATAAGTCGTACATCACTTTAT / CTGTTTAATGGATTAGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT2598 C. elegans unc-43(n498n1179) IV. Show Description
MT2605 C. elegans unc-43(n498n1186) IV. Show Description
PJ1305 C. elegans unc-43(n498j038) IV; ccIs55; njEx38. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. unc-43 gain-of-function suppressed; not markedly small. Egl-d. Lethal @ 25C; short L1's do not survive. No GFP expression.