| MTG823 |
C. elegans |
fum-1(mod554[(G388R) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III)]). Show Description
Human variant model. Homozygous inviable. Homozygous lethal mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP fum-1 homozygotes (larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.. fum-1(mod[G388R]) is a CRISPR/Cas9-engineered missense allele mimicking a human clinical variant in an N2 background. sgRNA: AATCAAGTTGCAGTCAGTGT. ssODN: ACGATAAGTGGCTTGAAAACATTCAACTCGAAATGTCCATTTGATCCACGTACACTGACTGCAACTTGATTTCCCATAACTTGAGCGGCAACCATTGTGA. Reference: Ferris S, et al. Genet Med Open. 2025 Nov 1:3:103469. doi: 10.1016/j.gimo.2025.103469. PMID: 41438304. |
|
