| MT14446 |
C. elegans |
mir-228(n4382) IV. Show Description
Deletion breakpoints are: GTACACAGAACAATAGAAATCGCCT / CGTTTCTGTTT...CTACGATATTAT / GTCCGAATTAAATTGCTTTTTTTTTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MJS209 |
C elegans |
unc-119(ed3) III; qbcSi9 IV. Show Description
qbcSi9 [mex-5p::GFP::his-58::3XmiR-228::tbb-2 3UTR + unc-119(+)] IV. Germline-specific miR-228 miRNA GFP reporter. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.
|
|
| MJS210 |
C elegans |
unc-119(ed3) III; qbcSi10 IV. Show Description
qbcSi10 [mex-5p::GFP::his-58::3XmiR-228(mut)::tbb-2 3UTR + unc-119(+)] IV. Germline-specific miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.
|
|
| MJS276 |
C elegans |
unc-119(ed3) III; qbcSi12 IV. Show Description
qbcSi112 [elt-2p::GFP::his-58::3XmiR-228(mut)::tbb-2 3UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.
|
|
| MJS277 |
C elegans |
unc-119(ed3) III; qbcSi11 IV. Show Description
qbcSi11 [elt-1p::GFP::his-58::3XmiR-228::tbb-2 3UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.
|
|
| OH17801 |
C. elegans |
him-5(e1490) V; otIs870. Show Description
otIs870 [mir-228p::3xNLS::TagRFP] Pan-glial expression of tagRFP reporter. Him. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
|
|
| VT1485 |
C. elegans |
unc-119(ed3) III; maIs188. Show Description
maIs188 [mir-228p::GFP + unc-119(+)]. Wild type.
|
|