Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
MT355 C. elegans lin-14(n355) X. Show Description
Semi-dominant.
RM523 C. elegans unc-17(cn355) IV. Show Description
cn355 behaves like other unc-17 hypomorphs (coily Unc, slow growth, aldicarb-resistant, etc.); however, the mutation is in the splice site necessary for generating unc-17 transcripts, so that unc-17 transcripts and UNC-17 protein are dramatically reduced (hence the unc-17 behavioral phenotypes), and the cha-1 transcripts, CHA-1 protein, and ChAT enzyme activity are significantly increased (Mathews et al., 2015). Note: UNC-17 and CHA-1 protein sequences are both completely wild-type; the phenotypes derive from the extremely low level of the (wild-type) UNC-17 protein. Flanking Sequences: AAATTTAGAAAAAATAAAATATTCC/ A>G /GGGGGAGAGAGAGAGATGGGCTTCA (in direction of transcription). Reference: Mathews EA, et al. Genetics. 2015 Mar;199(3):729-37.
MT1147 C. elegans lin-14(n355n534) X. Show Description
Revertant.
MT1388 C. elegans lin-14(n355n679) X. Show Description
Intragenic revertant of gain-of-function allele n355sd. At 15C: retarded heterochronic developmental defects. At 25C: precocious heterochronic developmental defects.
MT925 C. elegans lin-14(n355n407) X. Show Description